miRNAs Participate in the Regulation of Oxidative Stress-Related Gene Expression in Endometrioid Endometrial Cancer
Abstract
1. Introduction
2. Results
2.1. Oxidative Stress-Related Gene Expression Profile Determined by mRNA Microarrays
2.2. PRDX2, PKD2, AQP1, SOD3, KLF2 Expression Profile Determined by RT-qPCR and ELISA
2.3. miRNA Target Prediction
3. Discussion
4. Materials and Methods
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.D.; Mazur, M.; Telser, J. Free Radicals and Antioxidants in Normal Physiological Functions and Human Disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef] [PubMed]
- Genestra, M. Oxyl Radicals, Redox-Sensitive Signalling Cascades and Antioxidants. Cell. Signal. 2007, 19, 1807–1819. [Google Scholar] [CrossRef] [PubMed]
- Valko, M.; Morris, H.; Cronin, M.T.D. Metals, Toxicity and Oxidative Stress. Curr. Med. Chem. 2005, 12, 1161–1208. [Google Scholar] [CrossRef] [PubMed]
- Sharifi-Rad, M.; Anil Kumar, N.V.; Zucca, P.; Varoni, E.M.; Dini, L.; Panzarini, E.; Rajkovic, J.; Tsouh Fokou, P.V.; Azzini, E.; Peluso, I.; et al. Lifestyle, Oxidative Stress, and Antioxidants: Back and Forth in the Pathophysiology of Chronic Diseases. Front. Physiol. 2020, 11, 694. [Google Scholar] [CrossRef] [PubMed]
- Krylatov, A.V.; Maslov, L.N.; Voronkov, N.S.; Boshchenko, A.A.; Popov, S.V.; Gomez, L.; Wang, H.; Jaggi, A.S.; Downey, J.M. Reactive Oxygen Species as Intracellular Signaling Molecules in the Cardiovascular System. Curr. Cardiol. Rev. 2018, 14, 290–300. [Google Scholar] [CrossRef] [PubMed]
- Villalpando-Rodriguez, G.E.; Gibson, S.B. Reactive Oxygen Species (ROS) Regulates Different Types of Cell Death by Acting as a Rheostat. Oxid. Med. Cell. Longev. 2021, 2021, 9912436. [Google Scholar] [CrossRef] [PubMed]
- Canton, M.; Sánchez-Rodríguez, R.; Spera, I.; Venegas, F.C.; Favia, M.; Viola, A.; Castegna, A. Reactive Oxygen Species in Macrophages: Sources and Targets. Front. Immunol. 2021, 12, 734229. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, X.; Vikash, V.; Ye, Q.; Wu, D.; Liu, Y.; Dong, W. ROS and ROS-Mediated Cellular Signaling. Oxid. Med. Cell. Longev. 2016, 2016, 4350965. [Google Scholar] [CrossRef]
- Juan, C.A.; Pérez de la Lastra, J.M.; Plou, F.J.; Pérez-Lebeña, E. The Chemistry of Reactive Oxygen Species (ROS) Revisited: Outlining Their Role in Biological Macromolecules (DNA, Lipids and Proteins) and Induced Pathologies. Int. J. Mol. Sci. 2021, 22, 4642. [Google Scholar] [CrossRef]
- Sies, H. Oxidative Stress: A Concept in Redox Biology and Medicine. Redox Biol. 2015, 4, 180–183. [Google Scholar] [CrossRef]
- Valko, M.; Izakovic, M.; Mazur, M.; Rhodes, C.J.; Telser, J. Role of Oxygen Radicals in DNA Damage and Cancer Incidence. Mol. Cell. Biochem. 2004, 266, 37–56. [Google Scholar] [CrossRef] [PubMed]
- Valko, M.; Rhodes, C.J.; Moncol, J.; Izakovic, M.; Mazur, M. Free Radicals, Metals and Antioxidants in Oxidative Stress-Induced Cancer. Chem. Biol. Interact. 2006, 160, 1–40. [Google Scholar] [CrossRef] [PubMed]
