CRISPR/Cas9-Mediated Enrichment Coupled to Nanopore Sequencing Provides a Valuable Tool for the Precise Reconstruction of Large Genomic Target Regions
Abstract
:1. Introduction
2. Results
2.1. Reconstruction of the Pod-Shattering Region by CRISPR/Cas9 Tiling and ONT Sequencing
2.2. Validation of the De Novo Assembly Generated by Cas9 Tiling Using a Traditional WGS Approach
3. Discussion
4. Materials and Methods
4.1. Extraction of HMW DNA
4.2. Illumina Sequencing and Data Analysis
4.3. Cas9 Tiling Coupled to ONT Sequencing
4.4. Nanopore WGS
4.5. ONT Sequence Analysis and De Novo Assembly
4.6. Comparison of Cas9-Tiling Assembly with P. vulgaris Reference Genome and WGS Assembly
4.7. Genome Annotation
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Maestri, S.; Gambino, G.; Lopatriello, G.; Minio, A.; Perrone, I.; Cosentino, E.; Giovannone, B.; Marcolungo, L.; Alfano, M.; Rombauts, S.; et al. ‘Nebbiolo’ Genome Assembly Allows Surveying the Occurrence and Functional Implications of Genomic Structural Variations in Grapevines (Vitis vinifera L.). BMC Genom. 2022, 23, 159. [Google Scholar] [CrossRef] [PubMed]
- Aganezov, S.; Yan, S.M.; Soto, D.C.; Kirsche, M.; Zarate, S.; Avdeyev, P.; Taylor, D.J.; Shafin, K.; Shumate, A.; Xiao, C.; et al. A Complete Reference Genome Improves Analysis of Human Genetic Variation. Science 2022, 376, eabl3533. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Minio, A.; Massonnet, M.; Solares, E.; Lv, Y.; Beridze, T.; Cantu, D.; Gaut, B.S. The Population Genetics of Structural Variants in Grapevine Domestication. Nat. Plants 2019, 5, 965–979. [Google Scholar] [CrossRef] [PubMed]
- Jaillon, O.; Aury, J.-M.; Noel, B.; Policriti, A.; Clepet, C.; Casagrande, A.; Choisne, N.; Aubourg, S.; Vitulo, N.; Jubin, C.; et al. The Grapevine Genome Sequence Suggests Ancestral Hexaploidization in Major Angiosperm Phyla. Nature 2007, 449, 463–467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valiente-Mullor, C.; Beamud, B.; Ansari, I.; Francés-Cuesta, C.; García-González, N.; Mejía, L.; Ruiz-Hueso, P.; González-Candelas, F. One Is Not Enough: On the Effects of Reference Genome for the Mapping and Subsequent Analyses of Short-Reads. PLoS Comput. Biol. 2021, 17, e1008678. [Google Scholar] [CrossRef]
- Alonge, M.; Wang, X.; Benoit, M.; Soyk, S.; Pereira, L.; Zhang, L.; Suresh, H.; Ramakrishnan, S.; Maumus, F.; Ciren, D.; et al. Major Impacts of Widespread Structural Variation on Gene Expression and Crop Improvement in Tomato. Cell 2020, 182, 145–161.e23. [Google Scholar] [CrossRef]
- Gao, L.; Gonda, I.; Sun, H.; Ma, Q.; Bao, K.; Tieman, D.M.; Burzynski-Chang, E.A.; Fish, T.L.; Stromberg, K.A.; Sacks, G.L.; et al. The Tomato Pan-Genome Uncovers New Genes and a Rare Allele Regulating Fruit Flavor. Nat. Genet. 2019, 51, 1044–1051. [Google Scholar] [CrossRef]
- Bayer, P.E.; Golicz, A.A.; Scheben, A.; Batley, J.; Edwards, D. Plant Pan-Genomes Are the New Reference. Nat. Plants 2020, 6, 914–920. [Google Scholar] [CrossRef]
- Golicz, A.A.; Bayer, P.E.; Barker, G.C.; Edger, P.P.; Kim, H.; Martinez, P.A.; Chan, C.K.K.; Severn-Ellis, A.; McCombie, W.R.; Parkin, I.A.P.; et al. The Pangenome of an Agronomically Important Crop Plant Brassica Oleracea. Nat. Commun. 2016, 7, 13390. [Google Scholar] [CrossRef] [Green Version]
