Krüppel-like Factor 15 Suppresses Ferroptosis by Activating an NRF2/GPX4 Signal to Protect against Folic Acid-Induced Acute Kidney Injury
Abstract
:1. Introduction
2. Results
2.1. KLF15 Expression Was Decreased in AKI Mice and KLF15 Knockout Aggravated Kidney Injury In Vivo
2.2. KLF15 Knockout Aggravated FA-Induced Ferroptosis In Vivo
2.3. KLF15 Is Reduced in Erastin-Treated HK2 Cells
2.4. KLF15 Protects HK2 Cells from Erastin-Induced Ferroptosis
2.5. KLF15 Inhibits Ferroptosis by Activating the NRF2/GPX4 Signaling Axis
2.6. KLF15 Stabilizes NRF2 by Suppressing Ubiquitin-Mediated Degradation
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Renal Function, Histology, and Immunohistochemistry
4.3. Detection of MDA and GSH Levels
4.4. Cell Culture, Transfection, and Drug Treatments
4.5. Cell Viability Assay
4.6. Real-Time Quantitative PCR
4.7. Western Blot Analysis
4.8. Lipid ROS Assay Using Flow Cytometry
4.9. Iron Measurements
4.10. Co-Immunoprecipitation Assay
4.11. Preparation of Nuclear and Cytosolic Fractions
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Han, S.; Ray, J.W.; Pathak, P.; Sweet, D.R.; Zhang, R.; Gao, H.; Jain, N.; Koritzinsky, E.H.; Matoba, K.; Xu, W.; et al. KLF15 regulates endobiotic and xenobiotic metabolism. Nat. Metab. 2019, 1, 422–430. [Google Scholar] [CrossRef] [PubMed]
- Fan, L.; Sweet, D.R.; Fan, E.K.; Prosdocimo, D.A.; Madera, A.; Jiang, Z.; Padmanabhan, R.; Haldar, S.M.; Vinayachandran, V.; Jain, M.K. Transcription factors KLF15 and PPARdelta cooperatively orchestrate genome-wide regulation of lipid metabolism in skeletal muscle. J. Biol. Chem. 2022, 298, 101926. [Google Scholar] [CrossRef] [PubMed]
- Haldar, S.M.; Jeyaraj, D.; Anand, P.; Zhu, H.; Lu, Y.; Prosdocimo, D.A.; Eapen, B.; Kawanami, D.; Okutsu, M.; Brotto, L.; et al. Kruppel-like factor 15 regulates skeletal muscle lipid flux and exercise adaptation. Proc. Natl. Acad. Sci. USA 2012, 109, 6739–6744. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Xu, W.; Zhang, L. KLF15 Regulates Oxidative Stress Response in Cardiomyocytes through NAD+. Metabolites 2021, 11, 620. [Google Scholar] [CrossRef] [PubMed]
- Li, X.T.; Song, J.W.; Zhang, Z.Z.; Zhang, M.W.; Liang, L.R.; Miao, R.; Liu, Y.; Chen, Y.H.; Liu, X.Y.; Zhong, J.C. Sirtuin 7 mitigates renal ferroptosis, fibrosis and injury in hypertensive mice by facilitating the KLF15/Nrf2 signaling. Free Radic. Biol. Med. 2022, 193, 459–473. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.W.; Li, X.T.; Zhang, Z.Z.; Liu, Y.; Song, J.W.; Liu, X.M.; Chen, Y.H.; Wang, N.; Guo, Y.; Liang, L.R.; et al. Elabela blunts doxorubicin-induced oxidative stress and ferroptosis in rat aortic adventitial fibroblasts by activating the KLF15/GPX4 signaling. Cell Stress Chaperones 2023, 28, 91–103. [Google Scholar] [CrossRef]
- Gu, X.; Mallipattu, S.K.; Guo, Y.; Revelo, M.P.; Pace, J.; Miller, T.; Gao, X.; Jain, M.K.; Bialkowska, A.B.; Yang, V.W.; et al. The loss of Kruppel-like factor 15 in Foxd1(+) stromal cells exacerbates kidney fibrosis. Kidney Int. 2017, 92, 1178–1193. [Google Scholar] [CrossRef]