- Hayes, J.D.; Dinkova-Kostova, A.T.; Tew, K.D. Oxidative Stress in Cancer. Cancer Cell 2020, 38, 167–197. [Google Scholar] [CrossRef]
- Kuehne, A.; Emmert, H.; Soehle, J.; Winnefeld, M.; Fischer, F.; Wenck, H.; Gallinat, S.; Terstegen, L.; Lucius, R.; Hildebrand, J.; et al. Acute Activation of Oxidative Pentose Phosphate Pathway as First-Line Response to Oxidative Stress in Human Skin Cells. Mol. Cell 2015, 59, 359–371. [Google Scholar] [CrossRef]
- Kumari, S.; Badana, A.K.; Malla, R. Reactive Oxygen Species: A Key Constituent in Cancer Survival. Biomark. Insights 2018, 13, 1177271918755391. [Google Scholar] [CrossRef] [PubMed]
- Galadari, S.; Rahman, A.; Pallichankandy, S.; Thayyullathil, F. Reactive Oxygen Species and Cancer Paradox: To Promote or to Suppress? Free Radic. Biol. Med. 2017, 104, 144–164. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. 2018, 9, 402. [Google Scholar] [CrossRef]
- Cosentino, G.; Plantamura, I.; Cataldo, A.; Iorio, M.V. MicroRNA and Oxidative Stress Interplay in the Context of Breast Cancer Pathogenesis. Int. J. Mol. Sci. 2019, 20, 5143. [Google Scholar] [CrossRef]
- Xu, Y.; He, X.; Deng, J.; Xiong, L.; Chen, B.; Chen, J.; Zhang, X.; Chen, W.; Liu, X.; Hu, X.; et al. ROS-Related MiRNAs Regulate Immune Response and Chemoradiotherapy Sensitivity in Hepatocellular Carcinoma by Comprehensive Analysis and Experiment. Oxid. Med. Cell. Longev. 2022, 2022, 4713518. [Google Scholar] [CrossRef]
- Yin, M.; Ren, X.; Zhang, X.; Luo, Y.; Wang, G.; Huang, K.; Feng, S.; Bao, X.; Huang, K.; He, X.; et al. Selective Killing of Lung Cancer Cells by MiRNA-506 Molecule through Inhibiting NF-ΚB P65 to Evoke Reactive Oxygen Species Generation and P53 Activation. Oncogene 2015, 34, 691–703. [Google Scholar] [CrossRef]
- Li, X.; Xin, S.; He, Z.; Che, X.; Wang, J.; Xiao, X.; Chen, J.; Song, X. MicroRNA-21 (MiR-21) Post-Transcriptionally Downregulates Tumor Suppressor PDCD4 and Promotes Cell Transformation, Proliferation, and Metastasis in Renal Cell Carcinoma. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2014, 33, 1631–1642. [Google Scholar] [CrossRef] [PubMed]
- Jajoo, S.; Mukherjea, D.; Kaur, T.; Sheehan, K.E.; Sheth, S.; Borse, V.; Rybak, L.P.; Ramkumar, V. Essential Role of NADPH Oxidase-Dependent Reactive Oxygen Species Generation in Regulating MicroRNA-21 Expression and Function in Prostate Cancer. Antioxid. Redox Signal. 2013, 19, 1863–1876. [Google Scholar] [CrossRef] [PubMed]
- Rizzo, S.; Femia, M.; Buscarino, V.; Franchi, D.; Garbi, A.; Zanagnolo, V.; Del Grande, M.; Manganaro, L.; Alessi, S.; Giannitto, C.; et al. Endometrial Cancer: An Overview of Novelties in Treatment and Related Imaging Keypoints for Local Staging. Cancer Imaging Off. Publ. Int. Cancer Imaging Soc. 2018, 18, 45. [Google Scholar] [CrossRef] [PubMed]