- Zhang, F.; Xue, H.; Dong, X.; Li, M.; Zheng, X.; Li, Z.; Xu, J.; Wang, W.; Wei, C. Long-Read Sequencing of 111 Rice Genomes Reveals Significantly Larger Pan-Genomes. Genome Res. 2022, 32, 853–863. [Google Scholar] [CrossRef]
- Hübner, S.; Bercovich, N.; Todesco, M.; Mandel, J.R.; Odenheimer, J.; Ziegler, E.; Lee, J.S.; Baute, G.J.; Owens, G.L.; Grassa, C.J.; et al. Sunflower Pan-Genome Analysis Shows That Hybridization Altered Gene Content and Disease Resistance. Nat. Plants 2019, 5, 54–62. [Google Scholar] [CrossRef]
- Pinosio, S.; Giacomello, S.; Faivre-Rampant, P.; Taylor, G.; Jorge, V.; Le Paslier, M.C.; Zaina, G.; Bastien, C.; Cattonaro, F.; Marroni, F.; et al. Characterization of the Poplar Pan-Genome by Genome-Wide Identification of Structural Variation. Mol. Biol. Evol. 2016, 33, 2706–2719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dapprich, J.; Ferriola, D.; Mackiewicz, K.; Clark, P.M.; Rappaport, E.; D’Arcy, M.; Sasson, A.; Gai, X.; Schug, J.; Kaestner, K.H.; et al. The next Generation of Target Capture Technologies—Large DNA Fragment Enrichment and Sequencing Determines Regional Genomic Variation of High Complexity. BMC Genom. 2016, 17, 486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bethune, K.; Mariac, C.; Couderc, M.; Scarcelli, N.; Santoni, S.; Ardisson, M.; Martin, J.; Montúfar, R.; Klein, V.; Sabot, F.; et al. Long-fragment Targeted Capture for Long-read Sequencing of Plastomes. Appl. Plant Sci. 2019, 7, e1243. [Google Scholar] [CrossRef] [PubMed]
- Leung, A.W.-S.; Leung, H.C.-M.; Wong, C.-L.; Zheng, Z.-X.; Lui, W.-W.; Luk, H.-M.; Lo, I.F.-M.; Luo, R.; Lam, T.-W. ECNano: A Cost-Effective Workflow for Target Enrichment Sequencing and Accurate Variant Calling on 4800 Clinically Significant Genes Using a Single MinION Flowcell. BMC Med. Genom. 2022, 15, 43. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Liu, J.; Zhang, H.; Liu, Z.; Wang, Y.; Xing, L.; He, Q.; Du, H. Plant Pan-Genomics: Recent Advances, New Challenges, and Roads Ahead. J. Genet. Genom. 2022, 49, 833–846. [Google Scholar] [CrossRef] [PubMed]
- Maestri, S.; Maturo, M.G.; Cosentino, E.; Marcolungo, L.; Iadarola, B.; Fortunati, E.; Rossato, M.; Delledonne, M. A Long-Read Sequencing Approach for Direct Haplotype Phasing in Clinical Settings. Int. J. Mol. Sci. 2020, 21, 9177. [Google Scholar] [CrossRef]
- De Cario, R.; Kura, A.; Suraci, S.; Magi, A.; Volta, A.; Marcucci, R.; Gori, A.M.; Pepe, G.; Giusti, B.; Sticchi, E. Sanger Validation of High-Throughput Sequencing in Genetic Diagnosis: Still the Best Practice? Front. Genet. 2020, 11, 592588. [Google Scholar] [CrossRef]
- Alfano, M.; De Antoni, L.; Centofanti, F.; Visconti, V.V.; Maestri, S.; Degli Esposti, C.; Massa, R.; D’Apice, M.R.; Novelli, G.; Delledonne, M.; et al. Characterization of Full-Length CNBP Expanded Alleles in Myotonic Dystrophy Type 2 Patients by Cas9-Mediated Enrichment and Nanopore Sequencing. eLife 2022, 11, e80229. [Google Scholar] [CrossRef]
- Gilpatrick, T.; Lee, I.; Graham, J.E.; Raimondeau, E.; Bowen, R.; Heron, A.; Downs, B.; Sukumar, S.; Sedlazeck, F.J.; Timp, W. Targeted Nanopore Sequencing with Cas9-Guided Adapter Ligation. Nat. Biotechnol. 2020, 38, 433–438. [Google Scholar] [CrossRef]
- Mizuguchi, T.; Toyota, T.; Miyatake, S.; Mitsuhashi, S.; Doi, H.; Kudo, Y.; Kishida, H.; Hayashi, N.; Tsuburaya, R.S.; Kinoshita, M.; et al. Complete Sequencing of Expanded SAMD12 Repeats by Long-Read Sequencing and Cas9-Mediated Enrichment. Brain 2021, 144, 1103–1117. [Google Scholar] [CrossRef] [PubMed]
- Fiol, A.; Jurado-Ruiz, F.; López-Girona, E.; Aranzana, M.J. An Efficient CRISPR-Cas9 Enrichment Sequencing Strategy for Characterizing Complex and Highly Duplicated Genomic Regions. A Case Study in the Prunus Salicina LG3-MYB10 Genes Cluster. Plant Methods 2022, 18, 105. [Google Scholar] [CrossRef] [PubMed]
- López-Girona, E.; Davy, M.W.; Albert, N.W.; Hilario, E.; Smart, M.E.M.; Kirk, C.; Thomson, S.J.; Chagné, D. CRISPR-Cas9 Enrichment and Long Read Sequencing for Fine Mapping in Plants. Plant Methods 2020, 16, 121. [Google Scholar] [CrossRef] [PubMed]
- Iyer, S.V.; Kramer, M.; Goodwin, S.; McCombie, W.R. ACME: An Affinity-Based Cas9 Mediated Enrichment Method for Targeted Nanopore Sequencing. BioRxiv 2022. [Google Scholar] [CrossRef]
- Bruijnesteijn, J.; van der Wiel, M.; de Groot, N.G.; Bontrop, R.E. Rapid Characterization of Complex Killer Cell Immunoglobulin-Like Receptor (KIR) Regions Using Cas9 Enrichment and Nanopore Sequencing. Front. Immunol. 2021, 12, 722181. [Google Scholar] [CrossRef] [PubMed]
- Rubben, K.; Tilleman, L.; Deserranno, K.; Tytgat, O.; Deforce, D.; Van Nieuwerburgh, F. Cas9 Targeted Nanopore Sequencing with Enhanced Variant Calling Improves CYP2D6-CYP2D7 Hybrid Allele Genotyping. PLoS Genet. 2022, 18, e1010176. [Google Scholar] [CrossRef]
- Bellucci, E.; Mario Aguilar, O.; Alseekh, S.; Bett, K.; Brezeanu, C.; Cook, D.; De la Rosa, L.; Delledonne, M.; Dostatny, D.F.; Ferreira, J.J.; et al. The INCREASE Project: Intelligent Collections of Food-Legume Genetic Resources for European Agrofood Systems. Plant J. 2021, 108, 646–660. [Google Scholar] [CrossRef]
- Di Vittori, V.; Bitocchi, E.; Rodriguez, M.; Alseekh, S.; Bellucci, E.; Nanni, L.; Gioia, T.; Marzario, S.; Logozzo, G.; Rossato, M.; et al. Pod Indehiscence in Common Bean Is Associated with the Fine Regulation of PvMYB26. J. Exp. Bot. 2021, 72, 1617–1633. [Google Scholar] [CrossRef]
- Rau, D.; Murgia, M.L.; Rodriguez, M.; Bitocchi, E.; Bellucci, E.; Fois, D.; Albani, D.; Nanni, L.; Gioia, T.; Santo, D.; et al. Genomic Dissection of Pod Shattering in Common Bean: Mutations at Non-Orthologous Loci at the Basis of Convergent Phenotypic Evolution under Domestication of Leguminous Species. Plant J. 2019, 97, 693–714. [Google Scholar] [CrossRef]
- Murgia, M.L.; Attene, G.; Rodriguez, M.; Bitocchi, E.; Bellucci, E.; Fois, D.; Nanni, L.; Gioia, T.; Albani, D.M.; Papa, R.; et al. A Comprehensive Phenotypic Investigation of the “Pod-Shattering Syndrome” in Common Bean. Front. Plant Sci. 2017, 8, 251. [Google Scholar] [CrossRef]
- Di Vittori, V.; Gioia, T.; Rodriguez, M.; Bellucci, E.; Bitocchi, E.; Nanni, L.; Attene, G.; Rau, D.; Papa, R. Convergent Evolution of the Seed Shattering Trait. Genes 2019, 10, 68. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wallace, A.D.; Sasani, T.A.; Swanier, J.; Gates, B.L.; Greenland, J.; Pedersen, B.S.; Varley, K.E.; Quinlan, A.R. CaBagE: A Cas9-Based Background Elimination Strategy for Targeted, Long-Read DNA Sequencing. PLoS ONE 2021, 16, e0241253. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhao, Y.; Bollas, A.; Wang, Y.; Au, K.F. Nanopore Sequencing Technology, Bioinformatics and Applications. Nat. Biotechnol. 2021, 39, 1348–1365. [Google Scholar] [CrossRef] [PubMed]
- Pucker, B.; Irisarri, I.; de Vries, J.; Xu, B. Plant Genome Sequence Assembly in the Era of Long Reads: Progress, Challenges and Future Directions. Quant. Plant Biol. 2022, 3, e5. [Google Scholar] [CrossRef]
- Vaillancourt, B.; Buell, C.R. High Molecular Weight DNA Isolation Method from Diverse Plant Species for Use with Oxford Nanopore Sequencing. BioRxiv 2019, 783159. [Google Scholar] [CrossRef]
- Rezadoost, M.H.; Kordrostami, M.; Kumleh, H.H. An Efficient Protocol for Isolation of Inhibitor-Free Nucleic Acids Even from Recalcitrant Plants. 3 Biotech 2016, 6, 61. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Durbin, R. Fast and Accurate Short Read Alignment with Burrows–Wheeler Transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [Green Version]
- Picard Tools—By Broad Institute. Available online: http://broadinstitute.github.io/picard/ (accessed on 27 October 2022).
- ClipBam. Available online: http://fulcrumgenomics.github.io/fgbio/tools/latest/ClipBam.html (accessed on 27 October 2022).
- McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.; Cibulskis, K.; Kernytsky, A.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.; et al. The Genome Analysis Toolkit: A MapReduce Framework for Analyzing next-Generation DNA Sequencing Data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef] [Green Version]
- CRISPR-Cas9 Guide RNA Design Checker|IDT. Available online: https://eu.idtdna.com/site/order/designtool/index/CRISPR_SEQUENCE (accessed on 9 October 2022).
- De Coster, W.; D’Hert, S.; Schultz, D.T.; Cruts, M.; Van Broeckhoven, C. NanoPack: Visualizing and Processing Long-Read Sequencing Data. Bioinformatics 2018, 34, 2666–2669. [Google Scholar] [CrossRef] [Green Version]
- Koren, S.; Walenz, B.P.; Berlin, K.; Miller, J.R.; Bergman, N.H.; Phillippy, A.M. Canu: Scalable and Accurate Long-Read Assembly via Adaptive k-Mer Weighting and Repeat Separation. Genome Res. 2017, 27, 722–736. [Google Scholar] [CrossRef]
- Ruan, J.; Li, H. Fast and Accurate Long-Read Assembly with Wtdbg2. Nat. Methods 2020, 17, 155–158. [Google Scholar] [CrossRef] [PubMed]
- Li, H. Minimap2: Pairwise Alignment for Nucleotide Sequences. Bioinformatics 2018, 34, 3094–3100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vaser, R.; Sović, I.; Nagarajan, N.; Šikić, M. Fast and Accurate de Novo Genome Assembly from Long Uncorrected Reads. Genome Res. 2017, 27, 737–746. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Medaka 2022. Available online: https://github.com/nanoporetech/medaka (accessed on 10 August 2022).
- Walker, B.J.; Abeel, T.; Shea, T.; Priest, M.; Abouelliel, A.; Sakthikumar, S.; Cuomo, C.A.; Zeng, Q.; Wortman, J.; Young, S.K.; et al. Pilon: An Integrated Tool for Comprehensive Microbial Variant Detection and Genome Assembly Improvement. PLoS ONE 2014, 9, e112963. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. 1000 Genome Project Data Processing Subgroup The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Green Version]
- Nattestad, M.; Schatz, M.C. Assemblytics: A Web Analytics Tool for the Detection of Variants from an Assembly. Bioinforma. Oxf. Engl. 2016, 32, 3021–3023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marçais, G.; Delcher, A.L.; Phillippy, A.M.; Coston, R.; Salzberg, S.L.; Zimin, A. MUMmer4: A Fast and Versatile Genome Alignment System. PLOS Comput. Biol. 2018, 14, e1005944. [Google Scholar] [CrossRef] [Green Version]
- Khelik, K.; Lagesen, K.; Sandve, G.K.; Rognes, T.; Nederbragt, A.J. NucDiff: In-Depth Characterization and Annotation of Differences between Two Sets of DNA Sequences. BMC Bioinform. 2017, 18, 338. [Google Scholar] [CrossRef] [Green Version]
- Nattestad, M. Dot 2022. Available online: https://github.com/MariaNattestad/dot (accessed on 10 August 2022).
- Tarailo-Graovac, M.; Chen, N. Using RepeatMasker to Identify Repetitive Elements in Genomic Sequences. Curr. Protoc. Bioinforma. 2009, 25, 4.10.1–4.10.14. [Google Scholar] [CrossRef]
- Flynn, J.M.; Hubley, R.; Goubert, C.; Rosen, J.; Clark, A.G.; Feschotte, C.; Smit, A.F. RepeatModeler2 for Automated Genomic Discovery of Transposable Element Families. Proc. Natl. Acad. Sci. USA 2020, 117, 9451–9457. [Google Scholar] [CrossRef]
- Stanke, M.; Keller, O.; Gunduz, I.; Hayes, A.; Waack, S.; Morgenstern, B. AUGUSTUS: Ab Initio Prediction of Alternative Transcripts. Nucleic Acids Res. 2006, 34, W435–W439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gremme, G.; Brendel, V.; Sparks, M.E.; Kurtz, S. Engineering a Software Tool for Gene Structure Prediction in Higher Organisms. Inf. Softw. Technol. 2005, 47, 965–978. [Google Scholar] [CrossRef]
- Bellucci, E.; Bitocchi, E.; Ferrarini, A.; Benazzo, A.; Biagetti, E.; Klie, S.; Minio, A.; Rau, D.; Rodriguez, M.; Panziera, A.; et al. Decreased Nucleotide and Expression Diversity and Modified Coexpression Patterns Characterize Domestication in the Common Bean. Plant Cell 2014, 26, 1901–1912. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-Based Genome Alignment and Genotyping with HISAT2 and HISAT-Genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef] [PubMed]
- Simão, F.A.; Waterhouse, R.M.; Ioannidis, P.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO: Assessing Genome Assembly and Annotation Completeness with Single-Copy Orthologs. Bioinformatics 2015, 31, 3210–3212. [Google Scholar] [CrossRef] [PubMed]
ID | Sequence crRNA | PAM | Chr | [Start] | [End] | SubROI | SubROI Length (kbp) |
---|---|---|---|---|---|---|---|
gRNA.1 | CTCAAGGGTCGTAACATTCC | TGG | 5 | 38,489,481 | 38,489,500 | SubROI1_P1 | 54.4 |
gRNA.2 | TATGATGACACACACGTTAA | CGG | 5 | 38,540,913 | 38,540,894 | ||
gRNA.3 | ATGCCATTAAGAGTTGCGAT | GGG | 5 | 38,537,240 | 38,537,259 | SubROI2_P2 | 45 |
gRNA.4 | TTTTCACGACTTTGCATCTT | TGG | 5 | 38,582,350 | 38,582,331 | ||
gRNA.5 | AGAACGGAAGGAATGGGACA | GGG | 5 | 38,580,180 | 38,580,199 | SubROI3_P1 | 48.6 |
gRNA.6 | GGATATTACAAACAGACGAA | AGG | 5 | 38,628,876 | 38,628,857 | ||
gRNA.7 | ACTGTTGCGTAGGGACAAAT | CGG | 5 | 38,626,429 | 38,626,448 | SubROI4_P2 | 48.3 |
gRNA.8 | AGTTTGACAACTATCCCAAG | GGG | 5 | 38,674,838 | 38,674,819 | ||
gRNA.9 | GCCACTATAGTGCCAACTTC | TGG | 5 | 38,671,239 | 38,671,258 | SubROI5_P1 | 52.5 |
gRNA.10 | ATTACCGTAGCTAGTTATTA | AGG | 5 | 38,723,776 | 38,723,757 |
Cas9 Tiling | WGS | |
---|---|---|
Sequencing output (Gbp) | 0.84 | 32.00 |
Total reads | 157,028 | 1,246,133 |
Total aligned PASS reads | 54,540 | 992,031 |
PASS read N50 (bp) | 30,121 | 43,366 |
On-target PASS reads on ROI | 1794 | 375 |
On-target reads % | 3.29% | 0.04% |
On-target reads fully spanning sub-ROIs | 143 | 13 |
On-target average coverage | 152.85× | 67.32× |
Whole genome average coverage | 1.21× | 43.63× |
Fold enrichment | 113.16× | 1.36× |
Cas9 Tiling | WGS | |
---|---|---|
Total assembly length (bp) | 229,302 | 509,180,482 |
Number of contigs | 1 | 1913 |
Contig N50 (bp) | 229,302 | 3,412,857 |
Contig average length (bp) | 229,302 | 266,169 |
Contig including ROI (bp) | 229,302 | 3,708,722 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lopatriello, G.; Maestri, S.; Alfano, M.; Papa, R.; Di Vittori, V.; De Antoni, L.; Bellucci, E.; Pieri, A.; Bitocchi, E.; Delledonne, M.; et al. CRISPR/Cas9-Mediated Enrichment Coupled to Nanopore Sequencing Provides a Valuable Tool for the Precise Reconstruction of Large Genomic Target Regions. Int. J. Mol. Sci. 2023, 24, 1076. https://doi.org/10.3390/ijms24021076
Lopatriello G, Maestri S, Alfano M, Papa R, Di Vittori V, De Antoni L, Bellucci E, Pieri A, Bitocchi E, Delledonne M, et al. CRISPR/Cas9-Mediated Enrichment Coupled to Nanopore Sequencing Provides a Valuable Tool for the Precise Reconstruction of Large Genomic Target Regions. International Journal of Molecular Sciences. 2023; 24(2):1076. https://doi.org/10.3390/ijms24021076
Chicago/Turabian StyleLopatriello, Giulia, Simone Maestri, Massimiliano Alfano, Roberto Papa, Valerio Di Vittori, Luca De Antoni, Elisa Bellucci, Alice Pieri, Elena Bitocchi, Massimo Delledonne, and et al. 2023. "CRISPR/Cas9-Mediated Enrichment Coupled to Nanopore Sequencing Provides a Valuable Tool for the Precise Reconstruction of Large Genomic Target Regions" International Journal of Molecular Sciences 24, no. 2: 1076. https://doi.org/10.3390/ijms24021076
APA StyleLopatriello, G., Maestri, S., Alfano, M., Papa, R., Di Vittori, V., De Antoni, L., Bellucci, E., Pieri, A., Bitocchi, E., Delledonne, M., & Rossato, M. (2023). CRISPR/Cas9-Mediated Enrichment Coupled to Nanopore Sequencing Provides a Valuable Tool for the Precise Reconstruction of Large Genomic Target Regions. International Journal of Molecular Sciences, 24(2), 1076. https://doi.org/10.3390/ijms24021076