- Guo, Y.; Pace, J.; Li, Z.; Ma’ayan, A.; Wang, Z.; Revelo, M.P.; Chen, E.; Gu, X.; Attalah, A.; Yang, Y.; et al. Podocyte-Specific Induction of Kruppel-Like Factor 15 Restores Differentiation Markers and Attenuates Kidney Injury in Proteinuric Kidney Disease. J. Am. Soc. Nephrol. 2018, 29, 2529–2545. [Google Scholar] [CrossRef]
- Mallipattu, S.K.; Guo, Y.; Revelo, M.P.; Roa-Pena, L.; Miller, T.; Ling, J.; Shankland, S.J.; Bialkowska, A.B.; Ly, V.; Estrada, C.; et al. Kruppel-Like Factor 15 Mediates Glucocorticoid-Induced Restoration of Podocyte Differentiation Markers. J. Am. Soc. Nephrol. 2017, 28, 166–184. [Google Scholar] [CrossRef]
- Piret, S.E.; Attallah, A.A.; Gu, X.; Guo, Y.; Gujarati, N.A.; Henein, J.; Zollman, A.; Hato, T.; Ma’ayan, A.; Revelo, M.P.; et al. Loss of proximal tubular transcription factor Kruppel-like factor 15 exacerbates kidney injury through loss of fatty acid oxidation. Kidney Int. 2021, 100, 1250–1267. [Google Scholar] [CrossRef]
- Piret, S.E.; Guo, Y.; Attallah, A.A.; Horne, S.J.; Zollman, A.; Owusu, D.; Henein, J.; Sidorenko, V.S.; Revelo, M.P.; Hato, T.; et al. Kruppel-like factor 6-mediated loss of BCAA catabolism contributes to kidney injury in mice and humans. Proc. Natl. Acad. Sci. USA 2021, 118, e2024414118. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, N.; Kanai, A.; Suzuki, Y.; Ogino, H.; Ochi, H. Adrenergic receptor signaling induced by Klf15, a regulator of regeneration enhancer, promotes kidney reconstruction. Proc. Natl. Acad. Sci. USA 2022, 119, e2204338119. [Google Scholar] [CrossRef] [PubMed]
- Dixon, S.J.; Lemberg, K.M.; Lamprecht, M.R.; Skouta, R.; Zaitsev, E.M.; Gleason, C.E.; Patel, D.N.; Bauer, A.J.; Cantley, A.M.; Yang, W.S.; et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell 2012, 149, 1060–1072. [Google Scholar] [CrossRef]
- Latunde-Dada, G.O. Ferroptosis: Role of lipid peroxidation, iron and ferritinophagy. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 1893–1900. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Cao, F.; Yin, H.L.; Huang, Z.J.; Lin, Z.T.; Mao, N.; Sun, B.; Wang, G. Ferroptosis: Past, present and future. Cell Death Dis. 2020, 11, 88. [Google Scholar] [CrossRef]
- Yang, W.S.; Stockwell, B.R.; Stockwell, B.R. Ferroptosis: Death by Lipid Peroxidation. Trends Cell Biol. 2016, 26, 165–176. [Google Scholar] [CrossRef]
- Chen, D.; Chu, B.; Yang, X.; Liu, Z.; Jin, Y.; Kon, N.; Rabadan, R.; Jiang, X.; Stockwell, B.R.; Gu, W. iPLA2beta-mediated lipid detoxification controls p53-driven ferroptosis independent of GPX4. Nat. Commun. 2021, 12, 3644. [Google Scholar] [CrossRef]
- He, L.; Liu, Y.Y.; Wang, K.; Li, C.; Zhang, W.; Li, Z.Z.; Huang, X.Z.; Xiong, Y. Tanshinone IIA protects human coronary artery endothelial cells from ferroptosis by activating the NRF2 pathway. Biochem. Biophys. Res. Commun. 2021, 575, 1–7. [Google Scholar] [CrossRef]
