Role of Melatonin in Daily Variations of Plasma Insulin Level and Pancreatic Clock Gene Expression in Chick Exposed to Monochromatic Light
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Treatments
2.2. Sample
2.3. Enzyme-Linked Immunosorbent Assay
2.4. Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR)
2.5. Statistical Analysis
3. Results
3.1. Effect of Monochromatic Light on Circadian Rhythms of Plasma Insulin Level, Plasma Melatonin Level and Pancreatic Insulin-Related Gene
3.2. Effect of Pinealectomy on the Circadian Rhythms of the Plasma Melatonin Level under Monochromatic Light
3.3. Effect of Pinealectomy on the Circadian Rhythms of the Insulin Level and Pancreatic Insulin-Related Gene under Monochromatic Light
3.4. Effect of Monochromatic Light on the Circadian Rhythms of the Pancreas Clock Gene Expression
3.5. Effect of Pinealectomy on the Circadian Rhythms of the Pancreas Clock Gene Expression in the Chick under Monochromatic Light
4. Discussion
4.1. Effects of Monochromatic Light on Carbohydrate Metabolism in Chicken Plasma
4.2. Effects of Melatonin on Monochromatic Light-Induced Insulin Concentration in Plasma
4.3. Role of Clock Gene in Melatonin-Mediated Monochromatic Light-Induced Insulin Rhythm in Plasma
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Stenvers, D.J.; Scheer, F.; Schrauwen, P.; la Fleur, S.E.; Kalsbeek, A. Circadian clocks and insulin resistance. Nat. Rev. Endocrinol. 2019, 15, 75–89. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cassone, V.M.; Westneat, D.F. The bird of time: Cognition and the avian biological clock. Front. Mol. Neurosci. 2012, 5, 32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Renthlei, Z.; Gurumayum, T.; Borah, B.K.; Trivedi, A.K. Daily expression of clock genes in central and peripheral tissues of tree sparrow (Passer montanus). Chronobiol. Int. 2019, 36, 110–121. [Google Scholar] [CrossRef] [PubMed]
- Reppert, S.M.; Weaver, D.R. Coordination of circadian timing in mammals. Nature 2002, 418, 935–941. [Google Scholar] [CrossRef]
- Stenvers, D.J.; Jonkers, C.F.; Fliers, E.; Bisschop, P.; Kalsbeek, A. Nutrition and the circadian timing system. Prog. Brain Res. 2012, 199, 359–376. [Google Scholar] [CrossRef]
- Beta, R.A.A.; Balatsos, N.A.A. Tales around the clock: Poly(A) tails in circadian gene expression. Wiley Interdiscip. Rev. RNA 2018, 9, e1484. [Google Scholar] [CrossRef]
- Buhr, E.D.; Takahashi, J.S. Molecular components of the Mammalian circadian clock. Handb. Exp. Pharmacol. 2013, 217, 3–27. [Google Scholar] [CrossRef] [Green Version]
- Cassone, V.M. Avian circadian organization: A chorus of clocks. Front. Neuroendocrinol. 2014, 35, 76–88. [Google Scholar] [CrossRef] [Green Version]
- Green, C.B.; Takahashi, J.S.; Bass, J. The meter of metabolism. Cell 2008, 134, 728–742. [Google Scholar] [CrossRef] [Green Version]
- Oosterman, J.E.; Wopereis, S.; Kalsbeek, A. The Circadian Clock, Shift Work, and Tissue-Specific Insulin Resistance. Endocrinology 2020, 161, bqaa180. [Google Scholar] [CrossRef]
