Tryptamine, a Microbial Metabolite in Fermented Rice Bran Suppressed Lipopolysaccharide-Induced Inflammation in a Murine Macrophage Model
Abstract
1. Introduction
2. Results
2.1. Non-Fermented Rice Bran (RB) and FRB Ameliorate Lipopolysaccharide (LPS)-Induced Pro-Inflammatory Cytokine Expression
2.2. Solvent-Based Fractionation of FRB
2.3. Solid-Phase Fractionation of FRB
2.4. Tryptophan Microbial Metabolites in FRB
2.5. FRBE Anti-Inflammatory Capacity Is Dependent on Aryl Hydrocarbon Receptor (AHR) Activity
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. The First Stage of Extraction and Fractionation of Compounds in FRB
4.3. The Second Stage of Fractionation and Isolation of Active Compounds in FRB
4.4. Maintenance and Treatment of RAW 264.7 Cells
4.5. High-Performance Liquid Chromatography (HPLC) Analysis for Tryptophan and Its Microbial Metabolites
4.6. Quantitative Reverse Transcriptase Mediated Polymerase Chain Reaction (qRT-PCR)
4.7. Isolation of Mouse Intraperitoneal Macrophages
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Josefs, T.; Barrett, T.J.; Brown, E.J.; Quezada, A.; Wu, X.; Voisin, M.; Amengual, J.; Fisher, E.A. Neutrophil extracellular traps promote macrophage inflammation and impair atherosclerosis resolution in diabetic mice. JCI Insight 2020, 5, e134796. [Google Scholar] [CrossRef] [PubMed]
- van Diepen, J.A.; Robben, J.H.; Hooiveld, G.J.; Carmone, C.; Alsady, M.; Boutens, L.; Bekkenkamp-Grovenstein, M.; Hijmans, A.; Engelke, U.F.H.; Wevers, R.A.; et al. SUCNR1-mediated chemotaxis of macrophages aggravates obesity-induced inflammation and diabetes. Diabetologia 2017, 60, 1304–1313. [Google Scholar] [CrossRef] [PubMed]
- Rusbana, T.B.; Agista, A.Z.; Saputra, W.D.; Ohsaki, Y.; Watanabe, K.; Ardiansyah, A.; Budijanto, S.; Koseki, T.; Aso, H.; Komai, M.; et al. Supplementation with Fermented Rice Bran Attenuates Muscle Atrophy in a Diabetic Rat Model. Nutrients 2020, 12, 2409. [Google Scholar] [CrossRef]
- Islam, J.; Koseki, T.; Watanabe, K.; Ardiansyah; Budijanto, S.; Oikawa, A.; Alauddin, M.; Goto, T.; Aso, H.; Komai, M.; et al. Dietary supplementation of fermented rice bran effectively alleviates dextran sodium sulfate-induced colitis in mice. Nutrients 2017, 9, 747. [Google Scholar] [CrossRef] [PubMed]
- Scrivo, R.; Vasile, M.; Bartosiewicz, I.; Valesini, G. Inflammation as “common soil” of the multifactorial diseases. Autoimmun. Rev. 2011, 10, 369–374. [Google Scholar] [CrossRef] [PubMed]
- Hartupee, J.; Mann, D.L. Role of inflammatory cells in fibroblast activation. J. Mol. Cell. Cardiol. 2016, 93, 143–148. [Google Scholar] [CrossRef] [PubMed]
- Frangogiannis, N.G. Cell biological mechanisms in regulation of the post-infarction inflammatory response. Curr. Opin. Physiol. 2018, 1, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Maslowski, K.M.; Vieira, A.T.; Ng, A.; Kranich, J.; Sierro, F.; Yu, D.; Schilter, H.C.; Rolph, M.S.; Mackay, F.; Artis, D.; et al. Regulation of inflammatory responses by gut microbiota and chemoattractant receptor GPR43. Nature 2009, 461, 1282–1286. [Google Scholar] [CrossRef]
