Three Phages One Host: Isolation and Characterization of Pantoea agglomerans Phages from a Grasshopper Specimen
Abstract
:1. Introduction
2. Results and Discussion
2.1. Identification of the Host
2.2. Plaque and Virion Morphology of the Isolated Phages
2.3. Complete Genomes of the Isolated Phages
2.4. Scrutinizing the Place of Pantoea Phages Nifs112, Nufs112, and Nafs113 within the So-Far-Uncovered Phage Diversity
2.4.1. Selected Protein Phylogenies
2.4.2. Proteome-Based Clustering
2.4.3. Intergenomic Relationships within the Context of Proteomically Most-Similar Phages
- Nifs112 was a representative of the genus Eracentumvirus, interestingly, so far comprising only Erwinia phages;
- Nufs112 was related to Gajwadongvirus representatives but did not look like a representative of that genus itself;
- Nafs113 could firmly be considered a representative of the genus Lietduovirus, but the question of whether it represents a novel species therein remains.
2.5. Differences between Nifs112, Nufs112, and Nafs113 and Their Most Closely Related Phage Relatives
2.5.1. Pantoea Phage Nifs112
2.5.2. Pantoea Phage Nufs112
2.5.3. Pantoea Phage Nafs113
3. Materials and Methods
3.1. Host Bacteria and Phage Isolation and Propagation
3.2. Phage Concentration and Purification
3.3. Phage Sample Transmission Electron Microscopy and Virion Dimension Determination
3.4. Phage Genomic DNA Extraction and Whole-Genome Sequencing
3.5. Taxonomic Identification of the Host
3.6. Phage Genome De Novo Assembly, Functional Annotation, and Termini Verification
3.7. Elucidating the Place of Isolated Phages within the So-Far-Uncovered Phage Diversity
3.7.1. Proteome-Based Clustering with Other Cultured Phages
3.7.2. Intergenomic Distances to Other Cultured Phages
3.7.3. Selected Studied Phage Protein Phylogeny Reconstruction
3.7.4. Pairwise Genome/Proteome Comparisons with Closest Relatives
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Walterson, A.M.; Stavrinides, J. Pantoea: Insights into a highly versatile and diverse genus within the Enterobacteriaceae. FEMS Microbiol. Rev. 2015, 39, 968–984. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Luziatelli, F.; Gatti, L.; Ficca, A.G.; Medori, G.; Silvestri, C.; Melini, F.; Muleo, R.; Ruzzi, M. Metabolites Secreted by a Plant-Growth-Promoting Pantoea agglomerans Strain Improved Rooting of Pyrus communis L. cv Dar Gazi Cuttings. Front. Microbiol. 2020, 11, 539359. [Google Scholar] [CrossRef] [PubMed]
- Lorenzi, A.S.; Bonatelli, M.L.; Chia, M.A.; Peressim, L.; Quecine, M.C. Opposite Sides of Pantoea agglomerans and Its Associated Commercial Outlook. Microorganisms 2022, 10, 2072. [Google Scholar] [CrossRef] [PubMed]
- Kamber, T.; Lansdell, T.A.; Stockwell, V.O.; Ishimaru, C.A.; Smits, T.H.M.; Duffy, B. Characterization of the Biosynthetic Operon for the Antibacterial Peptide Herbicolin in Pantoea vagans Biocontrol Strain C9-1 and Incidence in Pantoea Species. Appl. Environ. Microbiol. 2012, 78, 4412–4419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, P.; Singh, R.K.; Li, H.-B.; Guo, D.-J.; Sharma, A.; Lakshmanan, P.; Malviya, M.K.; Song, X.-P.; Solanki, M.K.; Verma, K.K.; et al. Diazotrophic Bacteria Pantoea dispersa and Enterobacter asburiae Promote Sugarcane Growth by Inducing Nitrogen Uptake and Defense-Related Gene Expression. Front. Microbiol. 2021, 11, 600417. [Google Scholar] [CrossRef]
- Coutinho, T.A.; Venter, S.N. Pantoea ananatis: An unconventional plant pathogen. Mol. Plant Pathol. 2009, 10, 325–335. [Google Scholar] [CrossRef]
- Azizi, M.M.F.; Ina-Salwany, M.Y.; Zulperi, D.; Hata, E.M.; Ismail, S.I. The Emergence of Pantoea Species as a Future Threat to Global Rice Production. J. Plant Prot. Res. 2020, 60, 327–335. [Google Scholar]
- Roper, M.C. Pantoea stewartii subsp. stewartii: Lessons learned from a xylem-dwelling pathogen of sweet corn. Mol. Plant Pathol. 2011, 12, 628–637. [Google Scholar] [CrossRef]
- Brady, C.; Venter, S.; Cleenwerck, I.; Engelbeen, K.; Vancanneyt, M.; Swings, J.; Coutinho, T.A. Pantoea vagans sp. nov., Pantoea eucalypti sp. nov., Pantoea deleyi sp. nov. and Pantoea anthophila sp. nov. Int. J. Syst. Evol. Microbiol. 2009, 59, 2339–2345. [Google Scholar] [CrossRef]
- Manoharan, G.; Lalitha, P.; Jeganathan, L.P.; Dsilva, S.S.; Prajna, N.V. Pantoea ananatis as a Cause of Corneal Infiltrate after Rice Husk Injury. J. Clin. Microbiol. 2012, 50, 2163–2164. [Google Scholar] [CrossRef] [Green Version]
- Available, N.A.N. Isolation of a Pantoea dispersa -Like Strain from a 71-Year-Old Woman with Acute Myeloid Leukemia and Multiple Myeloma. Infection 2003, 31, 66–67. [Google Scholar] [CrossRef] [PubMed]
- Cruz, A.T.; Cazacu, A.C.; Allen, C.H. Pantoea agglomerans, a Plant Pathogen Causing Human Disease. J. Clin. Microbiol. 2007, 45, 1989–1992. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shubov, A.; Jagannathan, P.; Chin-Hong, P. Pantoea Agglomerans Pneumonia in a Heart-Lung Transplant Recipient: Case Report and A Review of An Emerging Pathogen in Immunocompromised Hosts. Transpl. Infect. Dis. 2011, 13, 536–539. [Google Scholar] [CrossRef] [PubMed]
- Dutkiewicz, J.; Mackiewicz, B.; Lemieszek, M.K.; Golec, M.; Milanowski, J. Pantoea agglomerans: A mysterious bacterium of evil and good. Part III. Deleterious effects: Infections of humans, animals and plants. Ann. Agric. Environ. Med. 2016, 23, 197–205. [Google Scholar] [CrossRef]
- De Baere, T.; Verhelst, R.; Labit, C.; Verschraegen, G.; Wauters, G.; Claeys, G.; Vaneechoutte, M. Bacteremic Infection with Pantoea ananatis. J. Clin. Microbiol. 2004, 42, 4393–4395. [Google Scholar] [CrossRef] [Green Version]
- Hischebeth, G.T.; Kohlhof, H.; Wimmer, M.D.; Randau, T.M.; Bekeredjian-Ding, I.; Gravius, S. Detection of Pantoea agglomerans in hip prosthetic infection by sonication of the removed prosthesis: The first reported case. Technol. Health Care 2013, 21, 613–618. [Google Scholar] [CrossRef]