- Lei, G.; Zhang, Y.; Hong, T.; Zhang, X.; Liu, X.; Mao, C.; Yan, Y.; Koppula, P.; Cheng, W.; Sood, A.K.; et al. Ferroptosis as a mechanism to mediate p53 function in tumor radiosensitivity. Oncogene 2021, 40, 3533–3547. [Google Scholar] [CrossRef]
- Lane, D.J.R.; Metselaar, B.; Greenough, M.; Bush, A.I.; Ayton, S.J. Ferroptosis and NRF2: An emerging battlefield in the neurodegeneration of Alzheimer’s disease. Essays Biochem 2021, 65, 925–940. [Google Scholar]
- Kim, S.; Kang, S.W.; Joo, J.; Han, S.H.; Shin, H.; Nam, B.Y.; Park, J.; Yoo, T.H.; Kim, G.; Lee, P.; et al. Characterization of ferroptosis in kidney tubular cell death under diabetic conditions. Cell Death Dis. 2021, 12, 160. [Google Scholar] [CrossRef]
- Wang, J.; Liu, Y.; Wang, Y.; Sun, L. The Cross-Link between Ferroptosis and Kidney Diseases. Oxid Med. Cell Longev. 2021, 2021, 6654887. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Zhang, T.; Wang, F.; Chen, X.; Xu, H.; Zhou, C.; Chen, M.; Yu, F.; Wang, S.; Yang, D.; et al. Targeted inhibition of Rev-erb-alpha/beta limits ferroptosis to ameliorate folic acid-induced acute kidney injury. Br. J. Pharmacol. 2021, 178, 328–345. [Google Scholar] [CrossRef]
- Hu, Z.; Zhang, H.; Yang, S.K.; Wu, X.; He, D.; Cao, K.; Zhang, W. Emerging Role of Ferroptosis in Acute Kidney Injury. Oxid. Med. Cell Longev. 2019, 2019, 8010614. [Google Scholar] [CrossRef] [PubMed]
- Tonnus, W.; Meyer, C.; Steinebach, C.; Belavgeni, A.; von Massenhausen, A.; Gonzalez, N.Z.; Maremonti, F.; Gembardt, F.; Himmerkus, N.; Latk, M.; et al. Dysfunction of the key ferroptosis-surveilling systems hypersensitizes mice to tubular necrosis during acute kidney injury. Nat. Commun. 2021, 12, 4402. [Google Scholar] [CrossRef] [PubMed]
- Dodson, M.; Castro-Portuguez, R.; Zhang, D.D. NRF2 plays a critical role in mitigating lipid peroxidation and ferroptosis. Redox Biol. 2019, 23, 101107. [Google Scholar] [CrossRef]
- Gao, X.; Jiang, S.; Du, Z.; Ke, A.; Liang, Q.; Li, X. KLF2 Protects against Osteoarthritis by Repressing Oxidative Response through Activation of Nrf2/ARE Signaling In Vitro and In Vivo. Oxid Med. Cell Longev. 2019, 2019, 8564681. [Google Scholar] [CrossRef]
- Yamamoto, M.; Kensler, T.W.; Motohashi, H. The KEAP1-NRF2 System: A Thiol-Based Sensor-Effector Apparatus for Maintaining Redox Homeostasis. Physiol. Rev. 2018, 98, 1169–1203. [Google Scholar] [CrossRef]
- Ni, L.; Yuan, C.; Wu, X. Targeting ferroptosis in acute kidney injury. Cell Death Dis. 2022, 13, 182. [Google Scholar] [CrossRef]
- Coca, S.G.; Singanamala, S.; Parikh, C.R. Chronic kidney disease after acute kidney injury: A systematic review and meta-analysis. Kidney Int. 2012, 81, 442–448. [Google Scholar] [CrossRef]
- Venkatachalam, M.A.; Weinberg, J.M.; Kriz, W.; Bidani, A.K. Failed Tubule Recovery, AKI-CKD Transition, and Kidney Disease Progression. J. Am. Soc. Nephrol. 2015, 26, 1765–1776. [Google Scholar] [CrossRef]
- Metz-Kurschel, U.; Kurschel, E.; Wagner, K.; Aulbert, E.; Graben, N.; Philipp, T. Folate nephropathy occurring during cytotoxic chemotherapy with high-dose folinic acid and 5-fluorouracil. Ren. Fail. 1990, 12, 93–97. [Google Scholar] [CrossRef] [PubMed]