- Kalsbeek, A.; la Fleur, S.; Fliers, E. Circadian control of glucose metabolism. Mol. Metab. 2014, 3, 372–383. [Google Scholar] [CrossRef]
- Reinke, H.; Asher, G. Crosstalk between metabolism and circadian clocks. Nat. Rev. Mol. Cell Biol. 2019, 20, 227–241. [Google Scholar] [CrossRef]
- Bass, J.; Lazar, M.A. Circadian time signatures of fitness and disease. Science 2016, 354, 994–999. [Google Scholar] [CrossRef] [Green Version]
- Vieira, E.; Burris, T.P.; Quesada, I. Clock genes, pancreatic function, and diabetes. Trends Mol. Med. 2014, 20, 685–693. [Google Scholar] [CrossRef] [Green Version]
- Pulimeno, P.; Mannic, T.; Sage, D.; Giovannoni, L.; Salmon, P.; Lemeille, S.; Giry-Laterriere, M.; Unser, M.; Bosco, D.; Bauer, C.; et al. Autonomous and self-sustained circadian oscillators displayed in human islet cells. Diabetologia 2013, 56, 497–507. [Google Scholar] [CrossRef] [Green Version]
- Sadacca, L.A.; Lamia, K.A.; deLemos, A.S.; Blum, B.; Weitz, C.J. An intrinsic circadian clock of the pancreas is required for normal insulin release and glucose homeostasis in mice. Diabetologia 2011, 54, 120–124. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Kim, M.S.; Li, R.; Liu, V.Y.; Fu, L.; Moore, D.D.; Ma, K.; Yechoor, V.K. Loss of Bmal1 leads to uncoupling and impaired glucose-stimulated insulin secretion in β-cells. Islets 2011, 3, 381–388. [Google Scholar] [CrossRef] [Green Version]
- Fonken, L.K.; Nelson, R.J. The effects of light at night on circadian clocks and metabolism. Endocr. Rev. 2014, 35, 648–670. [Google Scholar] [CrossRef]
- Matenchuk, B.A.; Mandhane, P.J.; Kozyrskyj, A.L. Sleep, circadian rhythm, and gut microbiota. Sleep Med. Rev. 2020, 53, 101340. [Google Scholar] [CrossRef]
- Chaix, A.; Manoogian, E.N.C.; Melkani, G.C.; Panda, S. Time-Restricted Eating to Prevent and Manage Chronic Metabolic Diseases. Annu. Rev. Nutr. 2019, 39, 291–315. [Google Scholar] [CrossRef]
- Morgan, L.M.; Shi, J.W.; Hampton, S.M.; Frost, G. Effect of meal timing and glycaemic index on glucose control and insulin secretion in healthy volunteers. Br. J. Nutr. 2012, 108, 1286–1291. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, J.; Bian, J.; Wang, Z.; Dong, Y.; Chen, Y. Effect of monochromatic light on circadian rhythmic expression of clock genes and arylalkylamine N-acetyltransferase in chick retina. Chronobiol. Int. 2017, 34, 1149–1157. [Google Scholar] [CrossRef] [PubMed]
- Jiang, N.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Role of monochromatic light on daily variation of clock gene expression in the pineal gland of chick. J. Photochem. Photobiol. B 2016, 164, 57–64. [Google Scholar] [CrossRef] [PubMed]
- Jiang, N.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Effect of monochromatic light on circadian rhythmic expression of clock genes in the hypothalamus of chick. J. Photochem. Photobiol. B 2017, 173, 476–484. [Google Scholar] [CrossRef]
