Prevalence of Class 1 Integron and In Vitro Effect of Antibiotic Combinations of Multidrug-Resistant Enterococcus Species Recovered from the Aquatic Environment in the Eastern Cape Province, South Africa
Abstract
1. Introduction
2. Results
2.1. Analysis of Integrons
2.2. Detection of Promoters in Class 1 Integron-Positive Enterococcus Strains
2.3. Antibiotics Susceptibility Profiles of the Enterococcus Species and Class 1 Integron
2.4. Evaluation of Minimal Inhibitory Concentration (MIC)
2.5. Checkerboard Assay
2.6. Time-Dependent Assessment of the Antibiotics Combinations against the Test Organisms
2.7. Genetic Diversity of the Test Enterococcus Species
3. Discussion
4. Materials and Methods
4.1. Bacterial Isolation and Extraction of Genomic DNA
4.2. Detection of Tuf Gene for Confirmation of Enterococcus Genus and Enterococcus Speciation Using PCR
4.3. Antibiotic Sensitivity Testing
4.4. Assessing the Genetic Variation of Enterococcus Species Isolates Using Enterobacterial Repetitive Intergenic Consensus Sequence PCR (ERIC-PCR)
4.5. Molecular Evaluation of Class 1, 2, and 3 Integrons
4.6. Characterization and Detection of Gene Cassette and Promoters
4.7. Evaluation of Minimal Inhibitory Concentration (MIC)
4.7.1. Checkerboard Assay
4.7.2. Time-Kill Assay
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cambray, G.; Guerout, A.M.; Mazel, D. Integrons. Annu. Rev. Genet. 2010, 44, 141–166. [Google Scholar] [CrossRef] [PubMed]
- Koczura, R.; Mokracka, J.; Barczak, A.; Krysiak, N.; Kaznowski, A. Association between the Presence of Class 1 Integrons, Virulence Genes, and Phylogenetic Groups of Escherichia coli Isolates from River Water. Microb. Ecol. 2013, 65, 84–90. [Google Scholar] [CrossRef] [PubMed]
- Sáenz, Y.; Vinué, L.; Ruiz, E.; Somalo, S.; Martínez, S.; Rojo-Bezares, B.; Zarazaga, M.; Torres, C. Class 1 integrons lacking qacEΔ1 and sul1 genes in Escherichia coli isolates of food, animal and human origins. Vet. Microbiol. 2010, 144, 493–497. [Google Scholar] [CrossRef] [PubMed]
- Da Costa, P.M.; Loureiro, L.; Matos, A.J. Transfer of multidrug-resistant bacteria between intermingled ecological niches: The interface between humans, animals and the environment. Int. J. Environ. Res. Public Health. 2013, 10, 278–294. [Google Scholar] [CrossRef] [PubMed]
- Cabral, J.P.S. Water Microbiology. Bacterial Pathogens and Water. Int. J. Environ. Res. Public Health 2010, 7, 3657–3703. [Google Scholar] [CrossRef]
- Adeniji, O.O.; Sibanda, T.; Okoh, A.I. Recreational water quality status of the Kidd’s Beach as determined by its physicochemical and bacteriological quality parameters. Heliyon 2019, 5, e01893. [Google Scholar] [CrossRef] [PubMed]
- Woodford, N.; Livermore, D.M. Infections caused by Gram-positive bacteria: A review of the global challenge. J. Infect. 2009, 59, S4–S16. [Google Scholar] [CrossRef]
- Gilmore, M.S.; Lebreton, F.; van Schaik, W. Genomic transition of enterococci from gut commensals to leading causes of multidrug-resistant hospital infection in the antibiotic era. Curr. Opin. Microbiol. 2013, 16, 10–16. [Google Scholar] [CrossRef]
- Top, J.; Willems, R.; Bonten, M. Emergence of CC17Enterococcus faecium: From commensal to hospital-adapted pathogen. FEMS Immunol. Med. Microbiol. 2008, 52, 297–308. [Google Scholar] [CrossRef]
