Myxinidin-Derived Peptide against Biofilms Caused by Cystic Fibrosis Emerging Pathogens
Abstract
1. Introduction
2. Results
2.1. WMR Serum Stability and Design of Novel Analogues
2.2. Minimal Inhibitory Concentration (MIC)
2.3. Serum Stability of the Analogue WMR-4
2.4. Biofilm Formation Assay and Antibiofilm Activity
2.5. RT-PCR
2.6. In Vivo Toxicity and Activity of the Peptide on the Infected G. mellonella
2.7. Peptide Secondary Structure
2.8. Interaction of WMR-4 with Lipopolysaccharide (LPS)
2.9. WMR-4: Liposome Insertion and Leakage
3. Materials and Methods
3.1. Peptide Synthesis
3.2. Strains and Cultural Conditions
3.3. Minimum Inhibitory Concentration (MIC)
3.4. Proteolitic Stability
3.5. Biofilm Formation Assay
3.6. Antibiofilm Activity
3.7. Quantitative Real Time PCR
3.8. In Vivo Effect of WMR-4 on Galleria mellonella Larvae
3.9. Statistical Analyses
3.10. Circular Dichroism (CD) Spectroscopy
3.11. Liposome Preparations
3.12. Peptide Aggregation by Thioflavin T Assay
3.13. Liposomes Leakage by ANT/DPX Assay
3.14. Tryptophan Quenching by Acrylamide
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Allan, K.M.; Farrow, N.; Donnelley, M.; Jaffe, A.; Waters, S.A. Treatment of cystic fibrosis: From gene- to cell-based therapies. Front. Pharmacol. 2021, 12, 639475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boucher, R.C. New concepts of the pathogenesis of cystic fibrosis lung disease. Eur. Respir. J. 2004, 23, 146–158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cutting, G.R. Cystic fibrosis genetics: From molecular understanding to clinical application. Nat. Rev. Genet. 2015, 16, 45–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valenza, G.; Tappe, D.; Turnwald, D.; Frosch, M.; König, C.; Hebestreit, H.; Abele-Horn, M. Prevalence and antimicrobial susceptibility of microorganisms isolated from sputa of patients with cystic fibrosis. J. Cyst. Fibros. 2008, 7, 123–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kreda, S.M.; Davis, C.W.; Rose, M.C. CFTR, mucins, and mucus obstruction in cystic fibrosis. Cold Spring Harb. Perspect. Med. 2012, 2, a009589. [Google Scholar] [CrossRef] [Scilit]
- Ciofu, O.; Hansen, C.R.; Høiby, N. Respiratory bacterial infections in cystic fibrosis. Curr. Opin. Pulm. Med. 2013, 19, 251–258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cantin, A.M.; Hartl, D.; Konstan, M.W.; Chmiel, J.F. Inflammation in cystic fibrosis lung disease: Pathogenesis and therapy. J. Cyst. Fibros. 2015, 14, 419–430. [Google Scholar] [CrossRef] [Scilit]
- Kidd, T.J.; Canton, R.; Ekkelenkamp, M.; Johansen, H.K.; Gilligan, P.; LiPuma, J.J.; Bell, S.C.; Elborn, J.S.; Flume, P.A.; VanDevanter, D.R.; et al. Defining antimicrobial resistance in cystic fibrosis. J. Cyst. Fibros. 2018, 17, 696–704. [Google Scholar] [CrossRef] [Scilit]
- Jennings, L.K.; Dreifus, J.E.; Reichhardt, C.; Storek, K.M.; Secor, P.R.; Wozniak, D.J.; Hisert, K.B.; Parsek, M.R. Pseudomonas aeruginosa aggregates in cystic fibrosis sputum produce exopolysaccharides that likely impede current therapies. Cell Rep. 2021, 34, 108782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- López-Causapé, C.; Rojo-Molinero, E.; Macià, M.D.; Oliver, A. The problems of antibiotic resistance in cystic fibrosis and solutions. Expert Rev. Respir. Med. 2015, 9, 73–88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sherrard, L.J.; Tunney, M.M.; Elborn, J.S. Antimicrobial resistance in the respiratory microbiota of people with cystic fibrosis. Lancet 2014, 384, 703–713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blanchard, A.C.; Waters, V.J. Microbiology of cystic fibrosis airway disease. Semin. Respir. Crit. Care Med. 2019, 40, 727–736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cystic Fibrosis Foundation. Patient Registry 2020 Annual Data Report; Cystic Fibrosis Foundation: Bethesda, MD, USA, 2021; Available online: https://www.cff.org/sites/default/files/2021-11/Patient-Registry-Annual-Data-Report.pdf (accessed on 1 February 2023).