- Moore, K.; Brewer, M.A. Endometrial Cancer: Is This a New Disease? Am. Soc. Clin. Oncol. Educ. Book Am. Soc. Clin. Oncol. Annu. Meet. 2017, 37, 435–442. [Google Scholar] [CrossRef] [PubMed]
- Raffone, A.; Travaglino, A.; Raimondo, D.; Neola, D.; Renzulli, F.; Santoro, A.; Insabato, L.; Casadio, P.; Zannoni, G.F.; Zullo, F.; et al. Prognostic Value of Myometrial Invasion and TCGA Groups of Endometrial Carcinoma. Gynecol. Oncol. 2021, 162, 401–406. [Google Scholar] [CrossRef] [PubMed]
- Arfin, S.; Jha, N.K.; Jha, S.K.; Kesari, K.K.; Ruokolainen, J.; Roychoudhury, S.; Rathi, B.; Kumar, D. Oxidative Stress in Cancer Cell Metabolism. Antioxidants 2021, 10, 642. [Google Scholar] [CrossRef]
- Nogueira, V.; Patra, K.C.; Hay, N. Selective Eradication of Cancer Displaying Hyperactive Akt by Exploiting the Metabolic Consequences of Akt Activation. eLife 2018, 7, e32213. [Google Scholar] [CrossRef]
- Yue, D.; Sun, X. Idelalisib Promotes Bim-Dependent Apoptosis through AKT/FoxO3a in Hepatocellular Carcinoma. Cell Death Dis. 2018, 9, 935. [Google Scholar] [CrossRef]
- Ermak, G.; Davies, K.J.A. Calcium and Oxidative Stress: From Cell Signaling to Cell Death. Mol. Immunol. 2002, 38, 713–721. [Google Scholar] [CrossRef]
- Brill, A.L.; Fischer, T.T.; Walters, J.M.; Marlier, A.; Sewanan, L.R.; Wilson, P.C.; Johnson, E.K.; Moeckel, G.; Cantley, L.G.; Campbell, S.G.; et al. Polycystin 2 Is Increased in Disease to Protect against Stress-Induced Cell Death. Sci. Rep. 2020, 10, 386. [Google Scholar] [CrossRef]
- Lemos, F.O.; Ehrlich, B.E. Polycystin and Calcium Signaling in Cell Death and Survival. Cell Calcium 2018, 69, 37–45. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Mu, X.; Yin, Q.; Hu, K. MiR-106a Contributes to Prostate Carcinoma Progression through PTEN. Oncol. Lett. 2019, 17, 1327–1332. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.; Liu, H.-T.; Mei, J.; Ding, F.-B.; Xiao, H.-B.; Hu, F.-Q.; Hu, R.; Wang, M.-S. MiR-106a Promotes Growth and Metastasis of Non-Small Cell Lung Cancer by Targeting PTEN. Int. J. Clin. Exp. Pathol. 2015, 8, 3827–3834. [Google Scholar] [PubMed]
- Li, P.; Xu, Q.; Zhang, D.; Li, X.; Han, L.; Lei, J.; Duan, W.; Ma, Q.; Wu, Z.; Wang, Z. Upregulated MiR-106a Plays an Oncogenic Role in Pancreatic Cancer. FEBS Lett. 2014, 588, 705–712. [Google Scholar] [CrossRef]
- Ma, J.; Wang, W.; Azhati, B.; Wang, Y.; Tusong, H. MiR-106a-5p Functions as a Tumor Suppressor by Targeting VEGFA in Renal Cell Carcinoma. Dis. Markers 2020, 2020, 8837941. [Google Scholar] [CrossRef]
- Huang, Q.; Ma, Q. MicroRNA-106a Inhibits Cell Proliferation and Induces Apoptosis in Colorectal Cancer Cells. Oncol. Lett. 2018, 15, 8941–8944. [Google Scholar] [CrossRef]
- Tang, W.; Li, J.; Liu, H.; Zhou, F.; Liu, M. MiR-106a Promotes Tumor Growth, Migration, and Invasion by Targeting BCL2L11 in Human Endometrial Adenocarcinoma. Am. J. Transl. Res. 2017, 9, 4984–4993. [Google Scholar]