- Tomita, K.; Freeman, B.L.; Bronk, S.F.; Lebrasseur, N.K.; White, T.A.; Hirsova, P.; Ibrahim, S.H. CXCL10-Mediates Macrophage, but not Other Innate Immune Cells-Associated Inflammation in Murine Nonalcoholic Steatohepatitis. Sci. Rep. 2016, 6, 28786. [Google Scholar] [CrossRef]
- Wang, C.; Petriello, M.C.; Zhu, B.; Hennig, B. PCB 126 induces monocyte/macrophage polarization and inflammation through AhR and NF-κB pathways. Toxicol. Appl. Pharmacol. 2019, 367, 71–81. [Google Scholar] [CrossRef]
- Luo, D.; Guo, Y.; Cheng, Y.; Zhao, J.; Wang, Y.; Rong, J. Natural product celastrol suppressed macrophage M1 polarization against inflammation in diet-induced obese mice via regulating Nrf2/HO-1, MAP kinase and NF-κB pathways. Aging 2017, 9, 2069–2082. [Google Scholar] [CrossRef]
- Hefnawy, H.T.M.; El-shourbagy, G. A Chemical Analysis and Antioxidant Activity of Polysaccharide Extracted from Rice Bran. World J. Dairy Food Sci. 2014, 9, 95–104. [Google Scholar] [CrossRef]
- Dapar, M.L.G.; Garzon, J.F.; Demayo, C.G. Cytotoxic activity and Antioxidant Potentials of hexane and Methanol extracts of IR64 Rice bran against Human Lung (A549) and Colon (HCT116) Carcinomas. Int. Res. J. Biol. Sci. 2013, 2, 19–23. [Google Scholar]
- Itharat, A.; Uttama, S.; Makchuchit, S. Anti-Inflammatory Activities of Constituents in Sang Yod Rice Extracts, γ-Oryzanol, Vitamins E, B1, B2 and B3, Using Inhibitory Effects on Nitric Oxide (NO) Production in Lipopolysaccharide (LPS) Activated RAW 264.7 Murine Macrophage Cells. Med. Aromat. Plants 2016, 5, 3–8. [Google Scholar] [CrossRef]
- Justo, M.L.; Candiracci, M.; Dantas, A.P.; de Sotomayor, M.A.; Parrado, J.; Vila, E.; Herrera, M.D.; Rodriguez-Rodriguez, R. Rice bran enzymatic extract restores endothelial function and vascular contractility in obese rats by reducing vascular inflammation and oxidative stress. J. Nutr. Biochem. 2013, 24, 1453–1461. [Google Scholar] [CrossRef]
- Nagendra Prasad, M.N.; Sanjay, K.R.; Shravy Khatokar, M.; Vismaya, M.N.; Najunda Swamy, S. Health Benefits of Rice Bran —A Review. J. Nutr. Food Sci. 2011, 1, 1000108. [Google Scholar] [CrossRef]
- de Castro Oliveira, M.G.; Bassinello, P.Z.; da Silva Lobo, V.L.; Rinaldi, M.M. Stability and microbiological quality of rice bran subjected to different heat treatments. Food Sci. Technol. 2012, 32, 725–733. [Google Scholar] [CrossRef]
- Satter, M.A.; Ara, H.; Jabin, S.A.; Abedin, N.; Azad, A.K.; Hossain, A.; Ara, U. Nutritional Composition and Stabilization of Local Variety Rice Bran BRRI-28. Int. J. Sci. Technol. 2014, 3, 306–313. [Google Scholar]
- Kum, S.-J.; Yang, S.-O.; Lee, S.M.; Chang, P.-S.; Choi, Y.H.; Lee, J.J.; Hurh, B.S.; Kim, Y.-S. Effects of aspergillus species inoculation and their enzymatic activities on the formation of volatile components in fermented soybean paste (doenjang). J. Agric. Food Chem. 2015, 63, 1401–1418. [Google Scholar] [CrossRef]
- Futagami, T.; Mori, K.; Wada, S.; Ida, H.; Kajiwara, Y.; Takashita, H.; Tashiro, K.; Yamada, O.; Omori, T.; Kuhara, S.; et al. Transcriptomic analysis of temperature responses of Aspergillus kawachii during barley koji production. Appl. Environ. Microbiol. 2015, 81, 1353–1363. [Google Scholar] [CrossRef]
