Next Article in Journal
The Temporal and Geographical Dynamics of Potato Virus Y Diversity in Russia
Previous Article in Journal
Pharmacokinetic Model-Based Control across the Blood–Brain Barrier for Circadian Entrainment
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Elevated E200K Somatic Mutation of the Prion Protein Gene (PRNP) in the Brain Tissues of Patients with Sporadic Creutzfeldt–Jakob Disease (CJD)

by
Sae-Young Won
1,2,†,
Yong-Chan Kim
3,† and
Byung-Hoon Jeong
1,2,*
1
Korea Zoonosis Research Institute, Jeonbuk National University, 820-120, Hana-ro, Iksan 54531, Republic of Korea
2
Department of Bioactive Material Sciences, Institute for Molecular Biology and Genetics, Jeonbuk National University, Jeonju 54896, Republic of Korea
3
Department of Biological Sciences, Andong National University, Andong 36729, Republic of Korea
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(19), 14831; https://doi.org/10.3390/ijms241914831
Submission received: 8 September 2023 / Revised: 26 September 2023 / Accepted: 29 September 2023 / Published: 2 October 2023
(This article belongs to the Section Molecular Biology)

Abstract

Sporadic Creutzfeldt–Jakob disease (CJD) is a major human prion disease worldwide. CJD is a fatal neurodegenerative disease caused by an abnormal prion protein (PrPSc). To date, the exact etiology of sporadic CJD has not been fully elucidated. We investigated the E200K and V203I somatic mutations of the prion protein gene (PRNP) in sporadic CJD patients and matched healthy controls using pyrosequencing. In addition, we estimated the impact of somatic mutations on the human prion protein (PrP) using PolyPhen-2, PANTHER and PROVEAN. Furthermore, we evaluated the 3D structure and electrostatic potential of the human PrP according to somatic mutations using DeepView. The rates of PRNP K200 somatic mutation were significantly increased in the frontal cortex and hippocampus of sporadic CJD patients compared to the matched controls. In addition, the electrostatic potential of the human PrP was significantly changed by the K200 somatic mutation of the PRNP gene. To the best of our knowledge, this is the first report on an association of the PRNP K200 somatic mutation with sporadic CJD.

1. Introduction

Prion diseases are rapidly progressive and fatal neurodegenerative disorders caused by the conversion of a normal prion protein (PrPC) to an abnormal prion protein (PrPSc) [1,2,3,4,5,6,7]. In humans, the representative form of prion disease is Creutzfeldt–Jakob disease (CJD), which is divided into four subtypes: iatrogenic, genetic, variant and sporadic CJD [8,9,10,11]. Of these four CJDs, the causes of iatrogenic, variant and genetic CJD have been identified. Variant CJD is caused by the consumption of PrPSc-contaminated bovine meat. In addition, iatrogenic CJD is transmitted by blood transfusions and the cross-contamination of surgical instruments, accounting for less than 1% of all cases [12,13]. Genetic CJD is caused by pathogenic germline mutations in the prion protein gene (PRNP) [14]. Sporadic CJD accounts for approximately 85% of all human prion diseases and occurs worldwide in 1–2 cases per million people per year [15]. However, the exact etiology of the most frequently observed form of CJD, sporadic CJD, has not been fully elucidated thus far. Therefore, investigation of the cause of sporadic CJD is needed.
Recent studies have reported that somatic mutations in the brain cause the onset of several neurodegenerative diseases, including Alzheimer’s disease, Parkinson’s disease and CJD [16,17,18,19,20]. In Alzheimer’s disease, somatic mutations in the presenilin-1 (PSEN1) gene have been reported in peripheral lymphocytes (8%) and in the cerebral cortex (14%) derived from a patient with Alzheimer’s disease [21]. Another study reported nine somatic mutations in the amyloid beta precursor protein (APP), sortilin-related receptor 1 (SORL1), nicastrin (NCSTN) and microtubule affinity-regulating kinase 4 (MARK4) genes in patients with Alzheimer’s disease by next-generation sequencing (NGS) [22]. In Parkinson’s disease, an average of three somatic mutations of the genes related to synaptic functions have been found in the brain derived from patients with Parkinson’s disease by whole exome sequencing (WES) [19]. In a sporadic CJD patient, a somatic mutation of the PRNP gene was detected in peripheral blood cells and brain tissue using Sanger sequencing [18]. However, since somatic mutations can be observed even in the human brain with normal aging, there remains a question of whether the detected somatic mutations have a significant value.
In this study, we collected hippocampal and frontal cortex brain samples from sporadic CJD patients and age- and sex-matched controls. In addition, we purified genomic DNA from brain samples and performed pyrosequencing to identify the E200K and V203I somatic mutations in the human PRNP gene, which are frequently reported mutations in familial CJD patients. Furthermore, we estimated the impact of E200K and V203I somatic mutations on the human prion protein (PrP) in silico using the programs PolyPhen-2, PANTHER and PROVEAN [23,24,25].