- Li, X.; Yi, X.; Bie, C.; Wang, Z. Expression of MiR-106 in Endometrial Carcinoma RL95-2 Cells and Effect on Proliferation and Invasion of Cancer Cells. Oncol. Lett. 2018, 16, 2251–2254. [Google Scholar] [CrossRef]
- Boren, T.; Xiong, Y.; Hakam, A.; Wenham, R.; Apte, S.; Wei, Z.; Kamath, S.; Chen, D.-T.; Dressman, H.; Lancaster, J.M. MicroRNAs and Their Target Messenger RNAs Associated with Endometrial Carcinogenesis. Gynecol. Oncol. 2008, 110, 206–215. [Google Scholar] [CrossRef]
- Chung, T.K.H.; Cheung, T.-H.; Huen, N.-Y.; Wong, K.W.Y.; Lo, K.W.K.; Yim, S.-F.; Siu, N.S.S.; Wong, Y.-M.; Tsang, P.-T.; Pang, M.-W.; et al. Dysregulated MicroRNAs and Their Predicted Targets Associated with Endometrioid Endometrial Adenocarcinoma in Hong Kong Women. Int. J. Cancer 2009, 124, 1358–1365. [Google Scholar] [CrossRef]
- Donkers, H.; Bekkers, R.; Galaal, K. Diagnostic Value of MicroRNA Panel in Endometrial Cancer: A Systematic Review. Oncotarget 2020, 11, 2010–2023. [Google Scholar] [CrossRef] [PubMed]
- Hiroki, E.; Akahira, J.-I.; Suzuki, F.; Nagase, S.; Ito, K.; Suzuki, T.; Sasano, H.; Yaegashi, N. Changes in MicroRNA Expression Levels Correlate with Clinicopathological Features and Prognoses in Endometrial Serous Adenocarcinomas. Cancer Sci. 2010, 101, 241–249. [Google Scholar] [CrossRef] [PubMed]
- Tsukamoto, O.; Miura, K.; Mishima, H.; Abe, S.; Kaneuchi, M.; Higashijima, A.; Miura, S.; Kinoshita, A.; Yoshiura, K.; Masuzaki, H. Identification of Endometrioid Endometrial Carcinoma-Associated MicroRNAs in Tissue and Plasma. Gynecol. Oncol. 2014, 132, 715–721. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Yang, N. MicroRNA-20a-5p Inhibits Epithelial to Mesenchymal Transition and Invasion of Endometrial Cancer Cells by Targeting STAT3. Int. J. Clin. Exp. Pathol. 2018, 11, 5715–5724. [Google Scholar] [PubMed]
- Qiu, Z.-A.; He, G.-P. MicroRNA-134 Functions as a Tumor Suppressor Gene in Gastric Cancer. Am. J. Transl. Res. 2016, 8, 4320–4328. [Google Scholar]
- Yuan, Y.; Wang, Q.; Cao, F.; Han, B.; Xu, L. MiRNA-134 Suppresses Esophageal Squamous Cell Carcinoma Progression by Targeting FOXM1. Int. J. Clin. Exp. Pathol. 2019, 12, 2130–2138. [Google Scholar]
- Xie, Y.; Song, J.; Zong, Q.; Wang, A.; Yang, Y.; Liu, F.; Meng, X. Decreased Expression of MIR-134 and Its Clinical Significance in Human Colorectal Cancer. Hepatogastroenterology 2015, 62, 615–619. [Google Scholar]
- Cao, D.; Di, M.; Liang, J.; Shi, S.; Tan, Q.; Wang, Z. MicroRNA-183 in Cancer Progression. J. Cancer 2020, 11, 1315–1324. [Google Scholar] [CrossRef]
- Mira, E.; Carmona-Rodríguez, L.; Pérez-Villamil, B.; Casas, J.; Fernández-Aceñero, M.J.; Martínez-Rey, D.; Martín-González, P.; Heras-Murillo, I.; Paz-Cabezas, M.; Tardáguila, M.; et al. SOD3 Improves the Tumor Response to Chemotherapy by Stabilizing Endothelial HIF-2α. Nat. Commun. 2018, 9, 575. [Google Scholar] [CrossRef]