- Ramos, C.L.; Thorsen, L.; Schwan, R.F.; Jespersen, L. Strain-specific probiotics properties of Lactobacillus fermentum, Lactobacillus plantarum and Lactobacillus brevis isolates from Brazilian food products. Food Microbiol. 2013, 36, 22–29. [Google Scholar] [CrossRef]
- Erkkilä, S.; Suihko, M.-L.; Eerola, S.; Petäjä, E.; Mattila-Sandholm, T. Dry sausage fermented by Lactobacillus rhamnosus strains. Int. J. Food Microbiol. 2001, 64, 205–210. [Google Scholar] [CrossRef]
- Moslehishad, M.; Ehsani, M.R.; Salami, M.; Mirdamadi, S.; Ezzatpanah, H.; Naslaji, A.N.; Moosavi-Movahedi, A.A. The comparative assessment of ACE-inhibitory and antioxidant activities of peptide fractions obtained from fermented camel and bovine milk by Lactobacillus rhamnosus PTCC 1637. Int. Dairy J. 2013, 29, 82–87. [Google Scholar] [CrossRef]
- Villena, J.; Chiba, E.; Tomosada, Y.; Salva, S.; Marranzino, G.; Kitazawa, H.; Alvarez, S. Orally administered Lactobacillus rhamnosus modulates the respiratory immune response triggered by the viral pathogen-associated molecular pattern poly(I:C). BMC Immunol. 2012, 13, 53. [Google Scholar] [CrossRef]
- Zommiti, M.; Cambronel, M.; Maillot, O.; Barreau, M.; Sebei, K.; Feuilloley, M.; Ferchichi, M.; Connil, N. Evaluation of probiotic properties and safety of Enterococcus faecium isolated from artisanal Tunisian Meat “Dried Ossban”. Front. Microbiol. 2018, 9, 1685. [Google Scholar] [CrossRef]
- Alauddin, M.; Shirakawa, H.; Koseki, T.; Kijima, N.; Ardiansyah, N.; Budijanto, S.; Islam, J.; Goto, T.; Komai, M. Fermented rice bran supplementation mitigates metabolic syndrome in stroke-prone spontaneously hypertensive rats. BMC Complement. Altern. Med. 2016, 16, 442. [Google Scholar] [CrossRef] [PubMed]
- Agista, A.; Rusbana, T.; Islam, J.; Ohsaki, Y.; Sultana, H.; Hirakawa, R.; Watanabe, K.; Nochi, T.; Ardiansyah; Budijanto, S.; et al. Fermented rice bran supplementation prevents the development of intestinal fibrosis due to DSS-induced inflammation in mice. Nutrients 2021, 13, 1869. [Google Scholar] [CrossRef] [PubMed]
- Islam, J.; Agista, A.Z.; Watanabe, K.; Nochi, T.; Aso, H.; Ohsaki, Y.; Koseki, T.; Komai, M.; Shirakawa, H. Fermented rice bran supplementation attenuates chronic colitis-associated extraintestinal manifestations in female C57BL/6N mice. J. Nutr. Biochem. 2022, 99, 108855. [Google Scholar] [CrossRef]
- Islam, J.; Sato, S.; Watanabe, K.; Watanabe, T.; Ardiansyah; Hirahara, K.; Aoyama, Y.; Tomita, S.; Aso, H.; Komai, M.; et al. Dietary tryptophan alleviates dextran sodium sulfate-induced colitis through aryl hydrocarbon receptor in mice. J. Nutr. Biochem. 2017, 42, 43–50. [Google Scholar] [CrossRef]
- Krishnan, S.; Ding, Y.; Saedi, N.; Choi, M.; Sridharan, G.V.; Sherr, D.H.; Yarmush, M.L.; Alaniz, R.C.; Jayaraman, A.; Lee, K. Gut Microbiota-Derived Tryptophan Metabolites Modulate Inflammatory Response in Hepatocytes and Macrophages. Cell Rep. 2018, 23, 1099–1111. [Google Scholar] [CrossRef]
- Bergander, L.V.; Cai, W.; Klocke, B.; Seifert, M.; Pongratz, I. Tryptamine serves as a proligand of the AhR transcriptional pathway whose activation is dependent of monoamine oxidases. Mol. Endocrinol. 2012, 26, 1542–1551. [Google Scholar] [CrossRef] [PubMed]