- Liu, L.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Effect of melatonin on monochromatic light-induced changes in clock gene circadian expression in the chick liver. J. Photochem. Photobiol. B 2019, 197, 111537. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. A Green and Blue Monochromatic Light Combination Therapy Reduces Oxidative Stress and Enhances B-Lymphocyte Proliferation through Promoting Melatonin Secretion. Oxid. Med. Cell Longev. 2021, 2021, 5595376. [Google Scholar] [CrossRef]
- Li, J.; Cao, J.; Wang, Z.; Dong, Y.; Chen, Y. Melatonin plays a critical role in inducing B lymphocyte proliferation of the bursa of Fabricius in broilers via monochromatic lights. J. Photochem. Photobiol. B 2015, 142, 29–34. [Google Scholar] [CrossRef]
- Cornelissen, G. Cosinor-based rhythmometry. Theor. Biol. Med. Model. 2014, 11, 16. [Google Scholar] [CrossRef] [Green Version]
- Albreiki, M.S.; Middleton, B.; Hampton, S.M. A single night light exposure acutely alters hormonal and metabolic responses in healthy participants. Endocr. Connect. 2017, 6, 100–110. [Google Scholar] [CrossRef] [Green Version]
- Gil-Lozano, M.; Hunter, P.M.; Behan, L.A.; Gladanac, B.; Casper, R.F.; Brubaker, P.L. Short-term sleep deprivation with nocturnal light exposure alters time-dependent glucagon-like peptide-1 and insulin secretion in male volunteers. Am. J. Physiol. Endocrinol. Metab. 2016, 310, E41–E50. [Google Scholar] [CrossRef]
- Hirota, N.; Sone, Y.; Tokura, H. Effect of evening exposure to dim or bright light on the digestion of carbohydrate in the supper meal. Chronobiol. Int. 2003, 20, 853–862. [Google Scholar] [CrossRef]
- Cheung, I.N.; Zee, P.C.; Shalman, D.; Malkani, R.G.; Kang, J.; Reid, K.J. Morning and Evening Blue-Enriched Light Exposure Alters Metabolic Function in Normal Weight Adults. PLoS ONE 2016, 11, e0155601. [Google Scholar] [CrossRef] [Green Version]
- Villasenor, A.; Wang, Z.V.; Rivera, L.B.; Ocal, O.; Asterholm, I.W.; Scherer, P.E.; Brekken, R.A.; Cleaver, O.; Wilkie, T.M. Rgs16 and Rgs8 in embryonic endocrine pancreas and mouse models of diabetes. Dis. Model. Mech. 2010, 3, 567–580. [Google Scholar] [CrossRef] [Green Version]
- Gerber, S.H.; Südhof, T.C. Molecular determinants of regulated exocytosis. Diabetes 2002, 51, S3–S11. [Google Scholar] [CrossRef] [Green Version]
- Ma, S.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. BMAL1 but not CLOCK is associated with monochromatic green light-induced circadian rhythm of melatonin in chick pinealocytes. Endocr. Connect. 2019, 8, 57–68. [Google Scholar] [CrossRef] [Green Version]
- Wright, H.R.; Lack, L.C. Effect of light wavelength on suppression and phase delay of the melatonin rhythm. Chronobiol. Int. 2001, 18, 801–808. [Google Scholar] [CrossRef]
- Kennaway, D.J. Melatonin research in mice: A review. Chronobiol. Int. 2019, 36, 1167–1183. [Google Scholar] [CrossRef]
- Jiang, N.; Cao, J.; Wang, Z.; Dong, Y.; Chen, Y. Effect of monochromatic light on the temporal expression of N-acetyltransferase in chick pineal gland. Chronobiol. Int. 2020, 37, 1140–1150. [Google Scholar] [CrossRef]