- Arias, C.A.; Murray, B.E. The rise of the Enterococcus: Beyond vancomycin resistance. Nat. Rev. Microbiol. 2012, 10, 266–278. [Google Scholar] [CrossRef]
- Hegstad, K.; Mikalsen, T.; Coque, T.M.; Werner, G.; Sundsfjord, A. Mobile genetic elements and their contribution to the emergence of antimicrobial resistant Enterococcus faecalis and Enterococcus faecium. Clin. Microbiol. Infect. 2010, 16, 541–554. [Google Scholar] [CrossRef] [PubMed]
- Iweriebor, B.C.; Gaqavu, S.; Obi, L.C.; Nwodo, U.U.; Okoh, A.I. Antibiotic Susceptibilities of Enterococcus Species Isolated from Hospital and Domestic Wastewater Effluents in Alice, Eastern Cape Province of South Africa. Int. J. Environ. Res. Public Health 2015, 12, 4231–4246. [Google Scholar] [CrossRef] [PubMed]
- Ateba, C.N.; Lekoma, K.P.; Kawadza, D.T. Detection of vanA and vanB genes in vancomycin-resistant enterococci (VRE) from groundwater using multiplex PCR analysis. J. Water Health 2013, 11, 684–691. [Google Scholar] [CrossRef] [PubMed]
- Krauland, M.; Harrison, L.; Paterson, D.; Marsh, J. Novel Integron Gene Cassette Arrays Identified in a Global Collection of Multi-Drug Resistant Non-Typhoidal Salmonella enterica. Curr. Microbiol. 2010, 60, 217–223. [Google Scholar] [CrossRef] [PubMed]
- Nandi, S.; Maurer, J.J.; Hofacre, C.; Summers, A.O. Gram-positive bacteria are a major reservoir of Class 1 antibiotic resistance integrons in poultry litter. Proc. Natl. Acad. Sci. USA 2004, 101, 7118–7122. [Google Scholar] [CrossRef]
- Hosseini, S.M.; Zeyni, B.; Rastyani, S.; Jafari, R.; Shamloo, F.; Tabar, Z.K.; Arabestani, M.R. Presence of virulence factors and antibiotic resistances in Enterococcus sp collected from dairy products and meat. Der Pharm. Lett. 2016, 8, 138–145. [Google Scholar]
- Xu, Z.; Li, L.; Shirtliff, M.E.; Peters, B.M.; Peng, Y.; Alam, M.J.; Yamasaki, S.; Shi, L. First report of class 2 integron in clinical Enterococcus faecalis and class 1 integron in Enterococcus faecium in South China. Diagn. Microbiol. Infect. Dis. 2010, 68, 315–317. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 31st ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Berwyn, PA, USA, 2021; Volume 41, Number 3. [Google Scholar]
- García-Solache, M.; Rice, L.B. The Enterococcus: A Model of Adaptability to Its Environment. Clin. Microbiol. Rev. 2019, 32, e00058-18. [Google Scholar] [CrossRef]
- Gilmore, M.S.; Clewell, D.B.; Courvalin, P.; Dunny, G.M.; Murray, B.E.; Rice, L.B. The Enterococci: Pathogenesis, Molecular Biology, and Antibiotic Resistance; ASM Press: Washington, DC, USA, 2002. [Google Scholar]
- Cottagnoud, P.; Gerber, C.M.; Cottagnoud, M.; Täuber, M.G. Gentamicin Increases the Efficacy of Vancomycin against Penicillin-Resistant Pneumococci in the Rabbit Meningitis Model. Antimicrob. Agents Chemother. 2002, 46, 188–190. [Google Scholar] [CrossRef]
- Torres, C.; Tenorio, C.; Lantero, M.; Gastañares, M.J.; Baquero, F. High-level penicillin resistance and penicillin-gentamicin synergy in Enterococcus faecium. Antimicrob. Agents Chemother. 1993, 37, 2427–2431. [Google Scholar] [CrossRef]