2. Results

2.1. Investigation of Somatic Mutations of the Human PRNP Gene by Pyrosequencing

To detect somatic mutations of E200K and V203I in the PRNP gene in human brain samples, pyrosequencing analysis was performed. Detailed information on the detection primers for pyrosequencing is presented in Figure 1A.
The pyrosequencing primers targeting K200 and I203 of the human PRNP gene were designed using the PyroMark Assay Design program (QIAGEN, Hilden, Germany). Biotinylated PCR products were amplified by PCR and the length was confirmed on a gel (161 bp) (Figure 1B). DNA peaks at codons 200 and 203 of the PRNP gene were successfully detected by pyrosequencing (Figure 1C). In addition, we performed a pyrosequencing analysis in the hippocampus and frontal cortex derived from six sporadic CJD patients and six matched controls. Importantly, the rates of PRNP K200 somatic mutation in the hippocampus and frontal cortex of the sporadic CJD patients were higher than those of the matched controls. (p < 0.05). However, the rates of PRNP I203 somatic mutation were not significantly different in the hippocampus and frontal cortex between the sporadic CJD patients and the controls (Figure 2).

2.2. Evaluation of the Effect of Somatic Mutations on the Human PrP Using in Silico Analysis

To evaluate the impact of E200K and V203I mutations on human PrP, we utilized PolyPhen-2, PANTHER and PROVEAN. The E200K and V203I mutations by PolyPhen-2 were predicted to be ‘Probably damaging’ with a score of 0.987 and to be ‘Possibly damaging’ with a score of 0.882, respectively. The E200K and V203I mutations by PANTHER were estimated to be ‘Possibly damaging’ with a score of 361 and to be ‘Probably benign’ with a score of 176, respectively. The E200K and V203I mutations by PROVEAN were evaluated to be ‘Neutral’ with a score of −1.478 and to be ‘Neutral’ with a score of −0.004, respectively (Table 1).

2.3. Evaluation of the Effect of Somatic Mutations on the Electrostatic Potential of the PrP

We evaluated the electrostatic potential and 3D structure analyses of the human PrP according to the somatic mutations of the PRNP gene (Figure 3). In a human PrP with the K200 allele, an increase in the positive charge and a decrease in the negative charge were observed adjacent to codon 200 compared to a wild-type human PrP (Figure 3A,B). However, we did not find significant changes in the electrostatic potential and 3D structure of the human PrP based on the I203 mutation (Figure 3).