- Martin-Sanchez, D.; Ruiz-Andres, O.; Poveda, J.; Carrasco, S.; Cannata-Ortiz, P.; Sanchez-Nino, M.D.; Ruiz Ortega, M.; Egido, J.; Linkermann, A.; Ortiz, A.; et al. Ferroptosis, but Not Necroptosis, Is Important in Nephrotoxic Folic Acid-Induced AKI. J. Am. Soc. Nephrol. 2017, 28, 218–229. [Google Scholar] [CrossRef]
- Li, D.; Liu, B.; Fan, Y.; Liu, M.; Han, B.; Meng, Y.; Xu, X.; Song, Z.; Liu, X.; Hao, Q.; et al. Nuciferine protects against folic acid-induced acute kidney injury by inhibiting ferroptosis. Br. J. Pharmacol. 2021, 178, 1182–1199. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Quan, F.; Cao, Q.; Lin, Y.; Yue, C.; Bi, R.; Cui, X.; Yang, H.; Yang, Y.; Birnbaumer, L.; et al. Quercetin alleviates acute kidney injury by inhibiting ferroptosis. J. Adv. Res. 2021, 28, 231–243. [Google Scholar] [CrossRef] [PubMed]
- Fan, L.; Sweet, D.R.; Prosdocimo, D.A.; Vinayachandran, V.; Chan, E.R.; Zhang, R.; Ilkayeva, O.; Lu, Y.; Keerthy, K.S.; Booth, C.E.; et al. Muscle Kruppel-like factor 15 regulates lipid flux and systemic metabolic homeostasis. J. Clin. Investig. 2021, 131, e139496. [Google Scholar] [CrossRef]
- Matoba, K.; Lu, Y.; Zhang, R.; Chen, E.R.; Sangwung, P.; Wang, B.; Prosdocimo, D.A.; Jain, M.K. Adipose KLF15 Controls Lipid Handling to Adapt to Nutrient Availability. Cell Rep. 2017, 21, 3129–3140. [Google Scholar] [CrossRef]
- Prosdocimo, D.A.; John, J.E.; Zhang, L.; Efraim, E.S.; Zhang, R.; Liao, X.; Jain, M.K. KLF15 and PPARalpha Cooperate to Regulate Cardiomyocyte Lipid Gene Expression and Oxidation. PPAR Res. 2015, 2015, 201625. [Google Scholar] [CrossRef]
- Wang, L.F.; Lin, W.A.; Chen, J.H. Kruppel-like Factor 15: A Potential Therapeutic Target For Kidney Disease. Int. J. Biol. Sci. 2019, 15, 1955–1961. [Google Scholar] [CrossRef]
- Gao, X.; Huang, L.; Grosjean, F.; Esposito, V.; Wu, J.; Fu, L.; Hu, H.; Tan, J.; He, C.; Gray, S.; et al. Low-protein diet supplemented with ketoacids reduces the severity of renal disease in 5/6 nephrectomized rats: A role for KLF15. Kidney Int. 2011, 79, 987–996. [Google Scholar] [CrossRef]
- Stockwell, B.R.; Friedmann Angeli, J.P.; Bayir, H.; Bush, A.I.; Conrad, M.; Dixon, S.J.; Fulda, S.; Gascón , S.; Hatzios, S.K.; Kagan, V.E.; et al. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 2017, 171, 273–285. [Google Scholar] [CrossRef] [PubMed]
- Friedmann Angeli, J.P.; Schneider, M.; Proneth, B.; Tyurina, Y.Y.; Tyurin, V.A.; Hammond, V.J.; Herbach, N.; Aichler, M.; Walch, A.; Eggenhofer, E.; et al. Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice. Nat. Cell Biol. 2014, 16, 1180–1191. [Google Scholar] [CrossRef]
- Ingold, I.; Berndt, C.; Schmitt, S.; Doll, S.; Poschmann, G.; Buday, K.; Roveri, A.; Peng, X.; Porto Freitas, F.; Seibt, T.; et al. Selenium Utilization by GPX4 Is Required to Prevent Hydroperoxide-Induced Ferroptosis. Cell 2018, 172, 409–422.e21. [Google Scholar] [CrossRef]