- Lefort, A.; Arthur, M.; Garry, L.; Carbon, C.; Courvalin, P.; Fantin, B. Bactericidal Activity of Gentamicin against Enterococcus faecalis In Vitro and In Vivo. Antimicrob. Agents Chemother. 2000, 44, 2077–2080. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Liu, A.; Vaudrey, J.; Vaiciunaite, B.; Moigboi, C.; McTavish, S.M.; Kearns, A.; Coates, A. Combinations of β-Lactam or Aminoglycoside Antibiotics with Plectasin Are Synergistic against Methicillin-Sensitive and Methicillin-Resistant Staphylococcus aureus. PLoS ONE 2015, 10, e0117664. [Google Scholar] [CrossRef]
- Byappanahalli, M.; Nevers, M.; Korajkic, A.; Staley, Z.R.; Harwood, V.J. Enterococci in the Environment. Microbiol. Mol. Biol. Rev. 2012, 76, 685–706. [Google Scholar] [CrossRef] [PubMed]
- Maheux, A.F.; Bissonnette, L.; Boissinot, M.; Bernier, J.-L.T.; Huppé, V.; Bérubé, È.; Boudreau, D.K.; Picard, F.J.; Huletsky, A.; Bergeron, M.G. Method for rapid and sensitive detection of Enterococcus sp. and Enterococcus faecalis/faecium cells in potable water samples. Water Res. 2011, 45, 2342–2354. [Google Scholar] [CrossRef]
- Lleã², M.D.M.; Bonato, B.; Benedetti, D.; Canepari, P. Survival of enterococcal species in aquatic environments. FEMS Microbiol. Ecol. 2005, 54, 189–196. [Google Scholar] [CrossRef]
- Zhou, X.; Willems, R.J.L.; Friedrich, A.W.; Rossen, J.W.A.; Bathoorn, E. Enterococcus faecium: From microbiological insights to practical recommendations for infection control and diagnostics. Antimicrob. Resist. Infect. Control 2020, 9, 130. [Google Scholar] [CrossRef]
- Saingam, P.; Li, B.; Sung, S.; Yan, T. Immediate Impact of Hurricane Lane on Microbiological Quality of Coastal Water in Hilo Bay, Hawaii. Environ. Sci. Technol. 2021, 55, 2960–2967. [Google Scholar] [CrossRef] [PubMed]
- Alipour, M.; Hajiesmaili, R.; Talebjannat, M.; Yahyapour, Y. Identification and antimicrobial resistance of Enterococcus spp. isolated from the river and coastal waters in northern Iran. Sci. World. J. 2014, 2014, 287458. [Google Scholar] [CrossRef]
- Di Cesare, A.; Vignaroli, C.; Luna, G.M.; Pasquaroli, S.; Biavasco, F. Antibiotic-Resistant Enterococci in Seawater and Sediments from a Coastal Fish Farm. Microb. Drug Resist. 2012, 18, 502–509. [Google Scholar] [CrossRef]
- Vignaroli, C.; Pasquaroli, S.; Citterio, B.; Di Cesare, A.; Mangiaterra, G.; Fattorini, D.; Biavasco, F. Antibiotic and heavy metal resistance in enterococci from coastal marine sediment. Environ. Pollut. 2018, 237, 406–413. [Google Scholar] [CrossRef]
- Adeniji, O.O.; Sibanda, T.; Okoh, A. Molecular detection of antibiotic resistance and virulence gene determinants of Enterococcus species isolated from coastal water in the Eastern Cape Province, South Africa. Int. J. Environ. Stud. 2021, 78, 208–227. [Google Scholar] [CrossRef]
- Di Cesare, A.; Frangipani, E.; Citterio, B.; Sabatino, R.; Corno, G.; Fontaneto, D.; Mangiaterra, G.; Bencardino, D.; Zoppi, S.; Di Blasio, A. Class 1 integron and Enterococcus spp. abundances in swine farms from the “Suckling piglets” to the “Fatteners” production category. Vet. Microbiol. 2022, 274, 109576. [Google Scholar] [CrossRef]
- Young, S.; Nayak, B.; Sun, S.; Badgley, B.D.; Rohr, J.R.; Harwood, V.J. Vancomycin-Resistant Enterococci and Bacterial Community Structure following a Sewage Spill into an Aquatic Environment. Appl. Environ. Microbiol. 2016, 82, 5653–5660. [Google Scholar] [CrossRef]
- Thu, W.P.; Sinwat, N.; Bitrus, A.A.; Angkittitrakul, S.; Prathan, R.; Chuanchuen, R. Prevalence, antimicrobial resistance, virulence gene, and class 1 integrons of Enterococcus faecium and Enterococcus faecalis from pigs, pork and humans in Thai-Laos border provinces. J. Glob. Antimicrob. Resist. 2019, 18, 130–138. [Google Scholar] [CrossRef]