- Wang, X.; Xia, Y. MicroRNA-328 Inhibits Cervical Cancer Cell Proliferation and Tumorigenesis by Targeting TCF7L2. Biochem. Biophys. Res. Commun. 2016, 475, 169–175. [Google Scholar] [CrossRef]
- Ma, W.; Ma, C.-N.; Zhou, N.-N.; Li, X.-D.; Zhang, Y.-J. Up- Regulation of MiR-328-3p Sensitizes Non-Small Cell Lung Cancer to Radiotherapy. Sci. Rep. 2016, 6, 31651. [Google Scholar] [CrossRef]
- Wang, C.; Wang, S.; Ma, F.; Zhang, W. MiRNA-328 Overexpression Confers Cisplatin Resistance in Non-small Cell Lung Cancer via Targeting of PTEN. Mol. Med. Rep. 2018, 18, 4563–4570. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.; You, Y.; Wu, Y.; Wang, M.; He, Q.; Zhou, X.; Chen, L.; Sun, X.; Liu, Y.; Fu, X.; et al. Overexpression of MiR-328-5p Influences Cell Growth and Migration to Promote NSCLC Progression by Targeting LOXL4. Ann. Transl. Med. 2022, 10, 301. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Liang, J.; Xu, M.; Wu, Z.; Cheng, W.; Wu, J. Identification of an Eleven-MiRNA Signature to Predict the Prognosis of Endometrial Cancer. Bioengineered 2021, 12, 4201–4216. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Geng, J.; Tan, W. MiR-363-3p Suppresses Tumor Growth and Metastasis of Colorectal Cancer via Targeting SphK2. Biomed. Pharmacother. Biomedecine Pharmacother. 2018, 105, 922–931. [Google Scholar] [CrossRef]
- Song, B.; Yan, J.; Liu, C.; Zhou, H.; Zheng, Y. Tumor Suppressor Role of MiR-363-3p in Gastric Cancer. Med. Sci. Monit. Int. Med. J. Exp. Clin. Res. 2015, 21, 4074–4080. [Google Scholar] [CrossRef]
- Dabravolski, S.A.; Sukhorukov, V.N.; Kalmykov, V.A.; Grechko, A.V.; Shakhpazyan, N.K.; Orekhov, A.N. The Role of KLF2 in the Regulation of Atherosclerosis Development and Potential Use of KLF2-Targeted Therapy. Biomedicines 2022, 10, 254. [Google Scholar] [CrossRef]
- Wang, H.-G.; Cao, B.; Zhang, L.-X.; Song, N.; Li, H.; Zhao, W.-Z.; Li, Y.-S.; Ma, S.-M.; Yin, D.-J. KLF2 Inhibits Cell Growth via Regulating HIF-1α/Notch-1 Signal Pathway in Human Colorectal Cancer HCT116 Cells. Oncol. Rep. 2017, 38, 584–590. [Google Scholar] [CrossRef][Green Version]
- Li, W.; Sun, M.; Zang, C.; Ma, P.; He, J.; Zhang, M.; Huang, Z.; Ding, Y.; Shu, Y. Upregulated Long Non-Coding RNA AGAP2-AS1 Represses LATS2 and KLF2 Expression through Interacting with EZH2 and LSD1 in Non-Small-Cell Lung Cancer Cells. Cell Death Dis. 2016, 7, e2225. [Google Scholar] [CrossRef]
- Wang, B.; Liu, M.; Song, Y.; Li, C.; Zhang, S.; Ma, L. KLF2 Inhibits the Migration and Invasion of Prostate Cancer Cells by Downregulating MMP2. Am. J. Mens Health 2019, 13, 1557988318816907. [Google Scholar] [CrossRef]
- Mu, Z.M.; Yin, X.Y.; Prochownik, E.V. Pag, a Putative Tumor Suppressor, Interacts with the Myc Box II Domain of c-Myc and Selectively Alters Its Biological Function and Target Gene Expression. J. Biol. Chem. 2002, 277, 43175–43184. [Google Scholar] [CrossRef] [PubMed]