- Gavini, F.; Mergaert, J.; Beji, A.; Mielcarek, C.; Izard, D.; Kersters, K.; De Ley, J. Transfer of Enterobacter agglomerans (Beijerinck 1888) Ewing and Fife 1972 to Pantoea gen. Nov. as Pantoea agglomerans comb. Nov. and Description of Pantoea dispersa sp. nov. Int. J. Syst. Evol. Microbiol. 1989, 39, 337–345. [Google Scholar] [CrossRef]
- Dutkiewicz, J.; Mackiewicz, B.; Lemieszek, M.K.; Golec, M.; Milanowski, J. Pantoea agglomerans: A mysterious bacterium of evil and good. Part IV. Beneficial effects. Ann. Agric. Environ. Med. 2016, 23, 206–222. [Google Scholar] [CrossRef]
- Adriaenssens, E.M.; Ceyssens, P.-J.; Dunon, V.; Ackermann, H.-W.; Van Vaerenbergh, J.; Maes, M.; De Proft, M.; Lavigne, R. Bacteriophages LIMElight and LIMEzero of Pantoea agglomerans, Belonging to the “phiKMV-Like Viruses”. Appl. Environ. Microbiol. 2011, 77, 3443–3450. [Google Scholar] [CrossRef] [Green Version]
- Šimoliūnas, E.; Šimoliūnienė, M.; Kaliniene, L.; Zajančkauskaitė, A.; Skapas, M.; Meškys, R.; Kaupinis, A.; Valius, M.; Truncaitė, L. Pantoea Bacteriophage vB_PagS_Vid5: A Low-Temperature Siphovirus That Harbors a Cluster of Genes Involved in the Biosynthesis of Archaeosine. Viruses 2018, 10, 583. [Google Scholar] [CrossRef] [Green Version]
- Šimoliūnienė, M.; Žukauskienė, E.; Truncaitė, L.; Cui, L.; Hutinet, G.; Kazlauskas, D.; Kaupinis, A.; Skapas, M.; Crécy-Lagard, V.; Dedon, P.; et al. Pantoea Bacteriophage vB_PagS_MED16—A Siphovirus Containing a 2′-Deoxy-7-amido-7-deazaguanosine-Modified DNA. Int. J. Mol. Sci. 2021, 22, 7333. [Google Scholar] [CrossRef]
- Petrauskaitė, E. Pantoea Genties Bakterijas Infekuojančių Bakteriofagų Charakterizavimas. Master’s Thesis, Vilniaus Universitetas, Vilnius, Lithuania, 2020. [Google Scholar]
- Žukauskienė, E.; Šimoliūnienė, M.; Truncaitė, L.; Skapas, M.; Kaupinis, A.; Valius, M.; Meškys, R.; Šimoliūnas, E. Pantoea Bacteriophage vB_PagS_AAS23: A Singleton of the Genus Sauletekiovirus. Microorganisms 2021, 9, 668. [Google Scholar] [CrossRef]
- Truncaitė, L.; Šimoliūnienė, M.; Alijošius, L.; Petrauskaitė, E.; Kiaušaitė, L.; Meškys, R.; Skapas, M.; Šimoliūnas, E. Complete genome analysis of Pantoea agglomerans-infecting bacteriophage vB_PagM_AAM22. Arch. Virol. 2020, 165, 2111–2114. [Google Scholar] [CrossRef] [PubMed]
- McDougall, D.L.; Soutar, C.D.; Perry, B.J.; Brown, C.; Alexander, D.; Yost, C.K.; Stavrinides, J. Isolation and Characterization of vB_PagP-SK1, a T7-Like Phage Infecting Pantoea agglomerans. Phage 2020, 1, 45–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roth, S.J.; Krukonis, G.P.; Delesalle, V.A. Complete Genome Sequence of the Pantoea Phage AH07. Microbiol. Resour. Announc. 2021, 10, e0081921. [Google Scholar] [CrossRef] [PubMed]
- Knecht, L.E.; Veljkovic, M.; Fieseler, L. Diversity and Function of Phage Encoded Depolymerases. Front. Microbiol. 2020, 10, 1–16. [Google Scholar] [CrossRef]
- Wittmann, J.; Turner, D.; Millard, A.D.; Mahadevan, P.; Kropinski, A.M.; Adriaenssens, E.M. From Orphan Phage to a Proposed New Family–the Diversity of N4-Like Viruses. Antibiotics 2020, 9, 663. [Google Scholar] [CrossRef]
- Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.G.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef] [Green Version]