3. Discussion

To date, the mechanism responsible for the conversion of a PrPC into a PrPSc in sporadic CJD has not been identified. Previous studies have reported that aging increases somatic mutations in neurons, and the accumulated mutations of the disease-associated genes encoding DNA repair cause several neurodegenerative diseases [26]. Although several studies have investigated somatic mutations of the PRNP gene in sporadic CJD patients, studies using age-matched controls have not been reported thus far. Since somatic mutations occur even in the normal aging process, a comparison is necessary to determine whether the somatic mutation rates observed in sporadic CJD are unusually high.
In the present study, higher K200 somatic mutations of the PRNP gene were observed in sporadic CJD patients than in age- and sex-matched controls (Figure 2). We also found that the K200 mutation of the PRNP gene significantly changed the electrostatic potential of the human PrP (Figure 3). Recent studies have reported that the K200 mutation of the PRNP gene has shown high penetrance and was confirmed as a causal factor of prion diseases using a transgenic mouse model. Since the causal relationship of K200 somatic mutation has been demonstrated in previous studies, the elevation of K200 somatic mutation rates found in this study may be an important factor in the occurrence of sporadic CJD. However, this investigation was carried out with a relatively small sample size. In addition, E200K is known to be highly prevalent in certain European countries, accounting for the majority of prion disease cases [14], and there is a possibility of misdiagnosed familial CJD in the samples with elevated E200K in the present study. Thus, further validation in a larger sample size is an important future step.
In the current study, we investigated only two somatic mutations of the PRNP gene. However, previous studies have reported that over 40 germline mutations were related to several genetic prion diseases, including CJD, Gerstmann–Sträussler–Scheinker syndrome (GSS) and fatal familial insomnia (FFI) [8,14,27,28]. Thus, further investigation of other somatic mutations in the PRNP gene is needed to confirm whether the elevated K200 somatic mutations of the PRNP gene are the only functionally relevant mutation of sporadic CJD.
We did not find any differences in the I203 somatic mutation rates of the PRNP gene between sporadic CJD patients and matched controls (Figure 2). The V203I mutation of the PRNP gene has been reported in several case reports of genetic CJD in Italy, Korea, China and Japan. However, a recent systemic review concluded that the I203 mutation of the PRNP gene did not exhibit high penetrance and could be benign or is only associated with susceptibility to prion disease. We also found that the I203 mutation of the PRNP gene did not affect significant changes in the electrostatic potential of the human PrP (Figure 3). These studies indicate that I203 mutations of the PRNP gene may not be a crucial factor in sporadic CJD.
Herein, we identified elevated K200 somatic mutations in the PRNP gene in the frontal cortex and hippocampus of sporadic CJD patients. In addition, unlike the I203 mutation of the PRNP gene, the K200 mutation induced a significant change in the electrostatic potential of the human PrP. To the best of our knowledge, this is the first report of the association of the K200 somatic mutation of the PRNP gene with sporadic CJD patients.

4. Materials and Methods

4.1. Subjects

The 24 brain samples, including frontal cortex and hippocampus, of 6 sporadic CJD patients and 6 age- and sex-matched controls were provided by the University of Edinburgh in the United Kingdom. Sporadic CJD was diagnosed by an autopsy according to the guidelines of the World Health Organization (WHO). Detailed information on the samples is presented in Table 2.

4.2. Ethics Statements

All experimental procedures were approved by the institutional review board (IRB) of Jeonbuk National University and in accordance with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards (approval number: 2020-10-014). All the samples and related information were anonymized prior to research.

4.3. Genomic DNA Extraction

Genomic DNA was isolated from 20 mg of brain tissue using the Tissue Genomic DNA Isolation Kit (QIAGEN, Germantown, MD, USA) following the manufacturer’s instructions. The quality and concentration of genomic DNA (15–20 ng/µL, A260/280 = 1.8–2.0) were evaluated using a Nanodrop One spectrophotometer (Thermo Scientific, Waltham, MA, USA).

4.4. Polymerase Chain Reaction (PCR)

PCR was performed to amplify fragments containing the E200K and V203I SNPs of the human PRNP gene with Pfu DNA Polymerase (BIOFACT, Daejeon, Korea). The experimental conditions of each primer for PCR are described in Table 3. The PCR mixture contained 10 pmol of each primer, 2.5 µL of 10 × Taq DNA polymerase buffer, 1 μL of 10 mM dNTP mixture and 2.5 units of Taq DNA polymerase.

4.5. Sanger Sequencing

The purification of the PCR products was performed using a PCR Purification Kit (Thermo Fisher Scientific, USA), and the sequence was analyzed using an ABI 3730 automatic sequencer (ABI, Foster City, CA, USA). Sequencing results were analyzed by using Finch TV software (Geospiza Inc., Denver, CO, USA).

