CSAD Ameliorates Lipid Accumulation in High-Fat Diet-Fed Mice
Abstract
1. Introduction
2. Results
2.1. CSAD Is Downregulated in NAFLD Patients and Multiple NAFLD Mice Models
2.2. Overexpression of CSAD Improved HFD-Induced Obesity and Liver Damage
2.3. Overexpression of CSAD-Alleviated Hepatic Steatosis
2.4. Overexpression of CSAD Can Attenuate Mitochondrial Damage
2.5. Overexpression of CSAD Does Not Affect the Production of Taurine
3. Discussion
4. Materials and Methods
4.1. Mice Experimental Protocol
4.2. Biochemical Analysis of Blood Samples
4.3. TG and TC Analysis
4.4. Oral Lipid Tolerance Tests (OLTT)
4.5. Histologic Analysis
4.6. RT-qPCR
- M-Csad-F: CCAGGACGTGTTTGGGATTGT;
- M-Csad-R: CTCCTTCCATTCGCAGACCTT;
- M-Acadl-F: TTTCCTCGGAGCATGACATTTT
- M-Acadl-R: GCCAGCTTTTTCCCAGACCT
- M- Ppara-F: AACATCGAGTGTCGAATATGTGG
- M-Ppara-R: CCGAATAGTTCGCCGAAAGA
- M-Cpt1a-F: TGGCATCATCACTGGTGTGTT
- M-Cpt1a-R: GTCTAGGGTCCGATTGATCTTTG
- M-Cpt2-F: CAGCACAGCATCGTACCCA
- M-Cpt2-R: TCCCAATGCCGTTCTCAAAAT
- M-Acox1-F: TAACTTCCTCACTCGAAGCCA
- M-Acox1-R: AGTTCCATGACCCATCTCIGTC
- M-Acadm-F: AGGGTTTAGTTTTGAGTTGACGG
- M-Acadm-R: CCCCGCTTTTGTCATATTCCG
- M-Fasn-F: GGAGGTGGTGATAGCCGGTAT
- M-Fasn-R: TGGGTAATCCATAGAGCCCAG
- M-Scd1-F: TTCTTGCGATACACTCTGGTGC
- M-Scd1-R: CGGGATTGAATGTTCTTGTCGT
- M-GAPDH-F: GACGGCCGCATCTTCTTGTG
- M-GAPDH-R: GCGCCCAATACGGCCAAATC
4.7. Plasmid Construction
4.8. Western Blot
4.9. Cell Viability Assay
4.10. Taurine Content Analysis
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| NAFLD | non-alcoholic fatty liver disease |
| CSAD | cysteine sulfinic acid decarboxylase |
| GEO | gene Expression Omnibus |
| NASH | non-alcoholic steatohepatitis |
| ALT | alanine aminotransferase |
| AST | aspartate transaminase |
| LDL-C | low-density lipoprotein cholesterol |
| HDL-C | high-density lipoprotein cholesterol |
| TG | triglyceride |
| TC | total cholesterol |
| COX-IV | cytochrome c oxidase subunit 4 |
| TOM20 | translocase of outer mitochondrial membrane 20 |
| GAPDH | glyceraldehyde-3-phosphate dehydrogenase; |
| Acad1 | acetyl-CoA acetyltransferase 1 |
| Ppara | peroxisome proliferator-activated receptor α |
| Cptla | carnitine palmitoyl transferase 1a |
| Cpt2 | carnitine palmitoyltransferase 2 |
| Acox1 | acyl-CoA oxidase 1 |
| Acadm | acyl-CoA dehydrogenase |
| Fasn | fatty acid synthase |
| Scd1 | stearyl coenzyme A desaturation enzyme 1 |
References
- Bogdanova, K.; Poczatkova, H.; Uherkova, L.; Riegrova, D.; Rypka, M.; Feher, J.; Marchesini, G.; Vesely, J. Non-alcoholic fatty liver disease (NAFLD)—A novel common aspect of the metabolic syndrome. Biomed. Pap. Med. Fac. Univ. Palacky Olomouc Czech Repub. 2006, 150, 101–104. [Google Scholar] [CrossRef] [PubMed]
- Ng, C.H.; Chan, K.E.; Chin, Y.H.; Zeng, R.W.; Tsai, P.C.; Lim, W.H.; Tan, D.J.H.; Khoo, C.M.; Goh, L.H.; Ling, Z.J.; et al. The effect of diabetes and prediabetes on the prevalence, complications and mortality in nonalcoholic fatty liver disease. Clin. Mol. Hepatol. 2022, 28, 565–574. [Google Scholar] [CrossRef] [PubMed]