- Menetrey, Q.; Sorlin, P.; Jumas-Bilak, E.; Chiron, R.; Dupont, C.; Marchandin, H. Achromobacter xylosoxidans and Stenotrophomonas maltophilia: Emerging pathogens well-armed for life in the cystic fibrosis patients’ lung. Genes 2021, 12, 610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Díez-Aguilar, M.; Ekkelenkamp, M.; Morosini, M.I.; Merino, I.; de Dios Caballero, J.; Jones, M.; van Westreenen, M.; Tunney, M.M.; Cantón, R.; Fluit, A.C. Antimicrobial susceptibility of non-fermenting Gram-negative pathogens isolated from cystic fibrosis patients. Int. J. Antimicrob. Agents. 2019, 53, 84–88. [Google Scholar] [CrossRef] [Scilit]
- Isler, B.; Kidd, T.J.; Stewart, A.G.; Harris, P.; Paterson, D.L. Achromobacter infections and treatment options. Antimicrob. Agents Chemother. 2020, 64, e01025-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spilker, T.; Vandamme, P.; Lipuma, J.J. A multilocus sequence typing scheme implies population structure and reveals several putative novel Achromobacter species. J. Clin. Microbiol. 2012, 50, 3010–3015. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Swenson, C.E.; Sadikot, R.T. Achromobacter respiratory infections. Ann. Am. Thorac. Soc. 2015, 12, 252–258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoyle, N.; Zhvaniya, P.; Balarjishvili, N.; Bolkvadze, D.; Nadareishvili, L.; Nizharadze, D.; Wittmann, J.; Rohde, C.; Kutateladze, M. Phage therapy against Achromobacter xylosoxidans lung infection in a patient with cystic fibrosis: A case report. Res. Microbiol. 2018, 169, 540–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raidt, L.; Idelevich, E.A.; Dübbers, A.; Küster, P.; Drevinek, P.; Peters, G.; Kahl, B.C. Increased prevalence and resistance of important pathogens recovered from respiratory specimens of cystic fibrosis patients during a decade. Pediatr. Infect. Dis. J. 2015, 34, 700–705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amoureux, L.; Bador, J.; Verrier, T.; Mjahed, H.; DE Curraize, C.; Neuwirth, C. Achromobacter xylosoxidans is the predominant Achromobacter species isolated from diverse non-respiratory samples. Epidemiol. Infect. 2016, 144, 3527–3530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gade, S.S.; Nørskov-Lauritsen, N.; Ridderberg, W. Prevalence and species distribution of Achromobacter sp. cultured from cystic fibrosis patients attending the Aarhus centre in Denmark. J. Med. Microbiol. 2017, 66, 686–689. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Veschetti, L.; Sandri, A.; Krogh Johansen, H.; Lleò, M.M.; Malerba, G. Hyper-mutation as an evolutionary mechanism for Achromobacter xylosoxidans in cystic fibrosis lung infection. Pathogens 2020, 9, 72. [Google Scholar] [CrossRef] [Scilit]
- De Baets, F.; Schelstraete, P.; Van Daele, S.; Haerynck, F.; Vaneechoutte, M. Achromobacter xylosoxidans in cystic fibrosis: Prevalence and clinical relevance. J. Cyst. Fibros. 2007, 6, 75–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amin, R.; Waters, V. Antibiotic treatment for Stenotrophomonas maltophilia in people with cystic fibrosis. Cochrane Database Syst Rev. 2016, 7, CD009249. [Google Scholar]