- Yo, Y.D.; Chung, Y.M.; Park, J.K.; Ahn, C.M.; Kim, S.K.; Kim, H.J. Synergistic Effect of Peroxiredoxin II Antisense on Cisplatin-Induced Cell Death. Exp. Mol. Med. 2002, 34, 273–277. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.; Fu, Z.; Guo, J.; Lu, W.; Wen, K.; Chen, W.; Wang, H.; Wei, J.; Zhang, S. Overexpression of Peroxiredoxin 2 Inhibits TGF-Β1-Induced Epithelial-Mesenchymal Transition and Cell Migration in Colorectal Cancer. Mol. Med. Rep. 2014, 10, 867–873. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zheng, X.; Wei, J.; Li, W.; Li, X.; Wang, W.; Guo, J.; Fu, Z. PRDX2 Removal Inhibits the Cell Cycle and Autophagy in Colorectal Cancer Cells. Aging 2020, 12, 16390–16409. [Google Scholar] [CrossRef]
- Chen, Y.; Yang, S.; Zhou, H.; Su, D. PRDX2 Promotes the Proliferation and Metastasis of Non-Small Cell Lung Cancer In Vitro and In Vivo. BioMed Res. Int. 2020, 2020, 8359860. [Google Scholar] [CrossRef]
- Tomita, Y.; Dorward, H.; Yool, A.J.; Smith, E.; Townsend, A.R.; Price, T.J.; Hardingham, J.E. Role of Aquaporin 1 Signalling in Cancer Development and Progression. Int. J. Mol. Sci. 2017, 18, 299. [Google Scholar] [CrossRef]
- Ji, Y.; Liao, X.; Jiang, Y.; Wei, W.; Yang, H. Aquaporin 1 Knockdown Inhibits Triple-Negative Breast Cancer Cell Proliferation and Invasion In Vitro and In Vivo. Oncol. Lett. 2021, 21, 437. [Google Scholar] [CrossRef]
- Yamazato, Y.; Shiozaki, A.; Ichikawa, D.; Kosuga, T.; Shoda, K.; Arita, T.; Konishi, H.; Komatsu, S.; Kubota, T.; Fujiwara, H.; et al. Aquaporin 1 Suppresses Apoptosis and Affects Prognosis in Esophageal Squamous Cell Carcinoma. Oncotarget 2018, 9, 29957–29974. [Google Scholar] [CrossRef][Green Version]
- Huo, Z.; Lomora, M.; Kym, U.; Palivan, C.; Holland-Cunz, S.G.; Gros, S.J. AQP1 Is Up-Regulated by Hypoxia and Leads to Increased Cell Water Permeability, Motility, and Migration in Neuroblastoma. Front. Cell Dev. Biol. 2021, 9, 605272. [Google Scholar] [CrossRef]
- Stelzer, G.; Rosen, N.; Plaschkes, I.; Zimmerman, S.; Twik, M.; Fishilevich, S.; Stein, T.I.; Nudel, R.; Lieder, I.; Mazor, Y.; et al. The GeneCards Suite: From Gene Data Mining to Disease Genome Sequence Analyses. Curr. Protoc. Bioinform. 2016, 54, 1.30.1–1.30.33. [Google Scholar] [CrossRef]
- Safran, M.; Rosen, N.; Twik, M.; BarShir, R.; Stein, T.I.; Dahary, D.; Fishilevich, S.; Lancet, D. The GeneCards Suite. In Practical Guide to Life Science Databases; Abugessaisa, I., Kasukawa, T., Eds.; Springer Nature: Singapore, 2021; pp. 27–56. ISBN 9789811658129. [Google Scholar]
- Mi, H.; Thomas, P. PANTHER Pathway: An Ontology-Based Pathway Database Coupled with Data Analysis Tools. Methods Mol. Biol. Clifton NJ 2009, 563, 123–140. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, X. MiRDB: An Online Database for Prediction of Functional MicroRNA Targets. Nucleic Acids Res. 2020, 48, D127–D131. [Google Scholar] [CrossRef] [PubMed]
Biological Process | Number of Genes | Fold Change | Gene Symbol | p-Value |
---|---|---|---|---|