- Younossi, Z.M. Non-alcoholic fatty liver disease—A global public health perspective. J. Hepatol. 2019, 70, 531–544. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.A.; Chang, Y.; Sung, P.S.; Yoon, E.L.; Lee, H.W.; Yoo, J.J.; Lee, Y.S.; An, J.; Song, D.S.; Cho, Y.Y.; et al. Therapeutic mechanisms and beneficial effects of non-antidiabetic drugs in chronic liver diseases. Clin. Mol. Hepatol. 2022, 28, 425–472. [Google Scholar] [CrossRef] [PubMed]
- De Minicis, S.; Day, C.; Svegliati-Baroni, G. From NAFLD to NASH and HCC: Pathogenetic Mechanisms and Therapeutic Insights. Curr. Pharm. Design 2013, 19, 5239–5249. [Google Scholar] [CrossRef]
- Greco, D.; Kotronen, A.; Westerbacka, J.; Puig, O.; Arkkila, P.; Kiviluoto, T.; Laitinen, S.; Kolak, M.; Fisher, R.M.; Hamsten, A.; et al. Gene expression in human NAFLD. Am. J. Physiol. Gastrointest. Liver Physiol. 2008, 294, G1281–G1287. [Google Scholar] [CrossRef]
- Charlton, M.; Viker, K.; Krishnan, A.; Sanderson, S.; Veldt, B.; Kaalsbeek, A.J.; Kendrick, M.; Thompson, G.; Que, F.; Swain, J.; et al. Differential expression of lumican and fatty acid binding protein-1: New insights into the histologic spectrum of nonalcoholic fatty liver disease. Hepatology 2009, 49, 1375–1384. [Google Scholar] [CrossRef]
- Liu, W.Y.; Zhang, X.; Li, G.; Tang, L.J.; Zhu, P.W.; Rios, R.S.; Zheng, K.I.; Ma, H.L.; Wang, X.D.; Pan, Q.; et al. Protective association of Klotho rs495392 gene polymorphism against hepatic steatosis in non-alcoholic fatty liver disease patients. Clin. Mol. Hepatol. 2022, 28, 183–195. [Google Scholar] [CrossRef]
- Almanza, D. RNA Seq Analysis of Non-Alcoholic Fatty Liver Disease (NAFLD) Induced by Metabolic Syndrome in a Mouse Model; University of Massachusetts Boston: Boston, MA, USA, 2016. [Google Scholar]
- Choi, J.Y.; Kim, Y.J.; Ryu, R.; Cho, S.J.; Kwon, E.Y.; Choi, M.S. Effect of Green Tea Extract on Systemic Metabolic Homeostasis in Diet-Induced Obese Mice Determined via RNA-Seq Transcriptome Profiles. Nutrients 2016, 8, 640. [Google Scholar] [CrossRef]
- Liu, Y.; Cheng, F.; Luo, Y.X.; Hu, P.; Ren, H.; Peng, M.L. The role of cytochrome P450 in nonalcoholic fatty liver induced by high-fat diet: A gene expression profile analysis. Zhonghua Gan Zang Bing Za Zhi 2017, 25, 285–290. [Google Scholar]
- Huang, Z.; Wu, L.M.; Zhang, J.L.; Sabri, A.; Wang, S.J.; Qin, G.J.; Guo, C.Q.; Wen, H.T.; Du, B.B.; Zhang, D.H.; et al. Dual Specificity Phosphatase 12 Regulates Hepatic Lipid Metabolism Through Inhibition of the Lipogenesis and Apoptosis Signal-Regulating Kinase 1 Pathways. Hepatology 2019, 70, 1099–1118. [Google Scholar] [CrossRef] [PubMed]
- Park, E.; Park, S.Y.; Cho, I.S.; Kim, B.S.; Schuller-Levis, G. A Novel Cysteine Sulfinic Acid Decarboxylase Knock-Out Mouse: Immune Function (II). Adv. Exp. Med. Biol. 2017, 975 Pt 1, 449–460. [Google Scholar]
- Marcinkiewicz, J.; Schaffer, S.W. Taurine 9. In Advances in Experimental Medicine and Biology, 1st ed.; Springer International Publishing: Cham, Switzerland, 2015; pp. 17–27. [Google Scholar]
- Sidime, F.; Phillips, G.; LaMassa, N.; Park, E.; El Idrissi, A. Glucose Homeostasis and Retinal Histopathology in CSAD KO Mice. Adv. Exp. Med. Biol. 2017, 975 Pt 1, 503–511. [Google Scholar] [PubMed]
