Fine Mapping and Cloning of a qRA2 Affect the Ratooning Ability in Rice (Oryza sativa L.)
Abstract
1. Introduction
2. Results
2.1. Identification and Analysis of QTLs for Ratooning Ability in the NILs
2.2. Genetic Analysis of NIL128 for Ratooning Ability
2.3. Analysis of the Genetic Background of NIL128
2.4. Linkage Analysis of QTLs for Ratooning Ability in NIL128
2.5. Initial Localization of QTLs for Ratooning Ability
2.6. Fine Mapping of QTLs for Ratooning Ability
2.7. Candidate Genes in the 233-kb Region
2.8. Sequence Analyses of the QTL for Ratooning Ability
2.9. qra2 Is Responsible for the Ratooning Ability Phenotype of NIL128
2.10. Tissue Expression Analysis of qRA2
3. Discussion
3.1. qRA2, a New Gene Associated with Ratooning Ability
3.2. The Application Prospect of the qRA2 Gene in Rice Breeding
4. Materials and Methods
4.1. Plant Material
4.2. Investigation of Ratooning Ability
4.3. QTL Analysis of Ratooning Ability
4.4. Identification of QTLs for Ratooning Ability
4.5. Construction of the Mapping Population
4.6. Molecular Marker Amplification and Detection
4.7. Molecular Mapping of QTLs for Ratooning Ability
4.8. Physical Map Construction and Bioinformatics Analysis of QTLs for Ratooning Ability
4.9. Targeted Mutagenesis of qRA2 in Rice with CRISPR/Cas9
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Huang, M.; Zou, Y. Integrating mechanization with agronomy and breeding for food security in China. Field Crops Res. 2018, 224, 22–27. [Google Scholar] [CrossRef] [Scilit]
- Peng, S.; Tang, Q.; Zou, Y. Current status and challenges of rice production in China. Plant Prod. Sci. 2009, 12, 3–8. [Google Scholar] [CrossRef] [Scilit]
- Ray, D.K.; Foley, J.A. Increasing global crop harvest frequency: Recent trends and future directions. Environ. Res. Lett. 2013, 8, 044041. [Google Scholar] [CrossRef] [Scilit]
- Deng, N.; Grassini, P.; Yang, H.; Huang, J.; Cassman, K.G.; Peng, S. Closing yield gaps for rice self-sufficiency in China. Nat. Commun. 2019, 10, 1725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harrell, D.L.; Bond, J.A.; Blanche, S. Evaluation of main-crop stubble height on ratoon rice growth and development. Field Crops Res. 2009, 114, 396–403. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; He, A.; Jiang, G.; Sun, H.; Jiang, M.; Man, J.; Cui, K.; Nie, L. Ratoon rice technology: A green and resource-efficient way for rice production. Adv. Agron. 2020, 159, 135–167. [Google Scholar]
- Yuan, S.; Cassman, K.G.; Huang, J.; Peng, S.; Grassini, P. Can ratoon cropping improve resource use efficiencies and profitability of rice in central China? Field Crops Res. 2019, 234, 66–72. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.; Huang, J.; Peng, S. Research and development of mechanized rice ratooning technology in China. China Rice 2021, 27, 1–6. [Google Scholar]
- Yu, X.; Tao, X.; Liao, J.; Liu, S.; Xu, L.; Yuan, S.; Zhang, Z.; Wang, F.; Deng, N.; Huang, J.; et al. Predicting potential cultivation region and paddy area for ratoon rice production in China using Maxent model. Field Crops Res. 2022, 275, 108372. [Google Scholar] [CrossRef] [Scilit]
- Zheng, C.; Wang, Y.; Yuan, S.; Xiao, S.; Sun, Y.; Huang, J.; Peng, S. Heavy soil drying during mid-to-late grain filling stage of the main crop to reduce yield loss of the ratoon crop in a mechanized rice ratooning system. Crop J. 2022, 10, 280–285. [Google Scholar] [CrossRef] [Scilit]
- Tian, Z.; Shen, L.; Yuan, Z.; Lu, C.; Chen, Y.; Zhou, K.; Zhu, L. Identification of QTLs for ratooning ability and grain yield traits of rice and analysis of thair genetic effectes. Acta Agron. Sin. 1997, 23, 289–295. [Google Scholar]