4.6. Pyrosequencing

The biotinylated PCR products of the human PRNP gene were amplified by nonbiotinylated forward and biotinylated reverse primers. The volume of the total PCR mixture was 80 µL, including 2 µL Streptoavidin Sepharose High Performance Medium (GE Healthcare, Chicago, IL, USA), 40 µL PyroMark Binding Buffer (QIAGEN, USA), 8.5 µL high purity autoclaved water and 10 µL PCR products, and shaken for 15 min at 14,000 rpm. The PCR products were washed sequentially with 70% ethanol for 10 sec, PyroMark Denaturation Buffer (QIAGEN, USA) for 10 sec and PyroMark Wash Buffer (QIAGEN, USA) for 10 sec and then mixed with 24.2 µL Pyromark annealing Buffer (QIAGEN, USA) and 0.8 µL sequencing primer (2 µM). Finally, the samples were incubated in a PyroMark Q25 plate holder preheated to 80 °C for 2 min. Prepared samples were loaded into PyroMark Q24 (QIAGEN, USA) and operated in allele quantification (AQ) mode according to the manufacturer’s protocol.

4.7. In Silico Estimation of the Impact of E200K and V203I Somatic Mutations on the Human Prion Protein (PrP)

The biological impacts of E200K and V203I somatic mutations on the human PrP were evaluated by using the PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/index.shtml (accessed on 14 April 2022 )), PANTHER (http://www.pantherdb.org/ (accessed on 14 April 2022)) and PROVEAN (http://provean.jcvi.org/seq_submit.php (accessed on 14 April 2022)) programs. PolyPhen-2 predicts the effect on the stability and function of amino acid changes using an independent count (PSIC). PANTHER calculates the length of time (in millions of years) of a position in a protein sequence using a hidden Markov model (HMM) based on statistical modeling. PROVEAN is a program that predicts the impact of nonsynonymous SNPs and indels on protein function.

4.8. D Structure and Electrostatic Potential Analyses

The NMR structure of the human PrP was obtained from the RCSB Protein Data Bank (PDB ID: 6FNV.1.A). The 3D structure of the human PrP was analyzed by using the SWISS-MODEL program (https://swissmodel.expasy.org/ (accessed on 14 April 2022)). The electrostatic potential according to the somatic mutations of the human PRNP gene was analyzed by using the Swiss-PdbViewer 4.1 program (https://spdbv.vital-it.ch/ (accessed on 14 April 2022)).

4.9. Statistical Analysis

Statistical analyses were performed by using SAS version 9.4 (SAS Institute Inc., Cary, NC, USA). The symbol * indicates p < 0.05. ‘N.S.’ indicates not significant.

Author Contributions

S.-Y.W., Y.-C.K. and B.-H.J. conceived and designed the experiment. S.-Y.W. and Y.-C.K. performed the experiments. S.-Y.W., Y.-C.K. and B.-H.J. analyzed the data. S.-Y.W., Y.-C.K. and B.-H.J. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (2021R1A2C1013213, 2022R1C1C2004792). This research was supported by the Basic Science Research Program through the National Research Foundation (NRF) of Korea funded by the Ministry of Education (2017R1A6A1A03015876, 2021R1A6A3A01086488). This research was supported by the Korea Basic Science Institute (National research Facilities and Equipment Center) grant funded by the Ministry of Education (grant No. 2021R1A6C101C369).