- Yang, W.S.; SriRamaratnam, R.; Welsch, M.E.; Shimada, K.; Skouta, R.; Viswanathan, V.S.; Cheah, J.H.; Clemons, P.A.; Shamji, A.F.; Clish, C.B.; et al. Regulation of ferroptotic cancer cell death by GPX4. Cell 2014, 156, 317–331. [Google Scholar] [CrossRef]
- La Rosa, P.; Petrillo, S.; Turchi, R.; Berardinelli, F.; Schirinzi, T.; Vasco, G.; Lettieri-Barbato, D.; Fiorenza, M.T.; Bertini, E.S.; Aquilano, K.; et al. The Nrf2 induction prevents ferroptosis in Friedreich’s Ataxia. Redox Biol. 2021, 38, 101791. [Google Scholar] [CrossRef]
- Mas, C.; Lussier-Price, M.; Soni, S.; Morse, T.; Arseneault, G.; Di Lello, P.; Lafrance-Vanasse, J.; Bieker, J.J.; Omichinski, J.G. Structural and functional characterization of an atypical activation domain in erythroid Kruppel-like factor (EKLF). Proc. Natl. Acad. Sci. USA 2011, 108, 10484–10489. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Zhang, L.; Liao, X.; Sangwung, P.; Prosdocimo, D.A.; Zhou, G.; Votruba, A.R.; Brian, L.; Han, Y.J.; Gao, H.; et al. Kruppel-like factor 15 is critical for vascular inflammation. J. Clin. Investig. 2013, 123, 4232–4241. [Google Scholar] [CrossRef]
- Lu, Y.Y.; Li, X.D.; Zhou, H.D.; Shao, S.; He, S.; Hong, M.N.; Liu, J.C.; Xu, Y.L.; Wu, Y.J.; Zhu, D.L.; et al. Transactivation domain of Kruppel-like factor 15 negatively regulates angiotensin II-induced adventitial inflammation and fibrosis. FASEB J. 2019, 33, 6254–6268. [Google Scholar] [CrossRef]
- He, S.; Lu, Y.; Guo, Y.; Li, S.; Lu, X.; Shao, S.; Zhou, H.; Wang, R.; Wang, J.; Gao, P.; et al. Kruppel-Like Factor 15 Modulates CXCL1/CXCR2 Signaling-Mediated Inflammatory Response Contributing to Angiotensin II-Induced Cardiac Remodeling. Front Cell Dev. Biol. 2021, 9, 644954. [Google Scholar] [CrossRef]
- Kim, Y.D.; Hwang, S.L.; Jeon, H.J.; Jeon, Y.H.; Nedumaran, B.; Kim, K.; Lee, S.E. B-cell translocation gene 2 enhances fibroblast growth factor 21 production by inducing Kruppel-like factor 15. Sci. Rep. 2019, 9, 3730. [Google Scholar] [CrossRef]
- Chung, S.; Kim, S.; Son, M.; Kim, M.; Koh, E.S.; Shin, S.J.; Park, C.W.; Kim, H.S. Inhibition of p300/CBP-Associated Factor Attenuates Renal Tubulointerstitial Fibrosis through Modulation of NF-kB and Nrf2. Int. J. Mol. Sci. 2019, 20, 1554. [Google Scholar] [CrossRef]
- Ganner, A.; Pfeiffer, Z.C.; Wingendorf, L.; Kreis, S.; Klein, M.; Walz, G.; Neumann-Haefelin, E. The acetyltransferase p300 regulates NRF2 stability and localization. Biochem. Biophys. Res. Commun. 2020, 524, 895–902. [Google Scholar] [CrossRef]
- Qiu, L.; Liu, X.; Xia, H.; Xu, C. Downregulation of P300/CBP-Associated Factor Protects from Vascular Aging via Nrf2 Signal Pathway Activation. Int. J. Mol. Sci. 2022, 23, 12574. [Google Scholar] [CrossRef]
- Wang, B.; Xu, H.; Kong, J.; Liu, D.; Qin, W.; Bai, W. Kruppel-like Factor 15 Reduces Ischemia-Induced Apoptosis Involving Regulation of p38/MAPK Signaling. Hum Gene Ther 2021, 32, 1471–1480. [Google Scholar] [CrossRef] [PubMed]