cellular response to reactive oxygen species | 5 | 58.66 | PRDX2, PKD2, AQP1, SOD3, KLF2 | 0.0002 |
response to reactive oxygen species | 6 | 49.31 | PRDX2, PKD2, AQP1, SOD3, KLF2, TXNIP | <0.0001 |
response to oxygen-containing compound | 13 | 11.50 | PRDX2, PKD2, AQP1, SOD3, KLF2, TXNIP, KCNMA1, ATP2B4, CYBA, SNCA, THBS1, FOXO1, PRNP | <0.0001 |
response to oxidative stress | 10 | 37.40 | PRDX2, PKD2, AQP1, SOD3, KLF2, TXNIP, SNCA, FOXO1, PRNP, MELK | <0.0001 |
cellular response to oxidative stress | 8 | 49.46 | PRDX2, PKD2, AQP1, SOD3, KLF2, SNCA, FOXO1, MELK | <0.0001 |
cellular response to chemical stress | 8 | 40.22 | PRDX2, PKD2, AQP1, SOD3, KLF2, SNCA, FOXO1, MELK | <0.0001 |
cellular response to oxygen-containing compound | 10 | 12.96 | PRDX2, PKD2, AQP1, SOD3, KLF2, ATP2B4, CYBA, SNCA, FOXO1, PRNP | <0.0001 |
ID | mRNA | Fold Change | ||
---|---|---|---|---|
G1 vs. C | G2 vs. C | G3 vs. C | ||
207542_s_at | AQP1 | 3.77 | 5.05 | 3.54 |
209047_at | AQP1 | 2.9 | 4.39 | 2.01 |
212135_s_at | ATP2B4 | −2.77 | −3.55 | −4.59 |
212136_at | ATP2B4 | −3.43 | −3.66 | −3.48 |
203028_s_at | CYBA | 2.23 | 3.26 | 2.98 |
202723_s_at | FOXO1 | −5.1 | −8.03 | −7.99 |
202724_s_at | FOXO1 | −3.27 | −5.4 | −3.89 |
221583_s_at | KCNMA1 | −6.41 | −6.43 | −5.65 |
221584_s_at | KCNMA1 | −17.35 | −18.23 | −11.35 |
219371_s_at | KLF2 | −2.66 | −5.13 | −3.25 |
204825_at | MELK | 3.17 | 3.84 | 3.07 |
203688_at | PKD2 | 2.26 | 3.61 | 3.75 |
39729_at | PRDX2 | 2.61 | 3.18 | 2.45 |
201300_s_at | PRNP | −2.89 | −8.14 | −4.09 |
215707_s_at | PRNP | −2.2 | −3.75 | −4.25 |
204466_s_at | SNCA | −2.42 | −4.62 | −4.29 |
205236_x_at | SOD3 | −2.47 | −2.15 | −2.49 |
201108_s_at | THBS1 | −2.4 | −3.57 | −5.01 |
201009_s_at | TXNIP | −2.16 | −3.58 | −4.27 |
Gene | Group | mRNA Copies/μg Total RNA | Kruskal–Wallis Test | Dunn’s Test | ||
---|---|---|---|---|---|---|
Me | Q1 | Q3 | ||||
PRDX2 | C | 22,980 | 20,343 | 25,632 | <0.001 | G1 vs. C, p < 0.001 G2 vs. C, p < 0.001 G3 vs. C, p < 0.001 G2 vs. G1, p = 0.014 |
G1 | 41,321 | 39,469 | 44,499 | |||
G2 | 51,326 | 49,250 | 56,410 | |||
G3 | 46,452 | 39,820 | 48,895 | |||
PKD2 | C | 19,340 | 15,375 | 22,048 | <0.001 | G1 vs. C, p = 0.001 G2 vs. C, p < 0.001 G3 vs. C, p < 0.001 G3 vs. G1, p = 0.003 |
G1 | 32,501 | 29,793 | 38,531 | |||
G2 | 43,033 | 38,637 | 48,262 | |||
G3 | 49,906 | 46,579 | 58,913 | |||
AQP1 | C | 7804 | 5050 | 10,637 | <0.001 | G1 vs. C, p = 0.001 G2 vs. C, p < 0.001 G3 vs. C, p < 0.001 |
G1 | 12,230 | 9278 | 16,038 | |||
G2 | 14,683 | 10,713 | 17,373 | |||
G3 | 15,923 | 10,938 | 18,431 | |||
SOD3 | C | 48,162 | 41,268 | 51,671 | <0.001 | G2 vs. C, p < 0.001 G3 vs. C, p < 0.001 G2 vs. C, p < 0.001 |
G1 | 15,368 | 12,215 | 17,756 | |||
G2 | 11,203 | 9825 | 14,341 | |||
G3 | 11,823 | 8284 | 18,383 | |||
KLF2 | C | 82,257 | 77,981 | 87,367 | <0.001 | G1 vs. C, p = 0.001 G2 vs. C, p < 0.001 G3 vs. C, p < 0.001 G3 vs. G1, p = 0.005 |