Institutional Review Board Statement

All experimental procedures were approved by the institutional review board (IRB) of Jeonbuk National University and in accordance with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards (approval number: 2020-10-014). All the samples and related information were anonymized prior to research.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are available from the corresponding authors upon reasonable request.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Prusiner, S.B. Prions. Proc. Natl. Acad. Sci. USA 1998, 95, 13363–13383. [Google Scholar] [CrossRef]
  2. Prusiner, S.B. The prion diseases. Brain Pathol. 1998, 8, 499–513. [Google Scholar] [CrossRef]
  3. Kim, Y.C.; Won, S.Y.; Jeong, B.H. Altered expression of glymphatic system-related proteins in prion diseases: Implications for the role of the glymphatic system in prion diseases. Cell Mol. Immunol. 2021, 18, 2281–2283. [Google Scholar] [CrossRef]
  4. Won, S.Y.; Kim, Y.C.; Jeong, B.H. First Report of the Potential Bovine Spongiform Encephalopathy (BSE)-Related Somatic Mutation E211K of the Prion Protein Gene (PRNP) in Cattle. Int. J. Mol. Sci. 2020, 21, 4246. [Google Scholar] [CrossRef]
  5. Kim, Y.C.; Won, S.Y.; Jeong, M.J.; Jeong, B.H. Absence of proteinase K-resistant PrP in Korean Holstein cattle carrying potential bovine spongiform encephalopathy-related E211K somatic mutation. Transbound. Emerg. Dis. 2021, 69, 805–812. [Google Scholar] [CrossRef]
  6. Kim, Y.C.; Park, K.J.; Hwang, J.Y.; Park, H.C.; Kang, H.E.; Sohn, H.J.; Jeong, B.H. In-depth examination of PrP(Sc) in Holstein cattle carrying the E211K somatic mutation of the bovine prion protein gene (PRNP). Transbound. Emerg. Dis. 2021, 69, e356–e361. [Google Scholar] [CrossRef]
  7. Benestad, S.L.; Telling, G.C. Chronic wasting disease: An evolving prion disease of cervids. Handb. Clin. Neurol. 2018, 153, 135–151. [Google Scholar] [CrossRef]
  8. Lloyd, S.; Mead, S.; Collinge, J. Genetics of prion disease. Top. Curr. Chem. 2011, 305, 1–22. [Google Scholar] [CrossRef]
  9. Jeong, B.H.; Kim, Y.S. Genetic studies in human prion diseases. J. Korean Med. Sci. 2014, 29, 623–632. [Google Scholar] [CrossRef]
  10. Gambetti, P.; Kong, Q.; Zou, W.; Parchi, P.; Chen, S.G. Sporadic and familial CJD: Classification and characterisation. Br. Med. Bull. 2003, 66, 213–239. [Google Scholar] [CrossRef]
  11. Atalay, F.O.; Tolunay, S.; Ozgun, G.; Bekar, A.; Zarifoglu, M. Creutzfeldt-Jakob disease: Report of four cases and review of the literature. Turk Patoloji Derg 2015, 31, 148–152. [Google Scholar] [CrossRef][Green Version]
  12. Collinge, J.; Palmer, M.S.; Dryden, A.J. Genetic predisposition to iatrogenic Creutzfeldt-Jakob disease. Lancet 1991, 337, 1441–1442. [Google Scholar] [CrossRef]
  13. Thomas, J.G.; Chenoweth, C.E.; Sullivan, S.E. Iatrogenic Creutzfeldt-Jakob disease via surgical instruments. J. Clin. Neurosci. 2013, 20, 1207–1212. [Google Scholar] [CrossRef]
  14. Mastrianni, J.A. The genetics of prion diseases. Genet. Med. 2010, 12, 187–195. [Google Scholar] [CrossRef]
  15. Uttley, L.; Carroll, C.; Wong, R.; Hilton, D.A.; Stevenson, M. Creutzfeldt-Jakob disease: A systematic review of global incidence, prevalence, infectivity, and incubation. Lancet Infect Dis. 2020, 20, e2–e10. [Google Scholar] [CrossRef]
  16. Park, J.S.; Lee, J.; Jung, E.S.; Kim, M.H.; Kim, I.B.; Son, H.; Kim, S.; Kim, S.; Park, Y.M.; Mook-Jung, I.; et al. Brain somatic mutations observed in Alzheimer’s disease associated with aging and dysregulation of tau phosphorylation. Nat. Commun. 2019, 10, 3090. [Google Scholar] [CrossRef]