- Gallagher, T.; Phan, J.; Oliver, A.; Chase, A.B.; England, W.E.; Wandro, S.; Hendrickson, C.; Riedel, S.F.; Whiteson, K. Cystic fibrosis-associated Stenotrophomonas maltophilia strain-specific adaptations and responses to pH. J. Bacteriol. 2019, 201, e00478-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goss, C.H.; Mayer-Hamblett, N.; Aitken, M.L.; Rubenfeld, G.D.; Ramsey, B.W. Association between Stenotrophomonas maltophilia and lung function in cystic fibrosis. Thorax 2004, 59, 955–959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sibley, C.D.; Parkins, M.D.; Rabin, H.R.; Duan, K.; Norgaard, J.C.; Surette, M.G. A polymicrobial perspective of pulmonary infections exposes an enigmatic pathogen in cystic fibrosis patients. Proc. Natl. Acad. Sci. USA 2008, 105, 15070–15075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Brien, T.J.; Welch, M. Recapitulation of polymicrobial communities associated with cystic fibrosis airway infections: A perspective. Future Microbiol. 2019, 14, 1437–1450. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delhaes, L.; Monchy, S.; Fréalle, E.; Hubans, C.; Salleron, J.; Leroy, S.; Prevotat, A.; Wallet, F.; Wallaert, B.; Dei-Cas, E.; et al. The airway microbiota in cystic fibrosis: A complex fungal and bacterial community-implications for therapeutic management. PLoS ONE 2012, 7, e36313. [Google Scholar] [CrossRef] [Scilit]
- Chotirmall, S.H.; O’Donoghue, E.; Bennett, K.; Gunaratnam, C.; O’Neill, S.J.; McElvaney, N.G. Sputum Candida albicans presages FEV1 decline and hospital-treated exacerbations in cystic fibrosis. Chest 2010, 138, 1186–1195. [Google Scholar] [CrossRef] [Scilit]
- Gileles-Hillel, A.; Shoseyov, D.; Polacheck, I.; Korem, M.; Kerem, E.; Cohen-Cymberknoh, M. Association of chronic Candida albicans respiratory infection with a more severe lung disease in patients with cystic fibrosis. Pediatr. Pulmonol. 2015, 50, 1082–1089. [Google Scholar] [CrossRef] [Scilit]
- Haiko, J.; Saeedi, B.; Bagger, G.; Karpati, F.; Özenci, V. Coexistence of Candida species and bacteria in patients with cystic fibrosis. Eur. J. Clin. Microbiol. Infect. Dis. 2019, 38, 1071–1077. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keown, K.; Reid, A.; Moore, J.E.; Taggart, C.C.; Downey, D.G. Coinfection with Pseudomonas aeruginosa and Aspergillus fumigatus in cystic fibrosis. Eur. Respir. Rev. 2020, 29, 200011. [Google Scholar] [CrossRef] [Scilit]
- Roscetto, E.; Bellavita, R.; Paolillo, R.; Merlino, F.; Molfetta, N.; Grieco, P.; Buommino, E.; Catania, M.R. Antimicrobial activity of a lipidated Temporin L analogue against carbapenemase-producing Klebsiella pneumoniae clinical isolates. Antibiotics 2021, 10, 1312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bellavita, R.; Vollaro, A.; Catania, M.R.; Merlino, F.; De Martino, L.; Nocera, F.P.; DellaGreca, M.; Lembo, F.; Grieco, P.; Buommino, E. Novel antimicrobial peptide from Temporin L in the treatment of Staphylococcus pseudintermedius and Malassezia pachydermatis in polymicrobial inter-kingdom infection. Antibiotics 2020, 9, 530. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Parente, J.; Harris, S.M.; Woods, D.E.; Hancock, R.E.; Falla, T.J. Antimicrobial peptide therapeutics for cystic fibrosis. Antimicrob. Agents Chemother. 