- Cid-Diaz, T.; Leal-Lopez, S.; Fernandez-Barreiro, F.; Gonzalez-Sanchez, J.; Santos-Zas, I.; Andrade-Bulos, L.J.; Rodriguez-Fuentes, M.E.; Mosteiro, C.S.; Mouly, V.; Casabiell, X.; et al. Obestatin signalling counteracts glucocorticoid-induced skeletal muscle atrophy via NEDD4/KLF15 axis. J. Cachexia Sarcopenia Muscle 2021, 12, 493–505. [Google Scholar] [CrossRef] [PubMed]
- Kasper, P.; Vohlen, C.; Dinger, K.; Mohr, J.; Hucklenbruch-Rother, E.; Janoschek, R.; Koth, J.; Matthes, J.; Appel, S.; Dotsch, J.; et al. Renal Metabolic Programming Is Linked to the Dynamic Regulation of a Leptin-Klf15 Axis and Akt/AMPKalpha Signaling in Male Offspring of Obese Dams. Endocrinology 2017, 158, 3399–3415. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Dong, W.; Shao, J.; Wang, Y.; Zhou, M.; Sun, H. Branched-Chain Amino Acid Negatively Regulates KLF15 Expression via PI3K-AKT Pathway. Front. Physiol. 2017, 8, 853. [Google Scholar] [CrossRef] [PubMed]
Number | Gene Name | Forward Primer | Reverse Primer |
---|---|---|---|
1 | h-KLF15 | AGGTTCTCGCGCTCTGACG | ACCTTGATGTGCTTGGAGAGG |
2 | h-NRF2 | TCTGGAAAGGACCGTTGTCG | GCCAAGTAGTGTGTCTCCATAG |
3 | h-GPX4 | GAGGCAAGACCGAAGTAAACTAC | CCGAACTGGTTACACGGGAA |
4 | h-SLC7A11 | GGTTGCCCTTTCCCTCTATTC | CCTGGGTTTCTTGTCCCATATAA |
5 | h-HO-1 | GGAAATCATCCCTTGCACGC | TGTTTGAACTTGGTGGGGCT |
6 | h-NQO1 | CATTGCAGTGGTTTGGGGTG | TCTGGAAAGGACCGTTGTCG |
7 | h-GCLM | GAGTTGCACAGCTGGATTCT | CCTCCCAGTAAGGCTGTAAATG |
8 | m-KLF15 | CCCAGCTTCTAGTCAACATCC | GCGCAATTCGCACAAACT |
9 | m-KIM-1 | CCAGGCGCTGTGGATTCTTA | TGTACCGACTGCTCTTCTGATAGG |
10 | m-NGAL | TGGCCCTGAGTGTCATGTG | CTCTTGTAGCTCATAGATGGTGC |
11 | m-NRF2 | CAATGAGGTTTCTTCGGCTACG | AAGACTGGGCTCTCGATGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, X.; Dong, S.; Fan, Y.; Xia, Y.; Yang, F.; Chen, Z.; Chen, D.; Zhang, M.; Liang, D.; Zeng, C. Krüppel-like Factor 15 Suppresses Ferroptosis by Activating an NRF2/GPX4 Signal to Protect against Folic Acid-Induced Acute Kidney Injury. Int. J. Mol. Sci. 2023, 24, 14530. https://doi.org/10.3390/ijms241914530
Yang X, Dong S, Fan Y, Xia Y, Yang F, Chen Z, Chen D, Zhang M, Liang D, Zeng C. Krüppel-like Factor 15 Suppresses Ferroptosis by Activating an NRF2/GPX4 Signal to Protect against Folic Acid-Induced Acute Kidney Injury. International Journal of Molecular Sciences. 2023; 24(19):14530. https://doi.org/10.3390/ijms241914530
Chicago/Turabian StyleYang, Xue, Shihui Dong, Yun Fan, Yuanyuan Xia, Fan Yang, Zhaohong Chen, Dacheng Chen, Mingchao Zhang, Dandan Liang, and Caihong Zeng. 2023. "Krüppel-like Factor 15 Suppresses Ferroptosis by Activating an NRF2/GPX4 Signal to Protect against Folic Acid-Induced Acute Kidney Injury" International Journal of Molecular Sciences 24, no. 19: 14530. https://doi.org/10.3390/ijms241914530
APA StyleYang, X., Dong, S., Fan, Y., Xia, Y., Yang, F., Chen, Z., Chen, D., Zhang, M., Liang, D., & Zeng, C. (2023). Krüppel-like Factor 15 Suppresses Ferroptosis by Activating an NRF2/GPX4 Signal to Protect against Folic Acid-Induced Acute Kidney Injury. International Journal of Molecular Sciences, 24(19), 14530. https://doi.org/10.3390/ijms241914530