- Ji, S.D.; Luo, X.; Ahn, S.N. Mapping QTL for ratooning ability in advanced backcross lines from an Oryza sativa O. rufipogon cross. Korean J. Agric. Sci. 2014, 41, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Zheng, J.; Li, Y.; Lin, W. Identification of QTLs for ratooning ability and grain yield traits in ratoon rice based on SSR marker. Mol. Plant Breed. 2004, 2, 342–347. [Google Scholar]
- Yang, C.; Wang, Y.; Tu, B.; Li, T.; Hu, L.; Li, S. QTL analysis of rice ratooning ability and related agronomic traits by using RIL populations. Acta Agron. Sin. 2012, 38, 1240–1246. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Jiang, K.; Zhang, T.; Zhao, J.; Guo, X.; Yang, Q.; Wan, X.; You, S.; Cao, Y.; Luo, J.; et al. QTL analysis of rice ratooning ability and grain yield traits in a RIL population of rice. Southwest China J. Agri. Sci. 2013, 26, 2179–2184. [Google Scholar]
- Hu, H.; Gao, R.; He, L.; Liang, F.; Li, Z.; Xu, J.; Yang, L.; Wang, C.; Liu, Z.; Xu, J.; et al. Genetic dissection of rice ratooning ability using an introgression line population and substitution mapping of a pleiotropic quantitative trait locus qRA5. Plants 2022, 11, 1134. [Google Scholar] [CrossRef] [Scilit]
- Martin, R.C.; Mok, M.C.; Mok, D.W. A gene encoding the cytokinin enzyme zeatin O-xylosyltransferase of Phaseolus vulgaris. Plant Physiol. 1999, 120, 553–557. [Google Scholar] [CrossRef] [Scilit]
- Li, P.; Lei, K.; Li, Y.; He, X.; Wang, S.; Liu, R.; Ji, L.; Hou, B. Identification and characterization of the first cytokinin glycosyltransferase from rice. Rice 2019, 12, 19. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Zhao, J.; Song, J.; Jameson, P.E. Cytokinin glucosyl transferases, key regulators of cytokinin homeostasis, have potential value for wheat improvement. Plant Biotechnol. J. 2021, 19, 878–896. [Google Scholar] [CrossRef] [Scilit]
- He, N.; Zhan, G.; Huang, F.; Abou-Elwafa, S.F.; Yang, D. Fine mapping and cloning of a major QTL qph12, which simultaneously affects the plant height, panicle length, spikelet number and yield in rice (Oryza sativa L.). Front. Plant Sci. 2022, 13, 878558. [Google Scholar] [CrossRef] [Scilit]
- Yang, D.; Ye, X.; Zheng, X.; Cheng, C.; Ye, N.; Huang, F. Development and evaluation of chromosome segment substitution lines carrying overlapping chromosome segments of the whole wild rice genome. Front. Plant Sci. 2016, 7, 01737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashikari, M.; Sakakibara, H.; Lin, S.; Yamamoto, T.; Takashi, T.; Nishimura, A.; Angeles, E.R.; Qian., Q.; Kitano., H.; Matsuoka., M. Cytokinin oxidase regulates rice grain production. Science 2005, 309, 741–745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, C.; Xing, Y.; Mao, H.; Lu, T.; Han, B.; Xu, C.; Li, X.; Zhang, Q. GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor. Appl. Genet. 2006, 112, 1164–1171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, X.; Huang, W.; Shi, M.; Zhu, M.; Lin, H. A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat. Genet. 2007, 39, 623–630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xue, W.; Xing, Y.; Weng, X.; Zhao, Y.; Tang, W.; Wang, L.; Zhou, H.; Yu, S.; Xu, C.; Li, X.; et al. Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice. Nat. Genet. 2008, 40, 761–767. [Google Scholar] [CrossRef] [Scilit]
- Furuta, T.; Uehara, K.; Rosalyn, B.; Angeles-Shim, R.B.; Shim, J.; Ashikari, M.; Takashi, T. Development and evaluation of chromosome segment substitution lines (CSSLs) carrying chromosome segments derived from Oryza rufipogon in the genetic background of Oryza sativa L. Breed. Sci. 2014, 63, 468–475. [Google Scholar] [CrossRef] [Scilit]
- Henry, A.; Swamy, B.P.M.; Dixit, S.; Torres, R.D.; Batoto, T.C.; Manalili, M.; Anantha, M.S.; Mandal, N.P.; Kumar, A. Physiological mechanisms contributing to the QTL-combination effects on improved performance of IR64 rice NILs under drought. J. Exp. Bot. 2015, 66, 1787–1799. [Google Scholar] [CrossRef] [Scilit]
- Yang, D.; Cheng, C.; Zheng, X.; Ye, X.; Ye, N.; Huang, F. Identification and fine mapping of a major QTL, qHD19, that plays pleiotropic roles in regulating the heading date in rice. Mol. Breed. 2020, 40, 234. [Google Scholar] [CrossRef] [Scilit]
- Shang, X.; Xie, R.; Tian, H.; Wang, Q.; Guo, F. Putative zeatin O-glucosyltransferase OscZOG1 regulates root and shoot development and formation of agronomic traits in rice. J. Integr. Plant Biol. 2016, 58, 627–641. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, H.N.; Perry, L.; Kisiala, A.; Olechowski, H.; Emery, R.J.N. Cytokinin activity during early kernel development corresponds positively with yield potential and later stage ABA accumulation in field-grown wheat (Triticum aestivum L.). Planta 2020, 252, 76. [Google Scholar] [CrossRef] [Scilit]
- Nelson, R.; Wiesner-Hanks, T.; Wisser, R.; Balint-Kurti., P. Navigating complexity to breed disease-resistant crops. Nat. Rev. Genet. 2018, 19, 21–33. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Zhou, L.; Shi, H.; Chern, M.; Yu, H.; Yi, H.; He, M.; Yin, J.; Zhu, X.; Li, Y.; et al. A single transcription factor promotes both yield and immunity in rice. Science 2018, 361, 1026–1028. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.; Wang, Y.; Tu, B.; Zeng, Y.; Li, S. QTL analysis of cold resistance and ratooning ability by using indica-japonica RIL populations in rice. Chin. J. Rice Sci. 2012, 26, 741–745. [Google Scholar]
- Wang, S.; Basten, C.J.; Gaffney, P.; Zeng, Z. Windows QTL Cartographer Version 2.5; North Carolina State University Bioinformatics Research Center: Raleigh, NC, USA, 2012. [Google Scholar]
- Zeng, Z. Theoretical basis for separation of multiple linked gene effects in mapping quantitative trait loci. PNAS 1993, 90, 10972–10976. [Google Scholar] [CrossRef] [Scilit]
- Murray, M.G.; Thompson, W.F. Rapid isolation of high molecular weight plant DNA. Nucleic. Acids Res. 1980, 8, 4321–4325. [Google Scholar] [CrossRef] [Scilit]
- Panaud, O.; Chen, X.; Mccouch, S.R. Development of microsatellite and characterization of simple sequence length polymorphism (SSLP) in rice (Oryza sativa L.). Mol. Gen. Genet. 1996, 252, 597–607. [Google Scholar] [CrossRef] [Scilit]
- Liu, R.H.; Meng, J.L. MapDraw: A microsoft excel macro for drawing genetic linkage maps based on given genetic linkage data. Hereditas 2003, 25, 317–321. [Google Scholar]
- Rahman, M.L.; Chu, S.; Choi, M.; Qiao, Y.; Jiang, W.; Piao, R.; Khanam, S.; Cho, Y.; Jeung, J.; Jena, K.; et al. Identification of QTLs for some agronomic traits in rice using an introgression line from Oryaza minuta. Mo. Cell. 2007, 24, 16–26. [Google Scholar]
- Xie, K.; Zhang, J.; Yang, Y. Genome-wide prediction of highly specific guide RNA spacers for CRISPR-Cas9-mediated genome editing in model plants and major crops. Mol. Plant 2014, 7, 923–926. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.; Chen, L.; Zhu, Q.; Chen, Y.; Liu, Y. Rapid decoding of sequence-specific nuclease-induced heterozygous and biallelic mutations by direct sequencing of PCR products. Mol. Plant 2015, 8, 1285–1287. [Google Scholar] [CrossRef] [Scilit]




| Traits | Jiafuzhan | Hui1586 | NIL128 | qRA2KO-Line1 | qRA2KO-Line2 |
|---|---|---|---|---|---|
| Plant height (cm) | 118.32 ± 3.21 | 86.46 ± 1.94 ** | 119.43 ± 3.32 | 118.36 ± 3.21 | 119.28 ± 3.42 |
| Panicle length (cm) | 28.12 ± 1.23 | 29.35 ± 1.16 * | 29.12 ± 1.31 | 27.82 ± 1.26 | 28.22 ± 1.41 |
| Number of effective panicle | 9.84 ± 1.04 | 10.06 ± 1.18 | 9.75 ± 1.02 | 10.01 ± 1.02 | 9.92 ± 1.09 |
| Spikelets per panicle | 163.26 ± 4.56 | 145.46 ± 3.88 * | 164.12 ± 4.21 | 163.41 ± 4.32 | 164.46 ± 4.16 |
| Seed setting rate (%) | 92.52 ± 1.16 | 93.74 ± 1.66 | 86.22 ± 1.19 * | 91.52 ± 1.26 | 93.12 ± 1.13 |
| 1000-grain weight (g) | 23.12 ± 0.56 | 26.12 ± 0.54 * | 23.22 ± 0.38 | 23.42 ± 0.61 | 23.36 ± 0.52 |
| Grain length (mm) | 10.84 ± 0.12 | 8.38 ± 0.22 * | 10.72 ± 0.14 | 10.88 ± 0.15 | 10.88 ± 0.14 |
| Grain width (mm) | 2.62 ± 0.07 | 3.74 ± 0.08 ** | 2.64 ± 0.06 | 2.62 ± 0.09 | 2.60 ± 0.08 |
| Yield per plant (g) | 34.36 ± 0.92 | 35.82 ± 1.01 * | 32.04 ± 0.98 * | 35.06 ± 1.02 | 35.49 ± 0.94 |
| Ratooning ability (%) | 137.5 ± 5.85 | 52.3 ± 4.92 ** | 49.2 ± 4.83 ** | 46.8 ± 5.22 ** | 47.2 ± 4.96 ** |
| Crosses | F1 Phenotype | F2 Population | χ2 (3:1) | p | ||
|---|---|---|---|---|---|---|
| The Phenotype of Jiafuzhan | The Phenotype of NIL128 | Total Plants | ||||
| NIL128/Jiafuzhan | The phenotype of Jiafuzhan | 988 | 325 | 1313 | 0.336 * | >0.9 |
| Marker | Sequence of Forward Primer | Sequence of Reverse Primer |
|---|---|---|
| RM7286 | CAGAACAATTCGACCGCTTC | GGCTTGAGAGCGTTTGTAGG |
| RM1386 | CTACTCCCTAGTTGGCAGCG | TCTCCTGCAGGTACGTGCC |
| RM3795 | CATTTGCATGGAGAGGATAG | TCATCTTCATTTCATTTCACC |
| Indle2-1 | GTCTTGGAATTAAATGCTGC | GACCAAGATAAATGACAGGC |
| Indle2-3 | TACAGGTTAAGAGGAGGCAA | CAGTTGCAGGATTTATCTGT |
| Indle2-7 | AAGATATATAAACGCGTCGG | ATTGTCCTAAACGTACTGCC |
| Indle2-11 | TCCATTGTCTTTCATCCTCT | GTGGTACCGATCAATTTCAG |
| Indle2-12 | TCTTTTGACAATTTCCCATT | CGCAATGACCTTATCTGATT |
| Indle2-15 | AGACGATGCGTAGACAAGAT | TGTATCGTCGTCTTTTGTTG |
| Indle2-17 | TGAGACTAAGCGAAGGTAGG | CTCAAGCTTACAATTGACCC |
| Indle2-20 | TTTCTCCTGAATGAATTGCT | CCATCCTTTCTTCTGGTACA |
| Indle2-24 | TCACTACACAAACATACAAC | GCATGTCAACTAAATGGGTT |
| Indle2-28 | TATTCGGCCTCTATATCCAA | CTTTCTCTAATAAAAAGATA |
| Indle2-33 | CTTCTTCGACGACCTGGG | CAATTTCCAAGCTCTCTCC |
| Indle2-35 | AGATATCGCAAGTTAGGCTG | TAGGGCAAAAGTTAAAACGA |
| Indle2-38 | TTCGATCCTTTTTAATCACC | CACATGTTGTGTTGTAGATG |
| Indle2-40 | TTTGAAGCTATATGCGTCTG | ATGTGTGCCATGATTTACAA |
| Line | Target Type | Mutation Site |
|---|---|---|
| qRA2KO-line1 | gRNAs | GGCAAGGCAGGTCTCCTTGGGGAGCGGCACAGCGAC (Insert 2 bp) |
| qRA2KO-line2 | gRNAs | GGCAAGGCAGGTCTCCTTGG----GCGGCACAGCGACGG (Deletion 1 bp) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, N.; Huang, F.; Yang, D. Fine Mapping and Cloning of a qRA2 Affect the Ratooning Ability in Rice (Oryza sativa L.). Int. J. Mol. Sci. 2023, 24, 967. https://doi.org/10.3390/ijms24020967
He N, Huang F, Yang D. Fine Mapping and Cloning of a qRA2 Affect the Ratooning Ability in Rice (Oryza sativa L.). International Journal of Molecular Sciences. 2023; 24(2):967. https://doi.org/10.3390/ijms24020967
Chicago/Turabian StyleHe, Niqing, Fenghuang Huang, and Dewei Yang. 2023. "Fine Mapping and Cloning of a qRA2 Affect the Ratooning Ability in Rice (Oryza sativa L.)" International Journal of Molecular Sciences 24, no. 2: 967. https://doi.org/10.3390/ijms24020967
APA StyleHe, N., Huang, F., & Yang, D. (2023). Fine Mapping and Cloning of a qRA2 Affect the Ratooning Ability in Rice (Oryza sativa L.). International Journal of Molecular Sciences, 24(2), 967. https://doi.org/10.3390/ijms24020967