2005, 49, 2921–2927. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Song, Y. Mechanism of antimicrobial peptides: Antimicrobial, anti-inflammatory and antibiofilm activities. Int. J. Mol. Sci. 2021, 22, 11401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, C.I.; Schaller-Bals, S.; Paul, K.P.; Wahn, U.; Bals, R. Beta-defensins and LL-37 in bronchoalveolar lavage fluid of patients with cystic fibrosis. J. Cyst. Fibros. 2004, 3, 45–50. [Google Scholar] [CrossRef] [Scilit]
- Cabak, A.; Hovold, G.; Petersson, A.C.; Ramstedt, M.; Påhlman, L.I. Activity of airway antimicrobial peptides against cystic fibrosis pathogens. Pathog. Dis. 2020, 78, ftaa048. [Google Scholar] [CrossRef] [Scilit]
- Martin, I.; Waters, V.; Grasemann, H. Approaches to targeting bacterial biofilms in cystic fibrosis airways. Int. J. Mol. Sci. 2021, 22, 2155. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.; Mangoni, M.L.; Di, Y.P. In vivo therapeutic efficacy of frog skin-derived peptides against Pseudomonas aeruginosa-induced pulmonary infection. Sci. Rep. 2017, 7, 8548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferrera, L.; Cappiello, F.; Loffredo, M.R.; Puglisi, E.; Casciaro, B.; Botta, B.; Galietta, L.J.V.; Mori, M.; Mangoni, M.L. Esc peptides as novel potentiators of defective cystic fibrosis transmembrane conductance regulator: An unprecedented property of antimicrobial peptides. Cell. Mol. Life Sci. 2021, 79, 67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dalcin, D.; Ulanova, M. The role of human beta-defensin-2 in Pseudomonas aeruginosa pulmonary infection in cystic fibrosis patients. Infect. Dis. Ther. 2013, 2, 159–166. [Google Scholar] [CrossRef] [Scilit]
- Scudiero, O.; Galdiero, S.; Nigro, E.; Del Vecchio, L.; Di Noto, R.; Cantisani, M.; Colavita, I.; Galdiero, M.; Cassiman, J.J.; Daniele, A.; et al. Chimeric beta-defensin analogs, including the novel 3NI analog, display salt-resistant antimicrobial activity and lack toxicity in human epithelial cell lines. Antimicrob. Agents Chemother. 2013, 57, 1701–1708. [Google Scholar] [CrossRef] [Scilit]
- Ben Hur, D.; Kapach, G.; Wani, N.A.; Kiper, E.; Ashkenazi, M.; Smollan, G.; Keller, N.; Efrati, O.; Shai, Y. Antimicrobial peptides against multidrug-resistant Pseudomonas aeruginosa biofilm from cystic fibrosis patients. J. Med. Chem. 2022, 65, 9050–9062. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Wang, N.; Zhang, W.; Cheng, X.; Yan, Z.; Shao, G.; Wang, X.; Wang, R.; Fu, C. Therapeutic peptides: Current applications and future directions. Signal Transduct. Target. Ther. 2022, 7, 48. [Google Scholar] [CrossRef] [Scilit]
- Del Genio, V.; Bellavita, R.; Falanga, A.; Hervé-Aubert, K.; Chourpa, I.; Galdiero, S. Peptides to overcome the limitations of current anticancer and antimicrobial nanotherapies. Pharmaceutics 2022, 14, 1235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, J.; Xu, H.; Xia, J.; Ma, J.; Xu, J.; Li, Y.; Feng, J. D- and unnatural amino acid substituted antimicrobial peptides with improved proteolytic resistance and their proteolytic degradation characteristics. Front. Microbiol. 2020, 11, 563030. [Google Scholar] [CrossRef] [Scilit]