- Ahmad, A.; Ali, T.; Kim, M.W.; Khan, A.; Jo, M.H.; Rehman, S.U.; Khan, M.S.; Abid, N.B.; Khan, M.; Ullah, R.; et al. Adiponectin homolog novel osmotin protects obesity/diabetes-induced NAFLD by upregulating AdipoRs/PPARalpha signaling in ob/ob and db/db transgenic mouse models. Metabolism 2019, 90, 31–43. [Google Scholar] [CrossRef] [PubMed]
- Gaggini, M.; Morelli, M.; Buzzigoli, E.; DeFronzo, R.A.; Bugianesi, E.; Gastaldelli, A. Non-alcoholic fatty liver disease (NAFLD) and its connection with insulin resistance, dyslipidemia, atherosclerosis and coronary heart disease. Nutrients 2013, 5, 1544–1560. [Google Scholar] [CrossRef] [PubMed]
- Mantena, S.K.; King, A.L.; Andringa, K.K.; Eccleston, H.B.; Bailey, S.M. Mitochondrial dysfunction and oxidative stress in the pathogenesis of alcohol- and obesity-induced fatty liver diseases. Free Radic. Biol. Med. 2008, 44, 1259–1272. [Google Scholar] [CrossRef] [PubMed]
- Thiagarajan, P.; Aithal, G.P. Drug Development for Nonalcoholic Fatty Liver Disease: Landscape and Challenges. J. Clin. Exp. Hepatol. 2019, 9, 515–521. [Google Scholar] [CrossRef]
- Kaur, S. Potential Therapeutic Targets of Nafld in Offsprings with Respect to Maternal Western Type Diet. Res. J. Life Sci. Bioinform. Pharm. Chem. Sci. 2018, 4, 1–12. [Google Scholar]
- Kawabata, Y.; Nishida, N.; Awata, T.; Kawasaki, E.; Imagawa, A.; Shimada, A.; Osawa, H.; Tanaka, S.; Takahashi, K.; Nagata, M.; et al. Genome-Wide Association Study Confirming a Strong Effect of HLA and Identifying Variants in CSAD/lnc-ITGB7-1 on Chromosome 12q13.13 Associated with Susceptibility to Fulminant Type 1 Diabetes. Diabetes 2019, 68, 665–675. [Google Scholar] [CrossRef]
- Hashimoto, E.; Taniai, M.; Tokushige, K. Characteristics and diagnosis of NAFLD/NASH. J. Gastroenterol. Hepatol. 2013, 28, 64–70. [Google Scholar] [CrossRef]
- Wieckowska, A.; Feldstein, A.E. Diagnosis of Nonalcoholic Fatty Liver Disease: Invasive versus Noninvasive. Semin. Liver Dis. 2008, 28, 386–395. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Park, K.; Lee, H.S.; Park, H.K.; Han, J.H.; Ahn, S.B. The usefulness of metabolic score for insulin resistance for the prediction of incident non-alcoholic fatty liver disease in Korean adults. Clin. Mol. Hepatol. 2022, 28, 814–826. [Google Scholar] [CrossRef] [PubMed]
- Gentile, C.L.; Nivala, A.M.; Gonzales, J.C.; Pfaffenbach, K.T.; Wang, D.; Wei, Y.; Jiang, H.; Orlicky, D.J.; Petersen, D.R.; Pagliassotti, M.J.; et al. Experimental evidence for therapeutic potential of taurine in the treatment of nonalcoholic fatty liver disease. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 301, R1710–R1722. [Google Scholar] [CrossRef] [PubMed]
- Murakami, S.; Ono, A.; Kawasaki, A.; Takenaga, T.; Ito, T. Taurine attenuates the development of hepatic steatosis through the inhibition of oxidative stress in a model of nonalcoholic fatty liver disease in vivo and in vitro. Amino Acids 2018, 50, 1279–1288. [Google Scholar] [CrossRef]
- Zvenigorodskaia, L.A.; Ovsiannikova, O.N.; Noskova, K.K.; Nilova, T.V.; Elizarova, E.P. Taurine in the treatment of non-alcoholic fatty liver disease. Exp. Klin. Gastroenterol. 2010, 7, 43–50. [Google Scholar]
- Peng, K.Y.; Watt, M.J.; Rensen, S.; Greve, J.W.; Huynh, K.; Jayawardana, K.S.; Meikle, P.J.; Meex, R.C.R. Mitochondrial dysfunction-related lipid changes occur in nonalcoholic fatty liver disease progression. J. Lipid Res. 2018, 59, 1977–1986. [Google Scholar] [CrossRef]
- Gao, W.; Du, X.; Lei, L.; Wang, H.; Zhang, M.; Wang, Z.; Li, X.; Liu, G.; Li, X. NEFA-induced ROS impaired insulin signalling through the JNK and p38MAPK pathways in non-alcoholic steatohepatitis. J. Cell. Mol. Med. 2018, 22, 3408–3422. [Google Scholar] [CrossRef]
- Li, X.; Shi, Z.; Zhu, Y.; Shen, T.; Wang, H.; Shui, G.; Loor, J.J.; Fang, Z.; Chen, M.; Wang, X.; et al. Cyanidin-3-O-glucoside improves non-alcoholic fatty liver disease by promoting PINK1-mediated mitophagy in mice. Br. J. Pharmacol. 2020, 177, 3591–3607. [Google Scholar] [CrossRef]
- Kerr, T.A.; Matsumoto, Y.; Matsumoto, H.; Xie, Y.; Hirschberger, L.L.; Stipanuk, M.H.; Anakk, S.; Moore, D.D.; Watanabe, M.; Kennedy, S.; et al. Cysteine sulfinic acid decarboxylase regulation: A role for farnesoid X receptor and small heterodimer partner in murine hepatic taurine metabolism. Hepatol. Res. 2014, 44, E218–E228. [Google Scholar] [CrossRef]
- Ma, H.F.; Zheng, F.; Su, L.J.; Zhang, D.W.; Liu, Y.N.; Li, F.; Zhang, Y.Y.; Gong, S.S.; Kou, J.P. Metabolomic Profiling of Brain Protective Effect of Edaravone on Cerebral Ischemia-Reperfusion Injury in Mice. Front. Pharmacol. 2022, 13, 814942. [Google Scholar] [CrossRef]
- Mahootchi, E.; Raasakka, A.; Luan, W.; Muruganandam, G.; Loris, R.; Haavik, J.; Kursula, P. Structure and substrate specificity determinants of the taurine biosynthetic enzyme cysteine sulphinic acid decarboxylase. J. Struct. Biol. 2021, 213, 107674. [Google Scholar] [CrossRef] [PubMed]
- Santiago-Rolon, A.; Purcell, D.; Rosado, K.; Toro, D.H. A Comparison of Brunt’s Criteria, the Non-Alcoholic Fatty Liver Disease Activity Score (NAS), and a Proposed NAS Scoring that Includes Fibrosis in Non-Alcoholic Fatty Liver Disease Staging. Puerto Rico Health Sci. J. 2015, 34, 189–194. [Google Scholar]
- Mehlem, A.; Hagberg, C.E.; Muhl, L.; Eriksson, U.; Falkevall, A. Imaging of neutral lipids by oil red O for analyzing the metabolic status in health and disease. Nat. Protoc. 2013, 8, 1149–1154. [Google Scholar] [CrossRef] [PubMed]






Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tan, R.; Li, J.; Liu, L.; Wu, Q.; Fan, L.; Ma, N.; Yu, C.; Lu, H.; Zhang, X.; Chen, J.; et al. CSAD Ameliorates Lipid Accumulation in High-Fat Diet-Fed Mice. Int. J. Mol. Sci. 2022, 23, 15931. https://doi.org/10.3390/ijms232415931
Tan R, Li J, Liu L, Wu Q, Fan L, Ma N, Yu C, Lu H, Zhang X, Chen J, et al. CSAD Ameliorates Lipid Accumulation in High-Fat Diet-Fed Mice. International Journal of Molecular Sciences. 2022; 23(24):15931. https://doi.org/10.3390/ijms232415931
Chicago/Turabian StyleTan, Rongrong, Jiayang Li, Lu Liu, Qian Wu, Lei Fan, Ningning Ma, Chuwei Yu, Henglei Lu, Xuemei Zhang, Jing Chen, and et al. 2022. "CSAD Ameliorates Lipid Accumulation in High-Fat Diet-Fed Mice" International Journal of Molecular Sciences 23, no. 24: 15931. https://doi.org/10.3390/ijms232415931
APA StyleTan, R., Li, J., Liu, L., Wu, Q., Fan, L., Ma, N., Yu, C., Lu, H., Zhang, X., Chen, J., Gong, L., & Ren, J. (2022). CSAD Ameliorates Lipid Accumulation in High-Fat Diet-Fed Mice. International Journal of Molecular Sciences, 23(24), 15931. https://doi.org/10.3390/ijms232415931