  17. Miller, M.B.; Huang, A.Y.; Kim, J.; Zhou, Z.; Kirkham, S.L.; Maury, E.A.; Ziegenfuss, J.S.; Reed, H.C.; Neil, J.E.; Rento, L.; et al. Somatic genomic changes in single Alzheimer’s disease neurons. Nature 2022, 604, 714–722. [Google Scholar] [CrossRef]
  18. Alzualde, A.; Moreno, F.; Martinez-Lage, P.; Ferrer, I.; Gorostidi, A.; Otaegui, D.; Blazquez, L.; Atares, B.; Cardoso, S.; Martinez de Pancorbo, M.; et al. Somatic mosaicism in a case of apparently sporadic Creutzfeldt-Jakob disease carrying a de novo D178N mutation in the PRNP gene. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2010, 153B, 1283–1291. [Google Scholar] [CrossRef]
  19. Lobon, I.; Solís-Moruno, M.; Juan, D.; Muhaisen, A.; Abascal, F.; Esteller-Cucala, P.; García-Pérez, R.; Martí, M.J.; Tolosa, E.; Ávila, J.; et al. Somatic Mutations Detected in Parkinson Disease Could Affect Genes With a Role in Synaptic and Neuronal Processes. Front. Aging 2022, 3, 851039. [Google Scholar] [CrossRef]
  20. Leija-Salazar, M.; Piette, C.; Proukakis, C. Review: Somatic mutations in neurodegeneration. Neuropathol. Appl. Neurobiol. 2018, 44, 267–285. [Google Scholar] [CrossRef]
  21. Beck, J.A.; Poulter, M.; Campbell, T.A.; Uphill, J.B.; Adamson, G.; Geddes, J.F.; Revesz, T.; Davis, M.B.; Wood, N.W.; Collinge, J.; et al. Somatic and germline mosaicism in sporadic early-onset Alzheimer’s disease. Hum. Mol. Genet. 2004, 13, 1219–1224. [Google Scholar] [CrossRef]
  22. Nicolas, G.; Acuna-Hidalgo, R.; Keogh, M.J.; Quenez, O.; Steehouwer, M.; Lelieveld, S.; Rousseau, S.; Richard, A.C.; Oud, M.S.; Marguet, F.; et al. Somatic variants in autosomal dominant genes are a rare cause of sporadic Alzheimer’s disease. Alzheimer’s Dement. 2018, 14, 1632–1639. [Google Scholar] [CrossRef]
  23. Adzhubei, I.; Jordan, D.M.; Sunyaev, S.R. Predicting functional effect of human missense mutations using PolyPhen-2. Curr. Protoc. Hum. Genet. 2013, 76, 7–20. [Google Scholar] [CrossRef] [PubMed]
  24. Tang, H.; Thomas, P.D. PANTHER-PSEP: Predicting disease-causing genetic variants using position-specific evolutionary preservation. Bioinformatics 2016, 32, 2230–2232. [Google Scholar] [CrossRef]
  25. Choi, Y.; Chan, A.P. PROVEAN web server: A tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics 2015, 31, 2745–2747. [Google Scholar] [CrossRef]
  26. Lodato, M.A.; Rodin, R.E.; Bohrson, C.L.; Coulter, M.E.; Barton, A.R.; Kwon, M.; Sherman, M.A.; Vitzthum, C.M.; Luquette, L.J.; Yandava, C.N.; et al. Aging and neurodegeneration are associated with increased mutations in single human neurons. Science 2018, 359, 555–559. [Google Scholar] [CrossRef] [PubMed]
  27. Kovacs, G.G.; Puopolo, M.; Ladogana, A.; Pocchiari, M.; Budka, H.; van Duijn, C.; Collins, S.J.; Boyd, A.; Giulivi, A.; Coulthart, M.; et al. Genetic prion disease: The EUROCJD experience. Hum. Genet. 2005, 118, 166–174. [Google Scholar] [CrossRef] [PubMed]
  28. Shi, Q.; Chen, C.; Xiao, K.; Zhou, W.; Gao, L.P.; Chen, D.D.; Wu, Y.Z.; Wang, Y.; Hu, C.; Gao, C.; et al. Genetic Prion Disease: Insight from the Features and Experience of China National Surveillance for Creutzfeldt-Jakob Disease. Neurosci. Bull. 2021, 37, 1570–1582. [Google Scholar] [CrossRef]