- Boto, A.; González, C.C.; Hernández, D.; Romero-Estudillo, I.; Saavedra, C.J. Site-selective modification of peptide backbones. Org. Chem. Front. 2021, 8, 6720–6759. [Google Scholar] [CrossRef] [Scilit]
- White, C.J.; Yudin, A.K. Contemporary strategies for peptide macrocyclization. Nat. Chem. 2011, 3, 509–524. [Google Scholar] [CrossRef] [Scilit]
- Cantisani, M.; Leone, M.; Mignogna, E.; Kampanaraki, K.; Falanga, A.; Morelli, G.; Galdiero, M.; Galdiero, S. Structure-activity relations of myxinidin, an antibacterial peptide derived from the epidermal mucus of hagfish. Antimicrob. Agents Chemother. 2013, 57, 5665–5673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Falanga, A.; Maione, A.; La Pietra, A.; de Alteriis, E.; Vitale, S.; Bellavita, R.; Carotenuto, R.; Turrà, D.; Galdiero, S.; Galdiero, E.; et al. Competitiveness during dual-species biofilm formation of Fusarium oxysporum and Candida albicans and a novel treatment strategy. Pharmaceutics 2022, 14, 1167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maione, A.; Bellavita, R.; de Alteriis, E.; Galdiero, S.; Albarano, L.; La Pietra, A.; Guida, M.; Parrilli, E.; D’Angelo, C.; Galdiero, E.; et al. WMR peptide as antifungal and antibiofilm against albicans and non-albicans Candida species: Shreds of evidence on the mechanism of action. Int. J. Mol. Sci. 2022, 23, 2151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamaguchi, H.; Kodama, H.; Osada, S.; Kato, F.; Jelokhani-Niaraki, M.; Kondo, M. Effect of alpha, alpha-dialkyl amino acids on the protease resistance of peptides. Biosci. Biotechnol. Biochem. 2003, 67, 2269–2272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zikou, S.; Koukkou, A.I.; Mastora, P.; Sakarellos-Daitsiotis, M.; Sakarellos, C.; Drainas, C.; Panou-Pomonis, E. Design and synthesis of cationic Aib-containing antimicrobial peptides: Conformational and biological studies. J. Pept. Sci. 2007, 13, 481–486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Filler, S.G. Candida albicans Als3, a multifunctional adhesin and invasin. Eukaryot. Cell 2011, 10, 168–173. [Google Scholar] [CrossRef] [Scilit]
- Kovács, R.; Majoros, L. Fungal Quorum-Sensing Molecules: A review of their antifungal effect against Candida biofilms. J. Fungi 2020, 6, 99. [Google Scholar] [CrossRef] [Scilit]
- Azimi, A.; Aslanimehr, M.; Yaseri, M.; Shadkam, M.; Douraghi, M. Distribution of smf-1, rmlA, spgM and rpfF genes among Stenotrophomonas maltophilia isolates in relation to biofilm-forming capacity. J. Glob. Antimicrob. Resist. 2020, 23, 321–326. [Google Scholar] [CrossRef] [Scilit]
- Ronald, P.C. Small protein-mediated quorum sensing in a gram-negative bacterium: Novel targets for control of infectious disease. Discov. Med. 2011, 12, 461–470. [Google Scholar]
- Nielsen, S.M.; Penstoft, L.N.; Nørskov-Lauritsen, N. Motility, biofilm formation and antimicrobial efflux of sessile and planktonic cells of Achromobacter xylosoxidans. Pathogens 2019, 8, 14. [Google Scholar] [CrossRef] [Scilit]
- Cutuli, M.A.; Petronio Petronio, G.; Vergalito, F.; Magnifico, I.; Pietrangelo, L.; Venditti, N.; Di Marco, R. Galleria mellonella as a consolidated in vivo model hosts: New developments in antibacterial strategies and novel drug testing. Virulence 2019, 10, 527–541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sinha, S.; Zheng, L.; Mu, Y.; Ng, W.J.; Bhattacharjya, S. Structure and interactions of a host defense antimicrobial peptide Thanatin in lipopolysaccharide micelles reveal mechanism of bacterial cell agglutination. Sci. Rep. 2017, 7, 17795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Christiaens, B.; Symoens, S.; Verheyden, S.; Engelborghs, Y.; Joliot, A.; Prochiantz, A.; Vandekerckhove, J.; Rosseneu, M.; Vanloo, B. Tryptophan fluorescence study of the interaction of penetratin peptides with model membranes. Eur. J. Biochem. 2002, 269, 2918–2926. [Google Scholar] [CrossRef] [Scilit]
- Yousif, A.M.; Ingangi, V.; Merlino, F.; Brancaccio, D.; Minopoli, M.; Bellavita, R.; Novellino, E.; Carriero, M.V.; Carotenuto, A.; Grieco, P. Urokinase receptor derived peptides as potent inhibitors of the formyl peptide receptor type 1-triggered cell migration. Eur. J. Med. Chem. 2018, 143, 348–360. [Google Scholar] [CrossRef] [Scilit]
- Zannella, C.; Chianese, A.; Palomba, L.; Marcocci, M.E.; Bellavita, R.; Merlino, F.; Grieco, P.; Folliero, V.; De Filippis, A.; Mangoni, M.; et al. Broad-spectrum antiviral activity of the amphibian antimicrobial peptide Temporin L and its analogs. Int. J. Mol. Sci. 2022, 23, 2060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wikler, M.A. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically: Approved standard. CLSI 2006, 26, M7-A7. [Google Scholar]
- Fothergill, A.W. Antifungal susceptibility testing: Clinical laboratory and standards institute (CLSI) methods. In Interactions of Yeasts, Moulds, and Antifungal Agents: How to Detect Resistance, 2012 ed.; Gerri, S.H., Ed.; Springer: Berlin/Heidelberg, Germany, 2012; pp. 65–74. [Google Scholar]
- Bellavita, R.; Casciaro, B.; Di Maro, S.; Brancaccio, D.; Carotenuto, A.; Falanga, A.; Cappiello, F.; Buommino, E.; Galdiero, S.; Novellino, E.; et al. First-in-class cyclic Temporin L analogue: Design, synthesis, and antimicrobial assessment. J. Med. Chem. 2021, 64, 11675–11694. [Google Scholar] [CrossRef] [Scilit]
- Stepanovic, S.; Vukovic, D.; Dakic, I.; Savic, B.; Svabic-Vlahovic, M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods 2000, 40, 175–179. [Google Scholar] [CrossRef] [Scilit]
- Stepanovic, S.; Vukovic, D.; Hola, V.; Bonaventura, G.D.; Djukic, S.; Cirković, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 2007, 115, 891–899. [Google Scholar] [CrossRef] [Scilit]
- Maione, A.; La Pietra, A.; de Alteriis, E.; Mileo, A.; De Falco, M.; Guida, M.; Galdiero, E. Effect of myrtenol and its synergistic interactions with antimicrobial drugs in the inhibition of single and mixed biofilms of Candida auris and Klebsiella pneumoniae. Microorganisms 2022, 10, 1773. [Google Scholar] [CrossRef] [Scilit]
- Nielsen, S.M.; Meyer, R.L.; Nørskov-Lauritsen, N. Differences in gene expression profiles between early and late isolates in monospecies Achromobacter biofilm. Pathogens 2017, 6, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maione, A.; de Alteriis, E.; Carraturo, F.; Galdiero, S.; Falanga, A.; Guida, M.; Di Cosmo, A.; Maselli, V.; Galdiero, E. The membranotropic peptide gH625 to combat mixed Candida albicans/Klebsiella pneumoniae biofilm: Correlation between in vitro anti-biofilm activity and in vivo antimicrobial protection. J. Fungi 2021, 7, 26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bellavita, R.; Maione, A.; Merlino, F.; Siciliano, A.; Dardano, P.; De Stefano, L.; Galdiero, S.; Galdiero, E.; Grieco, P.; Falanga, A. Antifungal and antibiofilm activity of cyclic Temporin L peptide analogues against albicans and non-albicans Candida species. Pharmaceutics 2022, 14, 454. [Google Scholar] [CrossRef] [Scilit]
- de Alteriis, E.; Maione, A.; Falanga, A.; Bellavita, R.; Galdiero, S.; Albarano, L.; Salvatore, M.M.; Galdiero, E.; Guida, M. Activity of free and liposome-encapsulated essential oil from Lavandula angustifolia against persister-derived biofilm of Candida auris. Antibiotics 2021, 11, 26. [Google Scholar] [CrossRef] [Scilit]
- Bellavita, R.; Falanga, A.; Buommino, E.; Merlino, F.; Casciaro, B.; Cappiello, F.; Mangoni, M.L.; Novellino, E.; Catania, M.R.; Paolillo, R.; et al. Novel temporin L antimicrobial peptides: Promoting self-assembling by lipidic tags to tackle superbugs. J. Enzym. Inhib. Med. Chem. 2020, 35, 1751–1764. [Google Scholar] [CrossRef] [Scilit]
- Bellavita, R.; Annarita, F.; Merlino, F.; D’Auria, G.; Molfetta, N.; Saviano, A.; Maione, F.; Galdiero, U.; Catania, M.R.; Stefania, G.; et al. Unveiling the mechanism of action of acylated temporin L analogues against multidrug-resistant Candida albicans. J. Enzym. Inhib. Med. Chem. 2023, 38, 36–50. [Google Scholar] [CrossRef] [Scilit]
- Engel, M.F.M.; Khemtémourian, L.; Kleijer, C.C.; Meeldijk, H.J.; Jacobs, J.; Verkleij, A.J.; de Kruijff, B.; Killian, J.A.; Höppener, J.W.M. Membrane damage by human islet amyloid polypeptide through fibril growth at the membrane. Proc. Natl. Acad. Sci. USA 2008, 105, 6033–6038. [Google Scholar] [CrossRef] [Scilit]
- Del Genio, V.; Falanga, A.; Allard-Vannier, E.; Hervé-Aubert, K.; Leone, M.; Bellavita, R.; Uzbekov, R.; Chourpa, I.; Galdiero, S. Design and validation of nanofibers made of self-assembled peptides to become multifunctional stimuli-sensitive nanovectors of anticancer drug doxorubicin. Pharmaceutics 2022, 14, 1544. [Google Scholar] [CrossRef] [Scilit]
- Xue, C.; Lin, T.Y.; Chang, D.; Guo, Z. Thioflavin T as an amyloid dye: Fibril quantification, optimal concentration and effect on aggregation. R. Soc. Open. Sci. 2017, 4, 160696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ladokhin, A.S.; Wimley, W.C.; White, S.H. Leakage of membrane vesicle contents: Determination of mechanism using fluorescence requenching. Biophys. J. 1995, 69, 1964–1971. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parente, R.A.; Nir, S.; Szoka, F.C., Jr. Mechanism of leakage of phospholipid vesicle contents induced by the peptide GALA. Biochemistry 1990, 29, 8720–8728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tallmadge, D.H.; Huebner, J.S.; Borkman, R.F. Acrylamide quenching of tryptophan photochemistry and photophysics. Photochem. Photobiol. 1989, 49, 381–386. [Google Scholar] [CrossRef] [Scilit]
- De Kroon, A.I.P.M.; Soekarjo, M.W.; De Gier, J.; De Kruijff, B. The role of charge and hydrophobicity in peptide-lipid interaction: A comparative study based on tryptophan fluorescence measurements combined with the use of aqueous and hydrophobic quenchers. Biochemistry 1990, 29, 8229–8240. [Google Scholar] [CrossRef] [Scilit] [PubMed]













| MW (Da) | Fragment * |
|---|---|
| 1760.15 | NH2-WGIRRILKYGKRSK-CONH2 |
| 1443.86 | NH2-WGIRRILKYGKRS(K)-CONH2 |
| 1543.86 | NH2-WGIRRILKYGKR(SK)-CONH2 |
| 1361.80 | NH2-(W)GIRRILKYGKRSK-CONH2 |
| Name | Sequence |
|---|---|
| WMR | NH2-WGIRRILKYGKRSK-CONH2 |
| WMR-1 | NH2-WGIRRILKYGKRSk-CONH2 |
| WMR-2 | NH2-WGIRRILKYGKRsK-CONH2 |
| WMR-3 | NH2-WAibIRRILKYGKRSKCONH2 |
| WMR-4 | NH2-WAibIRRILKYGKRskCONH2 |
| WMR-5 | NH2-WGIRRILKYGKRSDapCONH2 |
| MIC (mM) | ||||||||
|---|---|---|---|---|---|---|---|---|
| WMR | WMR-1 | WMR-2 | WMR-3 | WMR-4 | WMR-5 | FLC (µg/mL) | MEM (µg/mL) | |
| C. albicans ATCC 90028 | >50 | >50 | >50 | >50 | 50 | >50 | 16 (48) | - |
| A. xylosoxidans DSM 2402 | 50 | >50 | >50 | >50 | 25 | 25 | - | 65 (250) |
| S. maltophilia DSM 50170 | 50 | >50 | >50 | >50 | 25 | 25 | - | 130 (499) |
| Micro-Organism | Primer | Primer Sequence (5′->3′) |
|---|---|---|
| A. xylosoxidans | Usp-A |
F: CCACGAAGATCCGTACCAGG R: AGGCCTTCTTGCGGTACAC |
| AxyA | F: CTGGAAGACGGGTCGCAATA R: TGAGTTCACGCAGTTCCACT | |
| espF | F: GCGTTCATCTATCCGGCCAT R: TGATCTCCATGATCGGCAGC | |
| rRNA16S | F: GCAGCAGTGGGGAATTTTGG R: ATTTCACTGCTACACGCGGA | |
| S. maltophilia | smf-1 | F: GGAAGGTATGTCCGAGTCCG R: GCGGGTACGGCTACGATCAGTT |
| Ax21 | F: GGCTACAACGTCGAAATCGC R: ATTCTTCAGCTCGCCGTTCA | |
| xanB | F: TATGCGATCGATGCGTCCAA R: CGAATGCGATCTCTTCGGGA | |
| rpfF | F: CTGGTCGACATCGTGGTG R: TGATCCGCATCATTTCATGC | |
| rRNA 16s | F: ACTGAGACACGGTCCAGACT R: CTTCTTCACCCACGCGGTAT | |
| C. albicans | ERG11 | F: ATTGTTGAAACTGTCATTG R: CCCCTAATAATATACTGATCTG |
| HOG1 | F: GACTTGTGGTCTGTGGGTTG R: ACATCAGCAGGAGGTGAGC | |
| ALS3 | F: CTAATGCTGCTACGTATAATT R: CCTGAAATTGACATGTAGCA | |
| ACT | F: AGCCCAATCCAAAAGAGGTATT R: GCTTCGGTCAACAAAACTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bellavita, R.; Maione, A.; Braccia, S.; Sinoca, M.; Galdiero, S.; Galdiero, E.; Falanga, A. Myxinidin-Derived Peptide against Biofilms Caused by Cystic Fibrosis Emerging Pathogens. Int. J. Mol. Sci. 2023, 24, 3092. https://doi.org/10.3390/ijms24043092
Bellavita R, Maione A, Braccia S, Sinoca M, Galdiero S, Galdiero E, Falanga A. Myxinidin-Derived Peptide against Biofilms Caused by Cystic Fibrosis Emerging Pathogens. International Journal of Molecular Sciences. 2023; 24(4):3092. https://doi.org/10.3390/ijms24043092
Chicago/Turabian StyleBellavita, Rosa, Angela Maione, Simone Braccia, Marica Sinoca, Stefania Galdiero, Emilia Galdiero, and Annarita Falanga. 2023. "Myxinidin-Derived Peptide against Biofilms Caused by Cystic Fibrosis Emerging Pathogens" International Journal of Molecular Sciences 24, no. 4: 3092. https://doi.org/10.3390/ijms24043092
APA StyleBellavita, R., Maione, A., Braccia, S., Sinoca, M., Galdiero, S., Galdiero, E., & Falanga, A. (2023). Myxinidin-Derived Peptide against Biofilms Caused by Cystic Fibrosis Emerging Pathogens. International Journal of Molecular Sciences, 24(4), 3092. https://doi.org/10.3390/ijms24043092