- Blaser, M.J.; Perez, G.P.; Kleanthous, H.; Cover, T.; Peek, R.M.; Chyou, P.H.; Stemmermann, G.N.; Nomura, A. Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res 1995, 55, 2111–2115. [Google Scholar]
- Guney, A.K. A Study on Class I Integrons and Antimicrobial Resistance among Clinical Staphylococci Isolates from a Turkish Hospital. Clin. Microbiol. Open Access 2014, 3, 173. [Google Scholar] [CrossRef]
- Hajiahmadi, F.; Safari, N.; Alijani, P.; Mordadi, A.; Arabestani, M.R. The frequency of integrons of antibiotic resistant in Stenotrophomonas maltophilia isolates in Hamadan/Iran. Iranian J. Med. Microbiol. 2016, 10, 10–16. [Google Scholar]
- Wang, L.; He, Y.; Xia, Y.; Wang, H.; Liang, S. Investigation of mechanism and molecular epidemiology of linezolid-resistant Enterococcus faecalis in China. Infect. Genet. Evol. 2014, 26, 14–19. [Google Scholar] [CrossRef] [PubMed]
- Park, K.; Jeong, Y.S.; Chang, J.; Sung, H.; Kim, M.N. Emergence of optrA-mediated linezolid-nonsusceptible Enterococcus faecalis in a tertiary care hospital. Ann. Lab. Med. 2020, 40, 321–325. [Google Scholar] [CrossRef]
- Miller, W.; Munita, J.M.; Arias, C.A. Mechanisms of antibiotic resistance in enterococci. Expert Rev. Anti-infective Ther. 2014, 12, 1221–1236. [Google Scholar] [CrossRef] [PubMed]
- Stogios, P.J.; Savchenko, A. Molecular mechanisms of vancomycin resistance. Protein Sci. 2020, 29, 654–669. [Google Scholar] [CrossRef] [PubMed]
- Tyers, M.; Wright, G.D. Drug combinations: A strategy to extend the life of antibiotics in the 21st century. Nat. Rev. Microbiol. 2019, 17, 141–155. [Google Scholar] [CrossRef] [PubMed]
- Ni, W.; Shao, X.; Di, X.; Cui, J.; Wang, R.; Liu, Y. In vitro synergy of polymyxins with other antibiotics for Acinetobacter baumannii: A systematic review and meta-analysis. Int. J. Antimicrob. Agents 2015, 45, 8–18. [Google Scholar] [CrossRef] [PubMed]
- Mercuro, N.J.; Davis, S.L.; Zervos, M.J.; Herc, E.S. Combatting resistant enterococcal infections: A pharmacotherapy review. Expert Opin. Pharmacother. 2018, 19, 979–992. [Google Scholar] [CrossRef] [PubMed]
- Leone, S.; Noviello, S.; Esposito, S. Combination antibiotic therapy for the treatment of infective endocarditis due to enterococci. Infection 2016, 44, 273–281. [Google Scholar] [CrossRef]
- Baddour, L.M.; Wilson, W.R.; Bayer, A.S.; Fowler, V.G., Jr.; Tleyjeh, I.M.; Rybak, M.J.; Barsic, B.; Lockhart, P.B.; Gewitz, M.H.; Levison, M.E.; et al. Infective endocarditis in adults: Diagnosis, antimicrobial therapy, and management of complications: A scientific statement for healthcare professionals from the American Heart Association. Circulation 2015, 132, 1435–1486. [Google Scholar] [CrossRef]
- Skinner, K.; Sandoe, J.A.; Rajendran, R.; Ramage, G.; Lang, S. Efficacy of rifampicin combination therapy for the treatment of enterococcal infections assessed in vivo using a Galleria mellonella infection model. Int. J. Antimicrob. Agents 2017, 49, 507–511. [Google Scholar] [CrossRef]