Figure 1. The first pyrosequencing scheme to detect somatic mutations of the human prion protein gene (PRNP). (A) Schematic design of primers for pyrosequencing to detect E200K and V203I somatic mutations of the human PRNP gene. (B) Gene-specific primers were used to obtain 161 bp amplicons of the human PRNP gene containing codons 200 and 203. Negative: PCR product with sterilized distilled water instead of the template. Positive: PCR product with genomic DNA extracted from a normal aging human brain. (C) Representative electropherograms of pyrosequencing containing codons 200 and 203 of the PRNP gene results. CTL: normal aging control. CJD: Creutzfeldt–Jakob disease patient.
Figure 1. The first pyrosequencing scheme to detect somatic mutations of the human prion protein gene (PRNP). (A) Schematic design of primers for pyrosequencing to detect E200K and V203I somatic mutations of the human PRNP gene. (B) Gene-specific primers were used to obtain 161 bp amplicons of the human PRNP gene containing codons 200 and 203. Negative: PCR product with sterilized distilled water instead of the template. Positive: PCR product with genomic DNA extracted from a normal aging human brain. (C) Representative electropherograms of pyrosequencing containing codons 200 and 203 of the PRNP gene results. CTL: normal aging control. CJD: Creutzfeldt–Jakob disease patient.
Ijms 24 14831 g001
Figure 2. Comparison of somatic mutation rates of the PRNP gene in brains from sporadic CJD patients and matched controls. (A) Comparison of K200 somatic mutation rates of the PRNP gene in the hippocampus. (B) Comparison of K200 somatic mutation rates of the PRNP gene in the frontal cortex. (C) Comparison of I203 somatic mutation rates of the PRNP gene in the hippocampus. (D) Comparison of I203 somatic mutation rates of the PRNP gene in the frontal cortex. *: p < 0.05; N.S.: not significant. Red and blue horizontal bars indicate the average somatic mutation rates of the PRNP gene in brains from sporadic CJD patients and matched controls, respectively.
Figure 2. Comparison of somatic mutation rates of the PRNP gene in brains from sporadic CJD patients and matched controls. (A) Comparison of K200 somatic mutation rates of the PRNP gene in the hippocampus. (B) Comparison of K200 somatic mutation rates of the PRNP gene in the frontal cortex. (C) Comparison of I203 somatic mutation rates of the PRNP gene in the hippocampus. (D) Comparison of I203 somatic mutation rates of the PRNP gene in the frontal cortex. *: p < 0.05; N.S.: not significant. Red and blue horizontal bars indicate the average somatic mutation rates of the PRNP gene in brains from sporadic CJD patients and matched controls, respectively.
Ijms 24 14831 g002
Figure 3. The three-dimensional (3D) structure and electrostatic potential of the human prion protein (PrP) according to somatic mutations in the PRNP gene. (A) The 3D structure and electrostatic potential of the wild-type human PrP. (B) The 3D structure and electrostatic potential of the human PrP with the K200 allele. (C) The 3D structure and electrostatic potential of the human PrP with the I203 allele. Positive potentials are drawn in blue. Negative potentials are drawn in red. White arrows indicate a significant change in electrostatic potential compared to the wild-type PrP.
Figure 3. The three-dimensional (3D) structure and electrostatic potential of the human prion protein (PrP) according to somatic mutations in the PRNP gene. (A) The 3D structure and electrostatic potential of the wild-type human PrP. (B) The 3D structure and electrostatic potential of the human PrP with the K200 allele. (C) The 3D structure and electrostatic potential of the human PrP with the I203 allele. Positive potentials are drawn in blue. Negative potentials are drawn in red. White arrows indicate a significant change in electrostatic potential compared to the wild-type PrP.