- Merrill, B.D.; Ward, A.T.; Grose, J.H.; Hope, S. Software-based analysis of bacteriophage genomes, physical ends, and packaging strategies. BMC Genom. 2016, 17, 1–16. [Google Scholar] [CrossRef] [Green Version]
- Zrelovs, N.; Jansons, J.; Dislers, A.; Kazaks, A. Morganella Phage Mecenats66 Utilizes an Evolutionarily Distinct Subtype of Headful Genome Packaging with a Preferred Packaging Initiation Site. Microorganisms 2022, 10, 1799. [Google Scholar] [CrossRef]
- Van der Wilk, F.; Dullemans, A.M.; Verbeek, M.; van den Heuvel, J.F. Isolation and characterization of APSE-1, a bacteriophage infecting the secondary endosymbiont of Acyrthosiphon pisum. Virology 1999, 262, 104–113. [Google Scholar] [CrossRef] [PubMed]
- Casjens, S.; Winn-Stapley, D.A.; Gilcrease, E.B.; Morona, R.; Kühlewein, C.; Chua, J.E.; Manning, P.A.; Inwood, W.; Clark, A.J. The Chromosome of Shigella flexneri Bacteriophage Sf6: Complete Nucleotide Sequence, Genetic Mosaicism, and DNA Packaging. J. Mol. Biol. 2004, 339, 379–394. [Google Scholar] [CrossRef] [PubMed]
- Almpanis, A.; Swain, M.; Gatherer, D.; McEwan, N. Correlation between bacterial G+C content, genome size and the G+C content of associated plasmids and bacteriophages. Microb. Genom. 2018, 4, e000168. [Google Scholar] [CrossRef] [PubMed]
- Turner, D.; Kropinski, A.; Adriaenssens, E. A Roadmap for Genome-Based Phage Taxonomy. Viruses 2021, 13, 506. [Google Scholar] [CrossRef] [PubMed]
- Cook, R.; Brown, N.; Redgwell, T.; Rihtman, B.; Barnes, M.; Clokie, M.; Stekel, D.J.; Hobman, J.; Jones, M.A.; Millard, A. INfrastructure for a PHAge REference Database: Identification of Large-Scale Biases in the Current Collection of Cultured Phage Genomes. Phage 2021, 2, 214–223. [Google Scholar] [CrossRef]
- Bolduc, B.; Bin Jang, H.; Doulcier, G.; You, Z.-Q.; Roux, S.; Sullivan, M.B. vConTACT: An iVirus tool to classify double-stranded DNA viruses that infect Archaea and Bacteria. PeerJ 2017, 5, e3243. [Google Scholar] [CrossRef] [Green Version]
- Moraru, C.; Varsani, A.; Kropinski, A.M. VIRIDIC—A Novel Tool to Calculate the Intergenomic Similarities of Prokaryote-Infecting Viruses. Viruses 2020, 12, 1268. [Google Scholar] [CrossRef]
- Vandenbergh, P.A.; Wright, A.M.; Vidaver, A.K. Partial Purification and Characterization of a Polysaccharide Depolymerase Associated with Phage-Infected Erwinia amylovora. Appl. Environ. Microbiol. 1985, 49, 994–996. [Google Scholar] [CrossRef] [Green Version]
- Knecht, L.E.; Born, Y.; Pothier, J.F.; Loessner, M.J.; Fieseler, L. Complete Genome Sequences of Erwinia amylovora Phages vB_EamP-S2 and vB_EamM-Bue1. Genome Announc. 2018, 7, e00891-18. [Google Scholar] [CrossRef] [Green Version]
- Besarab, N.V.; Letarova, M.; Babenko, V.; Belalov, I.; Golomidova, A.; Kulikov, E.; Lagonenko, A.; Evtushenkov, A.; Letarov, A. The Metastable Associations of Bacteriophages and Erwinia Amylovora. 27 October 2022, PREPRINT (Version 1). Available online: https://www.researchsquare.com (accessed on 7 December 2022).
- Muller, I.; Kube, M.; Reinhardt, R.; Jelkmann, W.; Geider, K. Complete Genome Sequences of Three Erwinia amylovora Phages Isolated in North America and a Bacteriophage Induced from an Erwinia tasmaniensis Strain. J. Bacteriol. 2011, 193, 795–796. [Google Scholar] [CrossRef] [Green Version]
- Gill, J.J.; Svircev, A.M.; Smith, R.; Castle, A.J. Bacteriophages of Erwinia amylovora. Appl. Environ. Microbiol. 2003, 69, 2133–2138. [Google Scholar] [CrossRef] [PubMed]
- Born, Y.; Fieseler, L.; Marazzi, J.; Lurz, R.; Duffy, B.; Loessner, M.J. Novel Virulent and Broad-Host-Range Erwinia amylovora Bacteriophages Reveal a High Degree of Mosaicism and a Relationship to Enterobacteriaceae Phages. Appl. Environ. Microbiol. 2011, 77, 5945–5954. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kemp, P.; Garcia, L.R.; Molineux, I.J. Changes in bacteriophage T7 virion structure at the initiation of infection. Virology 2005, 340, 307–317. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.S.; Jang, H.B.; Kim, K.S.; Kim, T.H.; Im, S.P.; Kim, S.W.; Lazarte, J.M.S.; Kim, J.S.; Jung, T.S. Complete Genomic and Lysis-Cassette Characterization of the Novel Phage, KBNP1315, which Infects Avian Pathogenic Escherichia coli (APEC). PLoS ONE 2015, 10, e0142504. [Google Scholar] [CrossRef] [Green Version]
- Lukianova, A.A.; Shneider, M.M.; Evseev, P.V.; Shpirt, A.M.; Bugaeva, E.N.; Kabanova, A.P.; Obraztsova, E.A.; Miroshnikov, K.K.; Senchenkova, S.N.; Shashkov, A.S.; et al. Morphologically Different Pectobacterium brasiliense Bacteriophages PP99 and PP101: Deacetylation of O-Polysaccharide by the Tail Spike Protein of Phage PP99 Accompanies the Infection. Front. Microbiol. 2020, 10, 3147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Latka, A.; Maciejewska, B.; Majkowska-Skrobek, G.; Briers, Y.; Drulis-Kawa, Z. Bacteriophage-encoded virion-associated enzymes to overcome the carbohydrate barriers during the infection process. Appl. Microbiol. Biotechnol. 2017, 101, 3103–3119. [Google Scholar] [CrossRef] [Green Version]
- Amarillas, L.; Estrada-Acosta, M.; León-Chan, R.G.; López-Orona, C.; León-Félix, J.; Lightbourn, L. Complete Genome Sequence of Ralstonia Phage Remenis, a Member of Putative New Genus within the Siphoviridae. Am. J. Potato Res. 2020, 97, 1–3. [Google Scholar] [CrossRef]
- Starmer, J.; Stomp, A.; Vouk, M.; Bitzer, D. Predicting Shine–Dalgarno Sequence Locations Exposes Genome Annotation Errors. PLoS Comput. Biol. 2006, 2, e57. [Google Scholar] [CrossRef] [Green Version]
- Irmscher, T.; Roske, Y.; Gayk, I.; Dunsing, V.; Chiantia, S.; Heinemann, U.; Barbirz, S. Pantoea stewartii WceF is a glycan biofilm-modifying enzyme with a bacteriophage tailspike-like fold. J. Biol. Chem. 2021, 296, 100286. [Google Scholar] [CrossRef]
- Zrelovs, N.; Dislers, A.; Kazaks, A. Genome Characterization of Nocturne116, Novel Lactococcus lactis-Infecting Phage Isolated from Moth. Microorganisms 2021, 9, 1540. [Google Scholar] [CrossRef]
- Kropinski, A.M.; Mazzocco, A.; Waddell, T.E.; Lingohr, E.; Johnson, R.P. Enumeration of Bacteriophages by Double Agar Overlay Plaque Assay. In Bacteriophages. Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2009; Volume 501, pp. 69–76. ISBN 978-1-58829-682-5. [Google Scholar]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 Years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoon, S.-H.; Ha, S.-M.; Kwon, S.; Lim, J.; Kim, Y.; Seo, H.; Chun, J. Introducing EzBioCloud: A taxonomically united database of 16S rRNA gene sequences and whole-genome assemblies. Int. J. Syst. Evol. Microbiol. 2017, 67, 1613–1617. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Green Version]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evol. Int. J. Org. Evol. 1985, 39, 783–791. [Google Scholar] [CrossRef]
- Andrews, S. FastQC—A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 17 November 2021).
- Bushnell, B. BBMap: A Fast, Accurate, Splice-Aware Aligner. In Proceedings of the Conference: 9th Annual Genomics of Energy & Environment Meeting, Walnut Creek, CA, USA, 17–20 March 2014. [Google Scholar]
- Wick, R.R.; Judd, L.M.; Gorrie, C.L.; Holt, K.E. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput. Biol. 2017, 13, 1–22. [Google Scholar] [CrossRef] [Green Version]
- Garneau, J.R.; Depardieu, F.; Fortier, L.-C.; Bikard, D.; Monot, M. PhageTerm: A tool for fast and accurate determination of phage termini and packaging mechanism using next-generation sequencing data. Sci. Rep. 2017, 7, 1–10. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows—Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [Green Version]
- Okonechnikov, K.; Golosova, O.; Fursov, M.; Varlamov, A.; Vaskin, Y.; Efremov, I.; German Grehov, O.G.; Kandrov, D.; Rasputin, K.; Syabro, M.; et al. Unipro UGENE: A unified bioinformatics toolkit. Bioinformatics 2012, 28, 1166–1167. [Google Scholar] [CrossRef] [PubMed]
- Amin, M.R.; Yurovsky, A.; Chen, Y.; Skiena, S.; Futcher, B. Re-annotation of 12,495 prokaryotic 16S rRNA 3’ ends and analysis of Shine-Dalgarno and anti-Shine-Dalgarno sequences. PLoS ONE 2018, 13, e0202767. [Google Scholar] [CrossRef] [PubMed]
- Krogh, A.; Larsson, B.; von Heijne, G.; Sonnhammer, E.L. Predicting transmembrane protein topology with a hidden markov model: Application to complete genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef] [Green Version]
- Käll, L.; Krogh, A.; Sonnhammer, E. Advantages of combined transmembrane topology and signal peptide prediction--the Phobius web server. Nucleic Acids Res. 2007, 35, W429–W432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, L.-T.; Schmidt, H.A.; Von Haeseler, A.; Minh, B.Q. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Minh, B.Q.; Nguyen, M.A.T.; Von Haeseler, A. Ultrafast Approximation for Phylogenetic Bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef] [Green Version]
- Kohl, M.; Wiese, S.; Warscheid, B. Cytoscape: Software for Visualization and Analysis of Biological Networks. In Data Mining in Proteomics: From Standards to Applications; Hamacher, M., Eisenacher, M., Stephan, C., Eds.; Humana Press: Totowa, NJ, USA, 2011; pp. 291–303. ISBN 978-1-60761-987-1. [Google Scholar]
- Paradis, E.; Schliep, K. ape 5.0: An environment for modern phylogenetics and evolutionary analyses in R. Bioinformatics 2019, 35, 526–528. [Google Scholar] [CrossRef]
- Sullivan, M.J.; Petty, N.K.; Beatson, S.A. Easyfig: A genome comparison visualizer. Bioinformatics 2011, 27, 1009–1010. [Google Scholar] [CrossRef] [Green Version]
- Gilchrist, C.L.M.; Chooi, Y.-H. Clinker & clustermap.js: Automatic generation of gene cluster comparison figures. Bioinformatics 2021, 37, 2473–2475. [Google Scholar] [CrossRef]
- Stajich, J.E.; Block, D.; Boulez, K.; Brenner, S.E.; Chervitz, S.A.; Dagdigian, C.; Fuellen, G.; Gilbert, J.G.; Korf, I.; Lapp, H.; et al. The Bioperl Toolkit: Perl Modules for the Life Sciences. Genome Res. 2002, 12, 1611–1618. [Google Scholar] [CrossRef] [PubMed]
Genome Accession | Pantoea Phage (Reference) | Genome Length (bp) | GC% | ORFs | Family | Genus | Host | Isolation Source |
---|---|---|---|---|---|---|---|---|
FR687252.1 | LIMElight [19] | 44,546 | 53.991 | 55 | Autographiviridae | Limelightvirus | P. agglomerans | soil from potato trial field |
FR751545.1 | LIMEzero [19] | 43,032 | 55.352 | 57 | Autographiviridae | Waewaevirus | P. agglomerans | soil from potato trial field |
MG948468.1 | vB_PagS_Vid5 [20] | 61,437 | 48.821 | 99 | not defined | Vidquintavirus | P. agglomerans | Amelanchier spicata |
MK095605.1 | vB_PagS_MED16 [21,22] | 46,103 | 55.111 | 73 | Siphoviridae (!) | not defined * | P. agglomerans | Amelanchier spicata |
MK095606.1 | vB_PagS_AAS23 [22,23] | 51,170 | 47.645 | 92 | Drexlerviridae | Sauletekiovirus | P. agglomerans | Ribes Jostabeere |
MK388689.1 | vB_PagM_LIET2 [22] | 74,710 | 53.989 | 131 | not defined | Lietduovirus | P. agglomerans BSL | Amelanchier spicata |
MK770119.1 | vB_PagS_AAS21 [22] | 116,649 | 39.007 | 213 | Demerecviridae | not defined * | P. agglomerans AUR | Ribes Jostabeere |
MK798142.1 | vB_PagM_AAM22 [24] | 49,744 | 48.436 | 96 | Myoviridae (!) | not defined * | P. agglomerans AUR | Ribes Jostabeere |
MK798143.1 | vB_PagM_AAM37 | 49,990 | 52.048 | 86 | not defined | Dibbivirus | P. agglomerans AUR | Ribes Jostabeere |
MK798144.1 | vB_PagM_PSKM | 49,935 | 52.356 | 82 | not defined | Dibbivirus | P. agglomerans ARC | Amelanchier spicata |
MN450150.1 | vB_PagP-SK1 [25] | 39,938 | 52.324 | 42 | Autographiviridae | Elunavirus * | P. agglomerans SN01121 | barnyard soil |
MT230534.1 | vB_PagM_SSEM1 | 54,982 | 44.182 | 97 | Chaseviridae | Loessnervirus | P. agglomerans strain SER | red currant |
MZ501269.1 | AH01 | 46,062 | 52.232 | 69 | not defined | not defined * | Pantoea sp. | leaf of horse chestnut tree |
MZ501270.1 | AH07 [26] | 37,859 | 52.220 | 58 | Myoviridae(!) | not defined * | Pantoea sp. | leaf of horse chestnut tree |