- Mazurek, B.; Lou, X.; Olze, H.; Haupt, H.; Szczepek, A.J. In vitro protection of auditory hair cells by salicylate from the gentamicin-induced but not neomycin-induced cell loss. Neurosci. Lett. 2012, 506, 107–110. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.-Z.; Li, Y.-L.; Yu, Y.-L. Soil bacterial and fungal community successions under the stress of chlorpyrifos application and molecular characterization of chlorpyrifos-degrading isolates using ERIC-PCR. J. Zhejiang Univ. Sci. B 2014, 15, 322–332. [Google Scholar] [CrossRef]
- Wei, L.; Wu, Q.; Zhang, J.; Guo, W.; Chen, M.; Xue, L.; Wang, J.; Ma, L. Prevalence and Genetic Diversity of Enterococcus faecalis Isolates from Mineral Water and Spring Water in China. Front. Microbiol. 2017, 8, 1109. [Google Scholar] [CrossRef]
- Ramazanzadeh, R.; Zamani, S.; Zamani, S. Genetic diversity in clinical isolates of Escherichia coli by enterobacterial repetitive intergenic consensus (ERIC)-PCR technique in Sanandaj hospitals. Iran. J. Microbiol. 2013, 5, 126–131. [Google Scholar] [PubMed]
- Ekundayo, T.; Okoh, A. Molecular characterization, intra-species diversity and abundance of freshwater Plesiomonas shigelloides isolates. Microorganisms 2020, 8, 1081. [Google Scholar] [CrossRef] [PubMed]
- Prabhu, V.; Isloor, S.; Balu, M.; Suryanarayana, V.V.; Rathnamma, D. Genotyping by ERIC-PCR of Escherichia coli isolated from bovine mastitis cases. Indian J. Biotechnol. 2010, 9, 298–301. [Google Scholar]
- Garrido-Maestu, A.; Azinheiro, S.; Fuciños, P.; Carvalho, J.; Prado, M. Comparative Study of Multiplex Real-Time Recombinase Polymerase Amplification and ISO 11290-1 Methods for the Detection of Listeria Monocytogenes in Dairy Products. Food Microbiol. 2020, 92, 103570. [Google Scholar] [CrossRef]
- Ke, D.; Picard, F.J.; Martineau, F.; Ménard, C.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Development of a PCR Assay for Rapid Detection of Enterococci. J. Clin. Microbiol. 1999, 37, 3497–3503. [Google Scholar] [CrossRef] [PubMed]
- Ateba, C.N.; Mbewe, M. Genotypic characterization of Escherichia coli O157: H7 isolates from different sources in the north-west province, South Africa, using enterobacterial repetitive intergenic consensus PCR analysis. Int. J. Mol. Sci. 2014, 15, 9735–9747. [Google Scholar] [CrossRef]
- Asgharpour, F.; Mahmoud, S.; Marashi, A.; Moulana, Z. Molecular detection of class 1, 2 and 3 integrons and some antimicrobial resistance genes in Salmonella Infantis isolates. Iran. J. Microbiol. 2018, 10, 104–110. [Google Scholar]
- Goldstein, C.; Lee, M.D.; Sanchez, S.; Hudson, C.; Phillips, B.; Register, B.; Grady, M.; Liebert, C.; Summers, A.; White, D.G.; et al. Incidence of Class 1 and 2 Integrases in Clinical and Commensal Bacteria from Livestock, Companion Animals, and Exotics. Antimicrob. Agents Chemother. 2001, 45, 723–726. [Google Scholar] [CrossRef]
- Amiri, A.; Firoozeh, F.; Moniri, R.; Zibaei, M. Prevalence of CTX-M-Type and PER Extended-Spectrum β-Lactamases Among Klebsiella spp. Isolated from Clinical Specimens in the Teaching Hospital of Kashan, Iran. Iran Red Crescent. Med. J. 2016, 18, 22260. Available online: http://www.ncbi.nlm (accessed on 15 August 2019). [CrossRef]
- Afzali, H.; Firoozeh, F.; Amiri, A.; Moniri, R.; Zibaei, M. Characterization of CTX-M-Type Extend-Spectrum β-Lactamase Producing Klebsiella spp. in Kashan, Iran. Jundishapur J. Microbiol. 2015, 8, e27967. Available online: http://www.ncbi.nlm.nih.gov/pubmed/26587221 (accessed on 15 August 2019). [CrossRef]