Ijms 24 14831 g003
Table 1. In silico evaluation of the impact of K200 and I203 somatic mutations on the human prion protein (PrP).
Table 1. In silico evaluation of the impact of K200 and I203 somatic mutations on the human prion protein (PrP).
Somatic MutationsMethodsScorePrediction
c.598G > A
(E200K)
PolyPhen-20.987Probably damaging
PANTHER361Possibly damaging
PROVEAN−1.478Neutral
c.607G > A
(V203I)
PolyPhen-20.882Possibly damaging
PANTHER176Probably benign
PROVEAN−0.004Neutral
Table 2. K200 and I203 somatic mutation rates of the prion protein gene (PRNP) observed in sporadic CJD patients and matched controls.
Table 2. K200 and I203 somatic mutation rates of the prion protein gene (PRNP) observed in sporadic CJD patients and matched controls.
Sample No.TypeSexAgeAverageBrain TissueK200 Somatic Mutation Rates (%)I203 Somatic Mutation Rates (%)Codon 129 Genotype
Sample 1Control 1Male8464.6 ± 9.2Frontal cortex4.131.19MM
Sample 2 Hippocampus4.921.25
Sample 3Control 2Male67 Frontal cortex4.681.25MM
Sample 4 Hippocampus4.510.81
Sample 5Control 3Male73 Frontal cortex4.671.28VV
Sample 6 Hippocampus5.231.95
Sample 7Control 4Female57 Frontal cortex4.360.91MV
Sample 8 Hippocampus3.621.06
Sample 9Control 5Female73 Frontal cortex3.930.86MV
Sample 10 Hippocampus3.691.11
Sample 11Control 6Female53 Frontal cortex4.531.07MV
Sample 12 Hippocampus4.891.34
Sample 13Case 1Male8670.7 ± 13.3Frontal cortex5.680.92MM
Sample 14 Hippocampus4.074.25
Sample 15Case 2Male66 Frontal cortex4.611.41MV
Sample 16 Hippocampus5.030.98
Sample 17Case 3Male86 Frontal cortex4.301.63MV
Sample 18 Hippocampus6.451.43
Sample 19Case 4Female60 Frontal cortex5.611.25MM
Sample 20 Hippocampus5.101.04
Sample 21Case 5Female72 Frontal cortex4.461.58MM
Sample 22 Hippocampus5.921.22
Sample 23Case 6Female54 Frontal cortex5.910.90MV
Sample 24 Hippocampus5.560.83
Table 3. Detailed information on the primer sets used in this study.
Table 3. Detailed information on the primer sets used in this study.
Purpose NameSequenceSizeAnnealing Temperature
Sanger sequencingAmplificationFCAACCGCTACCCACCTCAG564 bp60 °C
RAGGACCATGCTCGATCCTCT
PyrosequencingAmplificationPFAGGCCCATGGATGAGTACAG161 bp60 °C
Biotin_PRTGGGTGATACACATCTGCTCAAC
SequencingSeqAGGGGGAGAACTTCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Won, S.-Y.; Kim, Y.-C.; Jeong, B.-H. Elevated E200K Somatic Mutation of the Prion Protein Gene (PRNP) in the Brain Tissues of Patients with Sporadic Creutzfeldt–Jakob Disease (CJD). Int. J. Mol. Sci. 2023, 24, 14831. https://doi.org/10.3390/ijms241914831

AMA Style

Won S-Y, Kim Y-C, Jeong B-H. Elevated E200K Somatic Mutation of the Prion Protein Gene (PRNP) in the Brain Tissues of Patients with Sporadic Creutzfeldt–Jakob Disease (CJD). International Journal of Molecular Sciences. 2023; 24(19):14831. https://doi.org/10.3390/ijms241914831

Chicago/Turabian Style

Won, Sae-Young, Yong-Chan Kim, and Byung-Hoon Jeong. 2023. "Elevated E200K Somatic Mutation of the Prion Protein Gene (PRNP) in the Brain Tissues of Patients with Sporadic Creutzfeldt–Jakob Disease (CJD)" International Journal of Molecular Sciences 24, no. 19: 14831. https://doi.org/10.3390/ijms241914831

APA Style

Won, S.-Y., Kim, Y.-C., & Jeong, B.-H. (2023). Elevated E200K Somatic Mutation of the Prion Protein Gene (PRNP) in the Brain Tissues of Patients with Sporadic Creutzfeldt–Jakob Disease (CJD). International Journal of Molecular Sciences, 24(19), 14831. https://doi.org/10.3390/ijms241914831

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop