Identification and Functional Analysis of an Epsilon Class Glutathione S-Transferase Gene Associated with α-Pinene Adaptation in Monochamus alternatus
Abstract
:1. Introduction
2. Results
2.1. The Effects of α-Pinene Treatment on M. alternatus Larvae
2.2. Physicochemical Properties and Bioinformatics Analysis of MaGSTe3
2.3. Response of MaGSTe3 to α-Pinene Stress
2.4. Enzymatic Properties of Recombinant MaGSTe3
2.5. Disk Diffusion Assay of MaGSTe3
2.6. RNAi of MaGSTe3
3. Discussion
4. Materials and Methods
4.1. Insect Collection and Treatment
4.2. Determination of Hydrogen Peroxide, MDA, and Activity of GSTs
4.3. RNA Isolation and cDNA Synthesis
4.4. Amplification and Cloning of MaGSTe3
4.5. Sequence and Phylogenetic Analysis of MaGSTe3
4.6. qRT-PCR
4.7. Prokaryotic Expression and Purification of Recombinant MaGSTe3 Protein
4.8. Enzyme Activity Assays of the Recombinant MaGSTe3
4.9. Disk Diffusion Assay
4.10. RNA Interference
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Appendix B
Prime Name | Primer Sequence (5′→3′) |
---|---|
MaGSTe3-F | ATGACGGTTATAGTGTATGGGAC |
MaGSTe3-R | TTAAGCCAGTTTGCTCTTAAACGCTG |
Prime Name | Primer Sequence (5′→3′) |
---|---|
RPL-10-qF | GACAAACGTTTCAGCGGAAC |
RPL-10-qR | TGCTGTTGATCGCCCAAAAC |
MaGSTe3-qF | CAGAAGAGGGCCGTGGTTA |
MaGSTe3-qR | CAGCAGCGTAAGTGCTTCTT |
Dialysates Name | Components |
---|---|
Dialysates I | 40 mM PBS (pH = 7.4), 200 mM NaCl, 200 mM imidazole |
Dialysates II | 20 mM PBS (pH = 7.4), 100 mM NaCl, 10 mM imidazole |
Dialysates III | sterile water |
Gene Name | Length | Mw | pI | BLASTX Best Hit | Subcellular Location | |||
---|---|---|---|---|---|---|---|---|
(bp) | (kDa) | Species | Acc. No. | E-Value | Identity | |||
(%) | ||||||||
MaGSTe3 | 648 | 23.58 | 5.72 | Anoplophora glabripennis | XP_018564047.1 | 2 × 10−9 | 99 | Cytoplasmic |
Prime Name | Primer Sequence (5′→3′) |
---|---|
ds-MaGSTe3-T7-F | taatacgactcactatagggAGTGAACACTATGGCTGGGG |
ds-MaGSTe3-T7-R | taatacgactcactatagggGACGCGTAGTAAGGCAAAGC |
ds-GFP-T7-F | ggatcctaatacgactcactataggATGAGTAAAGGAGAAGAACTTTTC |
ds-GFP-T7-R | ggatcctaatacgactcactataggTTTGTATAGTTCATCCATGCCAT |
ds-MaGSTe3-q-F | ACCAGTGCCACTACAACAATG |
ds-MaGSTe3-q-R | GTTCCTCTGACGACTGGACT |
References
- Wilf, P.; Labandeira, C.C.; Johnson, K.R.; Coley, P.D.; Cutter, A.D. Insect herbivory, plant defense, and early Cenozoic climate change. Proc. Natl. Acad. Sci. USA 2001, 98, 6221–6226. [Google Scholar] [CrossRef]
- Keeling, C.I.; Bohlmann, J. Genes, enzymes and chemicals of terpenoid diversity in the constitutive and induced defence of conifers against insects and pathogens. New Phytol. 2006, 170, 657–675. [Google Scholar] [CrossRef]
- Trapp, S.; Croteau, R. Defensive resin biosynthesis in conifers. Annu. Rev. Plant Biol. 2001, 52, 689–724. [Google Scholar] [CrossRef]
- Franceschi, V.R.; Krokene, P.; Christiansen, E.; Krekling, T. Anatomical and chemical defenses of conifer bark against bark beetles and other pests. New Phytol. 2005, 167, 353–376. [Google Scholar] [CrossRef]
- Phillips, M.A.; Croteau, R.B. Resin-based defenses in conifers. Trends Plant Sci. 1999, 4, 184–190. [Google Scholar] [CrossRef]
- Liu, B.; Chen, H. Disruption of CYP6DF1 and CYP6DJ2 increases the susceptibility of Dendroctonus armandi to (+)-α-pinene. Pestic. Biochem. Physiol. 2022, 188, 105270. [Google Scholar] [CrossRef]
- Shahriari, M.; Zibaee, A.; Sahebzadeh, N.; Shamakhi, L. Effects of α-pinene, trans-anethole, and thymol as the essential oil constituents on antioxidant system and acetylcholine esterase of Ephestia kuehniella Zeller (Lepidoptera: Pyralidae). Pestic. Biochem. Physiol. 2018, 150, 40–47. [Google Scholar] [CrossRef]
- Chiu, C.C.; Keeling, C.I.; Bohlmann, J. Toxicity of pine monoterpenes to mountain pine beetle. Sci. Rep. 2017, 7, 8858. [Google Scholar] [CrossRef]
- Abrahim, D.; Francischini, A.C.; Pergo, E.M.; Kelmer-Bracht, A.M.; Ishii-Iwamoto, E.L. Effects of α-pinene on the mitochondrial respiration of maize seedlings. Plant Physiol. Biochem. 2003, 41, 985–991. [Google Scholar] [CrossRef]
- Singh, H.P.; Batish, D.R.; Kaur, S.; Arora, K.; Kohli, R.K. α-Pinene inhibits growth and induces oxidative stress in roots. Ann. Bot. 2006, 98, 1261–1269. [Google Scholar] [CrossRef]
- Fernanda López, M.; Cano-Ramírez, C.; Shibayama, M.; Zúñiga, G. α-Pinene and myrcene induce ultrastructural changes in the midgut of Dendroctonus valens (Coleoptera: Curculionidae: Scolytinae). Ann. Entomol. Soc. Am. 2011, 104, 553–561. [Google Scholar] [CrossRef]
- Rufino, A.T.; Ribeiro, M.; Judas, F.; Salgueiro, L.; Lopes, M.C.; Cavaleiro, C.; Mendes, A.F. Anti-inflammatory and chondroprotective activity of (+)-α-pinene: Structural and enantiomeric selectivity. J. Nat. Prod. 2014, 77, 264–269. [Google Scholar] [CrossRef]
- Ye, J. Epidemic Status of Pine Wilt Disease in China and Its Prevention and Control Techniques and Counter Measures. Sci. Silvae Sin. 2019, 55, 1–10. [Google Scholar]
- Li, M.; Li, H.; Sheng, R.-C.; Sun, H.; Sun, S.-H.; Chen, F.-M. The first record of Monochamus saltuarius (Coleoptera; Cerambycidae) as vector of Bursaphelenchus xylophilus and its new potential hosts in China. Insects 2020, 11, 636. [Google Scholar] [CrossRef]
- Li, H.; Zhao, X.; Qiao, H.; He, X.; Tan, J.; Hao, D. Comparative transcriptome analysis of the heat stress response in Monochamus alternatus Hope (Coleoptera: Cerambycidae). Front. Physiol. 2020, 10, 1568. [Google Scholar] [CrossRef]
- Chen, R.; He, X.; Chen, J.; Gu, T.; Liu, P.; Xu, T.; Teale, S.A.; Hao, D. Traumatic resin duct development, terpenoid formation, and related synthase gene expression in Pinus massoniana under feeding pressure of Monochamus alternatus. J. Plant Growth Regul. 2019, 38, 897–908. [Google Scholar] [CrossRef]
- He, X.; Hao, Z.; Li, H.; Xu, T.; Chen, R.; Xia, X.; Li, S.; Hao, D. Transcriptome profiling and RNA interference reveals relevant detoxification genes in Monochamus alternatus response to (+)-α-pinene. J. Appl. Entomol. 2022, 146, 823–837. [Google Scholar] [CrossRef]
- Krishnan, N.; Kodrík, D. Antioxidant enzymes in Spodoptera littoralis (Boisduval): Are they enhanced to protect gut tissues during oxidative stress? J. Insect Physiol. 2006, 52, 11–20. [Google Scholar] [CrossRef]
- Wu, D.; Yang, Z.; Huang, Y. Analysis and evaluation of resin productivity and resin component among different half sibling families of Pinus massoniana. J. Beijing For. Univ. 2019, 41, 53–61. [Google Scholar]
- Mercier, B.; Prost, J.; Prost, M. The essential oil of turpentine and its major volatile fraction (α-and β-pinenes): A review. Int. J. Occup. Med. Environ. Health 2009, 22, 331–342. [Google Scholar] [CrossRef]
- Xu, B.B.; Liu, Z.D.; Sun, J.H. The effects of α-pinene on the feeding performance and pheromone production of Dendroctonus valens. Entomol. Exp. Et Appl. 2014, 150, 269–278. [Google Scholar] [CrossRef]
- Tsikas, D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Anal. Biochem. 2017, 524, 13–30. [Google Scholar] [CrossRef]
- Meng, J.-Y.; Zhang, C.-Y.; Zhu, F.; Wang, X.-P.; Lei, C.-L. Ultraviolet light-induced oxidative stress: Effects on antioxidant response of Helicoverpa armigera adults. J. Insect Physiol. 2009, 55, 588–592. [Google Scholar] [CrossRef]
- Sun, L.; Yin, J.; Du, H.; Liu, P.; Cao, C. Characterisation of GST genes from the Hyphantria cunea and their response to the oxidative stress caused by the infection of Hyphantria cunea nucleopolyhedrovirus (HcNPV). Pestic. Biochem. Physiol. 2020, 163, 254–262. [Google Scholar] [CrossRef]
- Singh, S.P.; Coronella, J.A.; Beneš, H.; Cochrane, B.J.; Zimniak, P. Catalytic function of Drosophila melanogaster glutathione S-transferase DmGSTS1-1 (GST-2) in conjugation of lipid peroxidation end products. Eur. J. Biochem. 2001, 268, 2912–2923. [Google Scholar] [CrossRef]
- Ding, Y.; Ortelli, F.; Rossiter, L.C.; Hemingway, J.; Ranson, H. The Anopheles gambiae glutathione transferase supergene family: Annotation, phylogeny and expression profiles. BMC Genom. 2003, 4, 35. [Google Scholar] [CrossRef]
- Jing, T.-X.; Wu, Y.-X.; Li, T.; Wei, D.-D.; Smagghe, G.; Wang, J.-J. Identification and expression profiles of fifteen delta-class glutathione S-transferase genes from a stored-product pest, Liposcelis entomophila (Enderlein)(Psocoptera: Liposcelididae). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2017, 206, 35–41. [Google Scholar] [CrossRef]
- Meng, L.W.; Yuan, G.R.; Lu, X.P.; Jing, T.X.; Zheng, L.S.; Yong, H.X.; Wang, J.J. Two delta class glutathione S-transferases involved in the detoxification of malathion in Bactrocera dorsalis (Hendel). Pest Manag. Sci. 2019, 75, 1527–1538. [Google Scholar] [CrossRef]
- Tao, F.; Si, F.L.; Hong, R.; He, X.; Li, X.Y.; Qiao, L.; He, Z.B.; Yan, Z.T.; He, S.L.; Chen, B. Glutathione S-transferase (GST) genes and their function associated with pyrethroid resistance in the malaria vector Anopheles sinensis. Pest Manag. Sci. 2022, 78, 4127–4139. [Google Scholar] [CrossRef]
- Gonzalez, D.; Fraichard, S.; Grassein, P.; Delarue, P.; Senet, P.; Nicolaï, A.; Chavanne, E.; Mucher, E.; Artur, Y.; Ferveur, J.-F. Characterization of a Drosophila glutathione transferase involved in isothiocyanate detoxification. Insect Biochem. Mol. Biol. 2018, 95, 33–43. [Google Scholar] [CrossRef]
- Dai, L.; Ma, J.; Ma, M.; Zhang, H.; Shi, Q.; Zhang, R.; Chen, H. Characterisation of GST genes from the Chinese white pine beetle Dendroctonus armandi (Curculionidae: Scolytinae) and their response to host chemical defence. Pest Manag. Sci. 2016, 72, 816–827. [Google Scholar] [CrossRef]
- Gao, H.; Dai, L.; Fu, D.; Sun, Y.; Chen, H. Isolation, expression profiling, and regulation via host allelochemicals of 16 Glutathione S-Transferases in the Chinese White Pine Beetle, Dendroctonus armandi. Front. Physiol. 2020, 11, 546592. [Google Scholar] [CrossRef]
- Li, S.; Wang, J.; Chen, C.; Li, H.; Hao, D. Tolerance, biochemistry and related gene expression in Pagiophloeus tsushimanus (Coleoptera: Curculionidae) exposed to chemical stress from headspace host-plant volatiles. Agric. For. Entomol. 2022, 24, 189–203. [Google Scholar] [CrossRef]
- Gao, H.; Lin, X.; Yang, B.; Liu, Z. The roles of GSTs in fipronil resistance in Nilaparvata lugens: Over-expression and expression induction. Pestic. Biochem. Physiol. 2021, 177, 104880. [Google Scholar] [CrossRef]
- Li, H.M.; Buczkowski, G.; Mittapalli, O.; Xie, J.; Wu, J.; Westerman, R.; Schemerhorn, B.; Murdock, L.; Pittendrigh, B. Transcriptomic profiles of Drosophila melanogaster third instar larval midgut and responses to oxidative stress. Insect Mol. Biol. 2008, 17, 325–339. [Google Scholar] [CrossRef]
- Enayati, A.A.; Ranson, H.; Hemingway, J. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 2005, 14, 3–8. [Google Scholar] [CrossRef]
- Huang, Y.; Xu, Z.; Lin, X.; Feng, Q.; Zheng, S. Structure and expression of glutathione S-transferase genes from the midgut of the Common cutworm, Spodoptera litura (Noctuidae) and their response to xenobiotic compounds and bacteria. J. Insect Physiol. 2011, 57, 1033–1044. [Google Scholar] [CrossRef]
- Chen, X.; Liu, J.; Zhang, C.; Li, Y.; Liu, T.; Wang, L.; Yu, Q.; Zhang, Y.; Lu, C.; Pan, M. The silkworm GSTe4 is sensitive to phoxim and protects HEK293 cells against UV-induced cell apoptosis. Bull. Entomol. Res. 2015, 105, 399–407. [Google Scholar] [CrossRef]
- Li, S.; Li, H.; Wang, J.; Chen, C.; Hao, D. Hormetic response and co-expression of cytochrome P450 and cuticular protein reveal the tolerance to host-specific terpenoid defences in an emerging insect pest, Pagiophloeus tsushimanus (Coleoptera: Curculionidae). J. Pest Sci. 2023, 96, 141–160. [Google Scholar] [CrossRef]
- Balakrishnan, B.; Su, S.; Wang, K.; Tian, R.; Chen, M. Identification, expression, and regulation of an omega class glutathione S-transferase in Rhopalosiphum padi (L.)(Hemiptera: Aphididae) under insecticide stress. Front. Physiol. 2018, 9, 427. [Google Scholar] [CrossRef]
- Zhang, Y.; Yang, B.; Yu, N.; Luo, G.; Gao, H.; Lin, X.; Liu, Z. Insecticide resistance associated overexpression of two sigma GST genes assists Nilaparvata lugens to remedy oxidative stress from feeding on resistant rice variety. Pestic. Biochem. Physiol. 2022, 188, 105230. [Google Scholar] [CrossRef]
- Hassan, F.; Singh, K.P.; Ali, V.; Behera, S.; Shivam, P.; Das, P.; Dinesh, D.S. Detection and functional characterization of sigma class GST in Phlebotomus argentipes and its role in stress tolerance and DDT resistance. Sci. Rep. 2019, 9, 19636. [Google Scholar] [CrossRef]
- Zhang, S.; Shen, S.; Peng, J.; Zhou, X.; Kong, X.; Ren, P.; Liu, F.; Han, L.; Zhan, S.; Huang, Y. Chromosome-level genome assembly of an important pine defoliator, Dendrolimus punctatus (Lepidoptera; Lasiocampidae). Mol. Ecol. Resour. 2020, 20, 1023–1037. [Google Scholar] [CrossRef]
- Keeling, C.I.; Henderson, H.; Li, M.; Yuen, M.; Clark, E.L.; Fraser, J.D.; Huber, D.P.; Liao, N.Y.; Docking, T.R.; Birol, I. Transcriptome and full-length cDNA resources for the mountain pine beetle, Dendroctonus ponderosae Hopkins, a major insect pest of pine forests. Insect Biochem. Mol. Biol. 2012, 42, 525–536. [Google Scholar] [CrossRef]
- Cui, X.; Wang, C.; Wang, X.; Li, G.; Liu, Z.; Wang, H.; Guo, X.; Xu, B. Molecular Mechanism of the UDP-Glucuronosyltransferase 2B20-like Gene (AccUGT2B20-like) in Pesticide Resistance of Apis cerana cerana. Front. Genet. 2020, 11, 592595. [Google Scholar] [CrossRef]
- Chen, R.; Wang, L.; Lin, T.; Wei, Z.; Wang, Y.; Hao, D. Rearing techniques of Monochamus alternatus Hope (Coleoptera: Cerambycidae) on artificial diets. J. Nanjing For. Univ. 2017, 60, 199. [Google Scholar]
- Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef]
- Burmeister, C.; Lüersen, K.; Heinick, A.; Hussein, A.; Domagalski, M.; Walter, R.D.; Liebau, E. Oxidative stress in Caenorhabditis elegans: Protective effects of the Omega class glutathione transferase (GSTO-1). FASEB J. 2008, 22, 343–354. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xue, M.; Xia, X.; Deng, Y.; Teng, F.; Zhao, S.; Li, H.; Hao, D.; Chen, W.-Y. Identification and Functional Analysis of an Epsilon Class Glutathione S-Transferase Gene Associated with α-Pinene Adaptation in Monochamus alternatus. Int. J. Mol. Sci. 2023, 24, 17376. https://doi.org/10.3390/ijms242417376
Xue M, Xia X, Deng Y, Teng F, Zhao S, Li H, Hao D, Chen W-Y. Identification and Functional Analysis of an Epsilon Class Glutathione S-Transferase Gene Associated with α-Pinene Adaptation in Monochamus alternatus. International Journal of Molecular Sciences. 2023; 24(24):17376. https://doi.org/10.3390/ijms242417376
Chicago/Turabian StyleXue, Mingyu, Xiaohong Xia, Yadi Deng, Fei Teng, Shiyue Zhao, Hui Li, Dejun Hao, and Wei-Yi Chen. 2023. "Identification and Functional Analysis of an Epsilon Class Glutathione S-Transferase Gene Associated with α-Pinene Adaptation in Monochamus alternatus" International Journal of Molecular Sciences 24, no. 24: 17376. https://doi.org/10.3390/ijms242417376
APA StyleXue, M., Xia, X., Deng, Y., Teng, F., Zhao, S., Li, H., Hao, D., & Chen, W.-Y. (2023). Identification and Functional Analysis of an Epsilon Class Glutathione S-Transferase Gene Associated with α-Pinene Adaptation in Monochamus alternatus. International Journal of Molecular Sciences, 24(24), 17376. https://doi.org/10.3390/ijms242417376