G1 | 19,671 | 18,163 | 23,383 | |||
G2 | 13,900 | 9285 | 17,330 | |||
G3 | 8900 | 3908 | 10,063 |
Concentration of Protein [ng/mL] | C | G1 | G2 | G3 |
---|---|---|---|---|
PRDX2 | 0.45 ± 0.27 | 0.92 ± 0.12 * | 1.01 ± 0.08 * | 0.97 ± 0.08 * |
PKD2 | 6.63 ± 1 | 9.06 ± 1.32 * | 10.7 ± 1.32 * | 11.1 ± 1.44 *,# |
AQP1 | 5.23 ± 0.73 | 6.90 ± 1.42 | 8.21 ± 0.90 * | 8.20 ± 1.03 * |
SOD3 | 138.85 ± 14.8 | 69.2 ± 9.66 | 45.1 ± 6.19 * | 32.0 ± 9.46 *,# |
KLF2 | 5.79 ± 0.68 | 2.83 ± 0.36 * | 2.52 ± 0.50 * | 2.16 ± 0.64 * |
mRNA | Expression | miRNA | Fold Change | ||
---|---|---|---|---|---|
G1 vs. C | G2 vs. C | G3 vs. C | |||
PKD2 | upregulated | miR-106a | 9.33 * | 1.1 | 1.91 |
miR-195-3p | −2.1 * | −1.52 | −1.67 | ||
miR-20a | −25.77 * | −1.01 | 1.06 | ||
miR-134 | −3.15 | −6.02 * | −16.07 * | ||
miR-183 | −1.49 | −6.02 * | 79.9 * | ||
SOD3 | downregulated | miR-328 | 7.74 * | 1.87 | 1.24 |
miR-363 | −1.21 | 2.14 | 34.47 * | ||
KLF2 | downregulated | miR-195-3p | −2.1 * | −1.52 | −1.67 |
miR-363 | −1.21 | 2.14 | 34.47 * |
mRNA | RT-qPCR Amplification Primers (5′-3′) |
---|---|
PRDX2 | Forward: CCTTCCAGTACACAGACGAGCA Reverse: CTCACTATCCGTTAGCCAGCCT |
PKD2 | Forward: AAATGTCTGGCTGGACCGAGGA Reverse: GGAATCACACCACCTGTTGCTG |
AQP1 | Forward: TATGCGTGCTGGCTACTACCGA Reverse: GGTTAATCCCACAGCCAGTGTAG |
SOD3 | Forward: ACGCTGGCGAGGACGACCTG Reverse: GCTTCTTGCGCTCTGAGTGCTC |
ACTB | Forward: TCACCCACACTGTGCCCATCTACGA Reverse: CAGCGGAACCGCTCATTGCCAATGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mieszczański, P.; Januszyk, S.; Zmarzły, N.; Ossowski, P.; Dziobek, K.; Sagan, D.; Boroń, D.; Opławski, M.; Grabarek, B.O. miRNAs Participate in the Regulation of Oxidative Stress-Related Gene Expression in Endometrioid Endometrial Cancer. Int. J. Mol. Sci. 2022, 23, 15817. https://doi.org/10.3390/ijms232415817
Mieszczański P, Januszyk S, Zmarzły N, Ossowski P, Dziobek K, Sagan D, Boroń D, Opławski M, Grabarek BO. miRNAs Participate in the Regulation of Oxidative Stress-Related Gene Expression in Endometrioid Endometrial Cancer. International Journal of Molecular Sciences. 2022; 23(24):15817. https://doi.org/10.3390/ijms232415817
Chicago/Turabian StyleMieszczański, Paweł, Szmon Januszyk, Nikola Zmarzły, Piotr Ossowski, Konrad Dziobek, Dorota Sagan, Dariusz Boroń, Marcin Opławski, and Beniamin Oskar Grabarek. 2022. "miRNAs Participate in the Regulation of Oxidative Stress-Related Gene Expression in Endometrioid Endometrial Cancer" International Journal of Molecular Sciences 23, no. 24: 15817. https://doi.org/10.3390/ijms232415817
APA StyleMieszczański, P., Januszyk, S., Zmarzły, N., Ossowski, P., Dziobek, K., Sagan, D., Boroń, D., Opławski, M., & Grabarek, B. O. (2022). miRNAs Participate in the Regulation of Oxidative Stress-Related Gene Expression in Endometrioid Endometrial Cancer. International Journal of Molecular Sciences, 23(24), 15817. https://doi.org/10.3390/ijms232415817