- Pail, G.; Huf, W.; Pjrek, E.; Winkler, D.; Willeit, M.; Praschak-Rieder, N.; Kasper, S. Bright-light therapy in the treatment of mood disorders. Neuropsychobiology 2011, 64, 152–162. [Google Scholar] [CrossRef]
- Shi, H.; Li, B.; Tong, Q.; Zheng, W.; Zeng, D.; Feng, G. Effects of LED Light Color and Intensity on Feather Pecking and Fear Responses of Layer Breeders in Natural Mating Colony Cages. Animals 2019, 9, 814. [Google Scholar] [CrossRef]
- Jin, E.; Jia, L.; Li, J.; Yang, G.; Wang, Z.; Cao, J.; Chen, Y. Effect of monochromatic light on melatonin secretion and arylalkylamine N-acetyltransferase mRNA expression in the retina and pineal gland of broilers. Anat. Rec. 2011, 294, 1233–1241. [Google Scholar] [CrossRef] [PubMed]
- Peschke, E.; Stumpf, I.; Bazwinsky, I.; Litvak, L.; Dralle, H.; Mühlbauer, E. Melatonin and type 2 diabetes—A possible link? J. Pineal Res. 2007, 42, 350–358. [Google Scholar] [CrossRef] [PubMed]
- Peschke, E.; Frese, T.; Chankiewitz, E.; Peschke, D.; Preiss, U.; Schneyer, U.; Spessert, R.; Mühlbauer, E. Diabetic Goto Kakizaki rats as well as type 2 diabetic patients show a decreased diurnal serum melatonin level and an increased pancreatic melatonin-receptor status. J. Pineal Res. 2006, 40, 135–143. [Google Scholar] [CrossRef] [PubMed]
- Gubin, D.; Neroev, V.; Malishevskaya, T.; Cornelissen, G.; Astakhov, S.Y.; Kolomeichuk, S.; Yuzhakova, N.; Kabitskaya, Y.; Weinert, D. Melatonin mitigates disrupted circadian rhythms, lowers intraocular pressure, and improves retinal ganglion cells function in glaucoma. J. Pineal Res. 2021, 70, e12730. [Google Scholar] [CrossRef]
- Gubin, D.; Weinert, D. Melatonin, circadian rhythms and glaucoma: Current perspective. Neural Regen. Res. 2022, 17, 1759–1760. [Google Scholar] [CrossRef]
- Garaulet, M.; Qian, J.; Florez, J.C.; Arendt, J.; Saxena, R.; Scheer, F. Melatonin Effects on Glucose Metabolism: Time to Unlock the Controversy. Trends Endocrinol. Metab. 2020, 31, 192–204. [Google Scholar] [CrossRef]
- Gomes, P.R.L.; Vilas-Boas, E.A.; Leite, E.A.; Munhoz, A.C.; Lucena, C.F.; Amaral, F.G.D.; Carpinelli, A.R.; Cipolla-Neto, J. Melatonin regulates maternal pancreatic remodeling and B-cell function during pregnancy and lactation. J. Pineal Res. 2021, 71, e12717. [Google Scholar] [CrossRef]
- Sharma, S.; Singh, H.; Ahmad, N.; Mishra, P.; Tiwari, A. The role of melatonin in diabetes: Therapeutic implications. Arch. Endocrinol. Metab. 2015, 59, 391–399. [Google Scholar] [CrossRef] [Green Version]
- Mühlbauer, E.; Albrecht, E.; Hofmann, K.; Bazwinsky-Wutschke, I.; Peschke, E. Melatonin inhibits insulin secretion in rat insulinoma β-cells (INS-1) heterologously expressing the human melatonin receptor isoform MT2. J. Pineal Res. 2011, 51, 361–372. [Google Scholar] [CrossRef]
- Nagorny, C.L.; Sathanoori, R.; Voss, U.; Mulder, H.; Wierup, N. Distribution of melatonin receptors in murine pancreatic islets. J. Pineal Res. 2011, 50, 412–417. [Google Scholar] [CrossRef]