OK570184.1 | Nifs112 [This study] | 46,202 | 50.214 | 59 | Autographiviridae | Eracentumvirus * | P. agglomerans | insect gut |
OK570185.1 | Nufs112 [This study] | 45,951 | 47.701 | 67 | Autographiviridae | not defined* | P. agglomerans | insect gut |
OK570186.1 | Nafs113 [This study] | 75,899 | 54.067 | 130 | not defined | Lietduovirus * | P. agglomerans | insect gut |
OL396571.1 | PdC23 | 44,715 | 49.661 | 75 | Siphoviridae(!) | not defined * | P. dispersa LMG2603 | waste water |
OL744209.1 | vB_PdeP_F1M1C | 38,645 | 50.734 | 55 | Autographiviridae | Teetrevirus * | P. deleyi | stormwater streams |
OL744212.1 | vB_PdeP_F2M1C | 39,424 | 50.700 | 57 | Autographiviridae | Teetrevirus * | P. deleyi | stormwater streams |
OL744217.1 | vB_PdeP_F5M1C | 36,790 | 50.155 | 56 | Autographiviridae | Teetrevirus * | P. deleyi | drain water |
OL744220.1 | vB_PdiM_F5M2A | 149,913 | 50.579 | 320 | not defined | Certrevirus * | P. dispersa | drain water |
Phage | Virion Morphology | Genome Accession | Genome Length | Genome GC Content (%) | Genome Termini | Mean Genome Depth | Whole-Genome Coverage | ORFs | Hypothetical Proteins |
---|---|---|---|---|---|---|---|---|---|
Nifs112 | Podophage | OK570184.1 | 46,202 | 50.2% | 296 bp SDTR | 223× | ≥106× | 59 | 28/59 |
Nufs112 | Podophage | OK570185.1 | 45,951 | 47.7% | 410 bp SDTR | 685× | ≥324× | 67 | 35/67 |
Nafs113 | Myophage | OK570186.1 | 75,899 | 54.1% | Circularly permuted | 286× | ≥30× | 130 | 91/130 |
Phage (Accession) | Primer | Primer Sequence (5′–3′) | Coordinates |
---|---|---|---|
Nifs112 (OK570184) | ph112-1_Fw | TGATGTATGCGTGTGTCAGC | 45,884–45,903 |
ph112-1_Rv | AGCCACTGTGTAGCCTAGG | 314–332 | |
Nufs112 (OK570185) | ph112-2_Fw | GGTCAGGAACTTACGTGAGG | 45,521–45,540 |
ph112-2_Rv | CCACCAGAGGTTGAGTGAC | 422–440 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zrelovs, N.; Jansons, J.; Kazaka, T.; Kazaks, A.; Dislers, A. Three Phages One Host: Isolation and Characterization of Pantoea agglomerans Phages from a Grasshopper Specimen. Int. J. Mol. Sci. 2023, 24, 1820. https://doi.org/10.3390/ijms24031820
Zrelovs N, Jansons J, Kazaka T, Kazaks A, Dislers A. Three Phages One Host: Isolation and Characterization of Pantoea agglomerans Phages from a Grasshopper Specimen. International Journal of Molecular Sciences. 2023; 24(3):1820. https://doi.org/10.3390/ijms24031820
Chicago/Turabian StyleZrelovs, Nikita, Juris Jansons, Tatjana Kazaka, Andris Kazaks, and Andris Dislers. 2023. "Three Phages One Host: Isolation and Characterization of Pantoea agglomerans Phages from a Grasshopper Specimen" International Journal of Molecular Sciences 24, no. 3: 1820. https://doi.org/10.3390/ijms24031820
APA StyleZrelovs, N., Jansons, J., Kazaka, T., Kazaks, A., & Dislers, A. (2023). Three Phages One Host: Isolation and Characterization of Pantoea agglomerans Phages from a Grasshopper Specimen. International Journal of Molecular Sciences, 24(3), 1820. https://doi.org/10.3390/ijms24031820