- Moura, A.; Pereira, C.; Henriques, I.; Correia, A. Novel gene cassettes and integrons in antibiotic-resistant bacteria isolated from urban wastewaters. Res. Microbiol. 2012, 163, 92–100. [Google Scholar] [CrossRef]
- Petersen, P.J.; Labthavikul, P.; Jones, C.H.; Bradford, P. In vitro antibacterial activities of tigecycline in combination with other antimicrobial agents determined by chequerboard and time-kill kinetic analysis. J. Antimicrob. Chemother. 2006, 57, 573–576. [Google Scholar] [CrossRef] [PubMed]
- Principe, L.; Capone, A.; Mazzarelli, A.; D’Arezzo, S.; Bordi, E.; Di Caro, A.; Petrosillo, N. In Vitro Activity of Doripenem in Combination with Various Antimicrobials Against Multidrug-Resistant Acinetobacter baumannii: Possible Options for the Treatment of Complicated Infection. Microb. Drug Resist. 2013, 19, 407–414. [Google Scholar] [CrossRef] [PubMed]
- Rabadia, A.; Kamat, S.; Kamat, D. Study of synergistic action of cefotaxime and Terminalia chebula on Acinetobacter baumannii using checkerboard assay. Int. J. Pharm. Pharm. Sci. 2013, 5, 830–832. [Google Scholar]
- Tängdén, T.; Hickman, R.A.; Forsberg, P.; Lagerbäck, P.; Giske, C.G.; Cars, O. Evaluation of Double- and Triple-Antibiotic Combinations for VIM- and NDM-Producing Klebsiella pneumoniae by In Vitro Time-Kill Experiments. Antimicrob. Agents Chemother. 2014, 58, 1757–1762. [Google Scholar] [CrossRef]
Antimicrobial Class | Antimicrobial Agents | Resistance (R) | Intermediate (I) | Susceptible (S) | Resistance (R) | Intermediate (I) | Susceptible (S) | Resistance (R) | Intermediate (I) | Susceptible (S) |
---|---|---|---|---|---|---|---|---|---|---|
Integron-Positive Isolates n = 50 | Integron-Negative Isolates n = 7 | Total n = 57 | ||||||||
Aminoglycosides | Gentamicin | 40 (80%) | 1 (2%) | 9 (18%) | 6 (85.7%) | 0 | 1 (14.3%) | 46 (80.7%) | 1 (1.8%) | 10 (17.5%) |
Tetracyclines | Tetracycline | 41 (82.0%) | 6 (12.0%) | 3 (6.0%) | 5 (71.4%) | 0 | 2 (28.6%) | 46 (80.7%) | 6 (10.5%) | 5 (8.8%) |
Quinolones | Ciprofloxacin | 36 (72%) | 3 (6%) | 11 (22.0%) | 7 (100%) | 0 | 0 | 43 (75.4%) | 3 (5.3%) | 11 (19.3%) |
Levofloxacin | 35 (70%) | 4 (8%) | 11 (22.0%) | 2 (28.6%) | 0 | 5 (71.4%) | 37 (64.9%) | 4 (7%) | 16 (28.1%) | |
Norfloxacin | 32 (64%) | 7 (14%) | 11 (22%) | 2 (28.6%) | 0 | 5 (71.4%) | 34 (59.6%) | 7 (12.3%) | 16 (28.1%) | |
Penicillin | Ampicillin | 26 (52%) | 0 | 24 (48%) | 4 (51.1%) | 0 | 3 (42.9%) | 30 (52.6%) | 0 | 27 (47.4%) |
Glycopeptide | Vancomycin | 38 (76.0%) | 1 (2.0%) | 11 (22.0%) | 5 (71.4%) | 0 | 2 (28.6%) | 43 (75.4%) | 1 (1.8%) | 13 (22.8%) |
Macrolides | Erythromycin | 47 (94%) | 3 (6%) | 0 | 7 (100%) | 0 | 0 | 54 (94.7%) | 3 (5.3%) | 0 |
Phenicol | Chloramphenicol | 20 (40%) | 0 | 30 (60%) | 1 (14.3%) | 0 | 6 (85.7%) | 21 (36.8%) | 0 | 36 (63.2%) |
Nitrofurantoin | Nitrofurantoin | 24 (48%) | 1 (2%) | 25 (50%) | 5 (71.4%) | 0 | 2 (28.6%) | 29 (50.9%) | 1 (1.8%) | 27 (47.4%) |
Oxazolidinones | Linezolid | 46 (92.0%) | 2 (4.0%) | 2 (4.0%) | 5 (71.4%) | 0 | 2 (28.6%) | 51 (89.5%) | 2 (3.5%) | 4 (7.0%) |
Ansamycins | Rifampicin | 50 (100%) | 0 | 0 | 7 (100%) | 0 | 0 | 57 (100%) | 0 | 0 |
Pathogens | Vancomycin (µg/mL) | Ampicillin (µg/mL) | Erythromycin (µg/mL) | Linezolid (µg/mL) | Rifampicin (µg/mL) | Ciprofloxacin (µg/mL) | Gentamicin (µg/mL) |
---|---|---|---|---|---|---|---|
MDR E. faecalis (35) | 256 | 16 | 2 | 2 | 2 | 1 | 4 |
MDR E. faecalis (41) | 256 | 8 | 32 | >1024 | 16 | 1 | 2 |
MDR E. faecium (26) | 128 | 8 | 8 | >1024 | 8 | 0.25 | 4 |
MDR E. faecium (44) | 256 | 8 | 32 | >1024 | 16 | 1 | 1 |
Antibiotic Combination | MDR Enterococcus Faecuim (44) FIC | Type of Interaction | MDR Enterococcus Faecium (26) FIC | Type of Interaction |
---|---|---|---|---|
Vancomycin + Ampicillin | 1 | Additive | 1 | Additive |
Ampicillin + Ciprofloxacin | 2 | Antagonistic | 0.62 | additive |
Ampicillin + Gentamicin | 0.75 | additive | 0.38 | synergistic |
Vancomycin + Gentamicin | 0.625 | Additive | 0.375 | synergistic |
Tetracycline + Ampicillin | 2 | Antagonistic | 2 | Antagonistic |
Rifampicin+ Vancomycin | 1 | Additive | 2 | Antagonistic |
Rifampicin + Ampicillin | 1.25 | Indifference | ||
Erythromycin + ampicillin | 1.5 | Indifference | ||
Drug Combination | MDR Enterococcus Faecalis (41) FIC | Type of Interaction | MDR Enterococcus Faecalis (35) FIC | Type of Interaction |
Vancomycin + Ampicillin | 0.75 | Additive | 1 | Additive |
Ampicillin + Ciprofloxacin | 0.53 | Additive | 0.155 | Synergistic |
Ampicillin + Gentamicin | 0.75 | Additive | 0.75 | Additive |
Vancomycin + Gentamicin | 0.75 | Additive | 0.27 | Synergistic |
Rifampicin + Ampicillin | 1.5 | Indifference | 1.25 | Indifference |
Rifampicin + Vancomycin | 1 | Additive | ||
Erythromycin + ampicillin | 1 | Additive |
Target Gene | Primer Sequence (5′-3′) | Amplicon Size (Bp) | Reference |
---|---|---|---|
IntI1 | F: CAG TGG ACA TAA GCC TGT TC R: CCC GAG GCA TAG ACT GTA | 164 | [59] |
IntI2 | F:TTATTGCTGGGATTAGGC R: ACGGCTACCCTCTGTTATC | 232 | [60] |
IntI3, | F: AGTGGGTGGCGAATGAGTG R: TGTTCTTGTATCGGCAGGTG | 600 | [61] |
5’CS 3’CS | 5′CS-F GGCATCCAAGCAGCAAG 3′CS-R AAGCAGACTTGACCTGA | variable | [62] |
attI2 orfX | attI2: GACGGCATGCACGATTTGTA orfX RGATGCCATCGCAAGTACGAG | varaible | [62] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Adeniji, O.O.; Nontongana, N.; Okoh, A.I. Prevalence of Class 1 Integron and In Vitro Effect of Antibiotic Combinations of Multidrug-Resistant Enterococcus Species Recovered from the Aquatic Environment in the Eastern Cape Province, South Africa. Int. J. Mol. Sci. 2023, 24, 2993. https://doi.org/10.3390/ijms24032993
Adeniji OO, Nontongana N, Okoh AI. Prevalence of Class 1 Integron and In Vitro Effect of Antibiotic Combinations of Multidrug-Resistant Enterococcus Species Recovered from the Aquatic Environment in the Eastern Cape Province, South Africa. International Journal of Molecular Sciences. 2023; 24(3):2993. https://doi.org/10.3390/ijms24032993
Chicago/Turabian StyleAdeniji, Oluwaseun Ola, Nolonwabo Nontongana, and Anthony Ifeanyin Okoh. 2023. "Prevalence of Class 1 Integron and In Vitro Effect of Antibiotic Combinations of Multidrug-Resistant Enterococcus Species Recovered from the Aquatic Environment in the Eastern Cape Province, South Africa" International Journal of Molecular Sciences 24, no. 3: 2993. https://doi.org/10.3390/ijms24032993
APA StyleAdeniji, O. O., Nontongana, N., & Okoh, A. I. (2023). Prevalence of Class 1 Integron and In Vitro Effect of Antibiotic Combinations of Multidrug-Resistant Enterococcus Species Recovered from the Aquatic Environment in the Eastern Cape Province, South Africa. International Journal of Molecular Sciences, 24(3), 2993. https://doi.org/10.3390/ijms24032993