- Prokopenko, I.; Langenberg, C.; Florez, J.C.; Saxena, R.; Soranzo, N.; Thorleifsson, G.; Loos, R.J.; Manning, A.K.; Jackson, A.U.; Aulchenko, Y.; et al. Variants in MTNR1B influence fasting glucose levels. Nat. Genet. 2009, 41, 77–81. [Google Scholar] [CrossRef]
- Lane, J.M.; Chang, A.M.; Bjonnes, A.C.; Aeschbach, D.; Anderson, C.; Cade, B.E.; Cain, S.W.; Czeisler, C.A.; Gharib, S.A.; Gooley, J.J.; et al. Impact of Common Diabetes Risk Variant in MTNR1B on Sleep, Circadian, and Melatonin Physiology. Diabetes 2016, 65, 1741–1751. [Google Scholar] [CrossRef] [Green Version]
- Peschke, E.; Bähr, I.; Mühlbauer, E. Experimental and clinical aspects of melatonin and clock genes in diabetes. J. Pineal Res. 2015, 59, 1–23. [Google Scholar] [CrossRef] [Green Version]
- Marcheva, B.; Ramsey, K.M.; Buhr, E.D.; Kobayashi, Y.; Su, H.; Ko, C.H.; Ivanova, G.; Omura, C.; Mo, S.; Vitaterna, M.H.; et al. Disruption of the clock components CLOCK and BMAL1 leads to hypoinsulinaemia and diabetes. Nature 2010, 466, 627–631. [Google Scholar] [CrossRef] [Green Version]
- Stamenkovic, J.A.; Olsson, A.H.; Nagorny, C.L.; Malmgren, S.; Dekker-Nitert, M.; Ling, C.; Mulder, H. Regulation of core clock genes in human islets. Metabolism 2012, 61, 978–985. [Google Scholar] [CrossRef]
Gene | Accession No. | Primer Sequence (5′ to 3′) | Length (bp) | |
---|---|---|---|---|
cClock | NM_204174.2 | F: GATCACAGGGCACCTCCAATA | R: CTAGTTCTCGCCGCCTTTCT | 301 |
cBmal1 | NM_001001463.1 | F: GTAGACCAGAGGGCGACAG | R: ATGAAACTGAACCAGCGACTC | 215 |
cBmal2 | NM_204133.1 | F: CGGCGTTCCTTCTTCTGTC | R: TTCCTCTTCCACTCCCACC | 165 |
cCry1 | NM_204245.1 | F: GATGTGGCTATCCTGTAGTTCCT | R: GCTGCTGGTAGATTTGTTTCAT | 281 |
cCry2 | NM_204244.1 | F: GCACGGCTGGATAAACACT | R: AAATAAGCGGCAGGACAAA | 141 |
cPer2 | NM_204262.1 | F: ATGAAACGAGCCATCCCG | R: CAGTTGTCGTGATTTTGCCTA | 206 |
cPer3 | XM_417528.2 | F: CAGTGCCTTTGTTGGGTTAC | R: GATGGATTCACAAAACTGGAC | 217 |
cInsulin | NM_205222.3 | F: TCTTTTCTGGCCCTGGAACC | R: GCAAGGGACTGCTCACTAGG | 159 |
cVamp2 | XM_040679081.2 | F: AAAATGTGCACGCACTGACC | R: CCTCGTGTCTGCTGAAACCT | 153 |
cGAPDH | NM_204305.1 | F: ATCACAGCCACACAGAAGACG | R: TGACTTTCCCCACAGCCTTA | 124 |
MT | cClock | cBmal1 | cBmal2 | cCry1 | cCry2 | cPer2 | cPer3 | ||
---|---|---|---|---|---|---|---|---|---|
Mesor | WPx | 4.245 ± 0.163 a* | 0.093 ± 0.001 a* | 0.021 ± 0.002 a* | 0.106 ± 0.002 a* | 0.085 ± 0.003 a* | 0.129 ± 0.006 a* | 0.077 ± 0.004 b* | 0.045 ± 0.008 a* |
RPx | 4.598 ± 0.190 a* | 0.103 ± 0.002 a* | 0.021 ± 0.005 a* | 0.094 ± 0.006 a | 0.102 ± 0.002 b* | 0.134 ± 0.005 a* | 0.078 ± 0.005 b* | 0.046 ± 0.003 a* | |
GPx | 5.377 ± 0.338 a* | 0.099 ± 0.001 a* | 0.026 ± 0.001 a* | 0.109 ± 0.004 a* | 0.089 ± 0.006 ab* | 0.131 ± 0.003 a* | 0.104 ± 0.009 a* | 0.062 ± 0.004 a* | |
BPx | 4.527 ± 0.242 a* | 0.100 ± 0.004 a* | 0.024 ± 0.002 a* | 0.106 ± 0.001 a | 0.091 ± 0.002 ab* | 0.144 ± 0.002 a* | 0.091 ± 0.002 ab* | 0.062 ± 0.003 a* | |
Amplitude | WPx | 2.267 ± 0.169 a* | 0.075 ± 0.013 a | 0.015 ± 0.002 a* | 0.029 ± 0.003 a* | 0.047 ± 0.012 a* | 0.061 ± 0.009 a* | 0.050 ± 0.007 a* | 0.046 ± 0.008 a* |
RPx | 2.225 ± 0.125 a* | 0.055 ± 0.005 a* | 0.011 ± 0.003 a* | 0.034 ± 0.006 a* | 0.046 ± 0.005 a* | 0.039 ± 0.014 a* | 0.044 ± 0.003 a* | 0.045 ± 0.005 a* | |
GPx | 2.330 ± 0.159 a* | 0.057 ± 0.002 a* | 0.015 ± 0.004 a* | 0.024 ± 0.005 a* | 0.043 ± 0.002 a* | 0.073 ± 0.004 a* | 0.045 ± 0.006 a* | 0.054 ± 0.008 a* | |
BPx | 2.386 ± 0.059 a* | 0.052 ± 0.003 a* | 0.013 ± 0.002 a* | 0.028 ± 0.009 a* | 0.042 ± 0.004 a* | 0.071 ± 0.008 a* | 0.047 ± 0.008 a* | 0.051 ± 0.003 a* | |
Acrophase | WPx | 15.58 ± 0.496 a | 10.77 ± 1.465 a* | 12.57 ± 0.346 a | 13.21 ± 0.120 a | 8.437 ± 0.563 a | 12.10 ± 0.245 ab | 4.570 ± 0.130 a | 24.818 ± 0.123 a |
(CT) | RPx | 15.56 ± 0.219 a | 13.44 ± 0.386 a* | 12.72 ± 0.745 a* | 13.74 ± 0.652 a | 8.269 ± 0.488 a | 13.02 ± 0.132 a | 3.947 ± 0.107 a | 24.439 ± 0.687 a |
GPx | 15.27 ± 0.292 a | 11.96 ± 0.265 a* | 12.59 ± 0.260 a | 11.23 ± 0.874 a | 8.276 ± 0.360 a | 10.74 ± 0.211 b* | 3.823 ± 0.854 a | 24.385 ± 0.798 a | |
BPx | 16.24 ± 0.340 a | 12.80 ± 0.544 a* | 12.96 ± 0.380 a* | 12.30 ± 0.477 a | 7.354 ± 0.142 a* | 11.88 ± 0.132 ab | 5.944 ± 0.963 a | 25.301 ± 0.880 a | |
p | WPx | 0 | 0 | 0 | 0 | 0 | 0.001 | 0 | 0 |
RPx | 0 | 0 | 0 | 0 | 0 | 0 | 0.004 | 0 | |
GPx | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
BPx | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
cVamp2 | cInsulin | cVamp2 | cInsulin | |||
---|---|---|---|---|---|---|
Mesor | WL | 0.601 ± 0.036 ab | 24.95 ± 1.281 a | WPx | 0.859 ± 0.021 *a | 21.41 ± 0.429 a |
RL | 0.752 ± 0.071 a | 24.72 ± 1.440 a | RPx | 0.943 ± 0.019 *a | 22.65 ± 0.307 a | |
GL | 0.418 ± 0.022 b | 24.95 ± 1.290 a | GPx | 0.866 ± 0.025 *a | 22.28 ± 1.023 a | |
BL | 0.465 ± 0.051 b | 24.82 ± 0.101 a | BPx | 0.867 ± 0.050 *a | 21.91 ± 2.048 a | |
Amplitude | WL | 0.494 ± 0.031 ab | 12.83 ± 0.488 a | WPx | 0.546 ± 0.012 a | 6.624 ± 1.355 *a |
RL | 0.584 ± 0.053 a | 11.91 ± 0.488 a | RPx | 0.541 ± 0.066 a | 7.204 ± 0.823 *a | |
GL | 0.294 ± 0.018 b | 14.66 ± 0.894 a | GPx | 0.541 ± 0.027 *a | 6.851 ± 0.757 *a | |
BL | 0.314 ± 0.045 b | 13.00 ± 1.545 a | BPx | 0.499 ± 0.081 a | 8.403 ± 3.476 a | |
Acrophase | WL | 4.153 ± 0.335 a | 16.89 ± 0.396 a | WPx | 2.818 ± 0.426 a | 17.42 ± 0.025 a |
(CT) | RL | 4.141 ± 0.303 a | 15.90 ± 0.757 a | RPx | 2.496 ± 0.413 *a | 16.07 ± 1.418 a |
GL | 4.254 ± 0.472 a | 18.05 ± 0.360 a | GPx | 2.222 ± 0.184 *a | 18.07 ± 0.650 a | |
BL | 3.711 ± 0.079 a | 18.45 ± 0.120 a | BPx | 2.680 ± 0.276 *a | 16.45 ± 0.899 a | |
p | WL | 0 | 0.002 | WPx | 0 | 0.006 |
RL | 0 | 0.01 | RPx | 0 | 0 | |
GL | 0 | 0 | GPx | 0 | 0 | |
BL | 0 | 0 | BPx | 0 | 0 |
MT | cClock | cBmal1 | cBmal2 | cCry1 | cCry2 | cPer2 | cPer3 | ||
---|---|---|---|---|---|---|---|---|---|
Mesor | WL | 18.47 ± 2.155 ab | 0.139 ± 0.004 bc | 0.032 ± 0.002 b | 0.111 ± 0.006 b | 0.160 ± 0.011 a | 0.266 ± 0.007 b | 0.142 ± 0.005 ab | 0.068 ± 0.008 b |
RL | 13.90 ± 1.266 b | 0.118 ± 0.003 c | 0.032 ± 0.001 b | 0.089 ± 0.002 c | 0.164 ± 0.002 a | 0.281 ± 0.007 b | 0.096 ± 0.009 c | 0.058 ± 0.003 b | |
GL | 25.19 ± 1.786 a | 0.175 ± 0.006 a | 0.043 ± 0.003 a | 0.134 ± 0.004 a | 0.168 ± 0.005 a | 0.389 ± 0.006 a | 0.148 ± 0.006 a | 0.103 ± 0.005 a | |
BL | 19.77 ± 1.400 ab | 0.151 ± 0.006 b | 0.036 ± 0.003 ab | 0.111 ± 0.002 b | 0.177 ± 0.002 a | 0.224 ± 0.006 c | 0.116 ± 0.007 b | 0.078 ± 0.002 b | |
Amplitude | WL | 13.18 ± 0.166 ab | 0.073 ± 0.009 ab | 0.025 ± 0.002 a | 0.041 ± 0.003 ab | 0.078 ± 0.005 a | 0.123 ± 0.015 b | 0.102 ± 0.003 ab | 0.068 ± 0.005 bc |
RL | 11.86 ± 1.104 b | 0.069 ± 0.003 b | 0.018 ± 0.001 b | 0.026 ± 0.004 b | 0.091 ± 0.007 a | 0.141 ± 0.006 b | 0.064 ± 0.009 b | 0.057 ± 0.005 c | |
GL | 19.38 ± 2.020 a | 0.077 ± 0.002 a | 0.030 ± 0.002 a | 0.048 ± 0.006 a | 0.077 ± 0.014 a | 0.254 ± 0.012 a | 0.107 ± 0.004 a | 0.104 ± 0.003 a | |
BL | 14.26 ± 0.826 ab | 0.076 ± 0.009 ab | 0.024 ± 0.002 ab | 0.035 ± 0.003 ab | 0.112 ± 0.004 a | 0.120 ± 0.018 b | 0.080 ± 0.017 ab | 0.077 ± 0.005 b | |
Acrophase | WL | 16.99 ± 0.244 a | 12.0 ± 0.223 a | 12.56 ± 0.261 b | 13.36 ± 0.867 a | 8.615 ± 0.271 b | 10.82 ± 0.499 a | 4.243 ± 0.137 b | 24.42 ± 0.586 a |
(CT) | RL | 15.25 ± 1.053 a | 15.5 ± 0.272 b | 10.79 ± 0.231 a | 14.51 ± 0.678 a | 8.780 ± 0.360 b | 13.22 ± 0.249 bc | 3.883 ± 0.454 b | 24.13 ± 0.405 a |
GL | 16.41 ± 0.352 a | 15.4 ± 0.595 b | 13.68 ± 0.335 b | 13.63 ± 0.332 a | 9.489 ± 0.508 ab | 14.30 ± 0.117 b | 3.068 ± 0.185 b | 24.55 ± 0.259 a | |
BL | 14.54 ± 1.196 a | 15.5 ± 0.467 b | 13.93 ± 0.550 b | 13.15 ± 0.347 a | 10.79 ± 0.259 a | 12.52 ± 0.370 c | 7.175 ± 1.297 a | 23.46 ± 0.258 a | |
p | WL | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
RL | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
GL | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | |
BL | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, C.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Role of Melatonin in Daily Variations of Plasma Insulin Level and Pancreatic Clock Gene Expression in Chick Exposed to Monochromatic Light. Int. J. Mol. Sci. 2023, 24, 2368. https://doi.org/10.3390/ijms24032368
Song C, Wang Z, Cao J, Dong Y, Chen Y. Role of Melatonin in Daily Variations of Plasma Insulin Level and Pancreatic Clock Gene Expression in Chick Exposed to Monochromatic Light. International Journal of Molecular Sciences. 2023; 24(3):2368. https://doi.org/10.3390/ijms24032368
Chicago/Turabian StyleSong, Chao, Zixu Wang, Jing Cao, Yulan Dong, and Yaoxing Chen. 2023. "Role of Melatonin in Daily Variations of Plasma Insulin Level and Pancreatic Clock Gene Expression in Chick Exposed to Monochromatic Light" International Journal of Molecular Sciences 24, no. 3: 2368. https://doi.org/10.3390/ijms24032368
APA StyleSong, C., Wang, Z., Cao, J., Dong, Y., & Chen, Y. (2023). Role of Melatonin in Daily Variations of Plasma Insulin Level and Pancreatic Clock Gene Expression in Chick Exposed to Monochromatic Light. International Journal of Molecular Sciences, 24(3), 2368. https://doi.org/10.3390/ijms24032368