- Hubbard, T.D.; Murray, I.A.; Perdew, G.H. Special section on drug metabolism and the microbiome—Minireview indole and tryptophan metabolism: Endogenous and dietary routes to ah receptor activation. Drug Metab. Dispos. 2015, 43, 1522–1535. [Google Scholar] [CrossRef] [PubMed]
- Goettel, J.A.; Gandhi, R.; Kenison, J.E.; Yeste, A.; Murugaiyan, G.; Sambanthamoorthy, S.; Griffith, A.E.; Patel, B.; Shouval, D.S.; Weiner, H.L.; et al. AHR Activation Is Protective against Colitis Driven by T Cells in Humanized Mice. Cell Rep. 2016, 17, 1318–1329. [Google Scholar] [CrossRef] [PubMed]
- Qiu, J.; Guo, X.; Chen, Z.-M.E.; He, L.; Sonnenberg, G.F.; Artis, D.; Fu, Y.-X.; Zhou, L. Group 3 innate lymphoid cells inhibit T-cell-mediated intestinal inflammation through aryl hydrocarbon receptor signaling and regulation of microflora. Immunity 2013, 39, 386–399. [Google Scholar] [CrossRef]
- Zhu, J.; Luo, L.; Tian, L.; Yin, S.; Ma, X.; Cheng, S.; Tang, W.; Yu, J.; Ma, W.; Zhou, X.; et al. Aryl hydrocarbon receptor promotes IL-10 expression in inflammatory macrophages through Src-STAT3 signaling pathway. Front. Immunol. 2018, 9, 2033. [Google Scholar] [CrossRef]
- Akihisa, T.; Yasukawa, K.; Yamaura, M.; Ukiya, M.; Kimura, Y.; Shimizu, N.; Arai, K. Triterpene alcohol and sterol ferulates from rice bran and their anti- inflammatory effects. J. Agric. Food Chem. 2000, 48, 2313–2319. [Google Scholar] [CrossRef]
- Rao, Y.P.C.; Sugasini, D.; Lokesh, B. Dietary gamma oryzanol plays a significant role in the anti-inflammatory activity of rice bran oil by decreasing pro-inflammatory mediators secreted by peritoneal macrophages of rats. Biochem. Biophys. Res. Commun. 2016, 479, 747–752. [Google Scholar] [CrossRef]
- Bhatia, H.S.; Baron, J.; Hagl, S.; Eckert, G.P.; Fiebich, B.L. Rice bran derivatives alleviate microglia activation: Possible involvement of MAPK pathway. J. Neuroinflamm. 2016, 13, 148. [Google Scholar] [CrossRef]
- Shen, J.; Yang, T.; Xu, Y.; Luo, Y.; Zhong, X.; Shi, L.; Hu, T.; Guo, T.; Nie, Y.; Luo, F.; et al. δ-Tocotrienol, Isolated from Rice Bran, Exerts an Anti-Inflammatory Effect via MAPKs and PPARs Signaling Pathways in Lipopolysaccharide-Stimulated Macrophages. Int. J. Mol. Sci. 2018, 19, 3022. [Google Scholar] [CrossRef]
- Giriwono, P.E.; Shirakawa, H.; Ohsaki, Y.; Hata, S.; Kuriyama, H.; Sato, S.; Goto, T.; Komai, M. Dietary supplementation of geranylgeraniol suppresses lipopolysaccharide-induced inflammation via the inhibition of NF-κB activation in rats. Eur. J. Nutr. 2013, 52, 1191–1199. [Google Scholar] [CrossRef]
- Giriwono, P.E.; Shirakawa, H.; Ohsaki, Y.; Sato, S.; Aoyama, Y.; Ho, H.-J.; Goto, T.; Komai, M. Geranylgeraniol Suppresses the expression of IRAK1 and TRAF6 to Inhibit NFκB Activation in Lipopolysaccharide-Induced Inflammatory Responses in Human Macrophage-Like Cells. Int. J. Mol. Sci. 2019, 20, 2320. [Google Scholar] [CrossRef]
- Saputra, W.D.; Shono, H.; Ohsaki, Y.; Sultana, H.; Komai, M.; Shirakawa, H. Geranylgeraniol Inhibits Lipopolysaccharide-Induced Inflammation in Mouse-Derived MG6 Microglial Cells via NF-κB Signaling Modulation. Int. J. Mol. Sci. 2021, 22, 10543. [Google Scholar] [CrossRef]
- Xiao, J.; Zhang, R.; Wu, Y.; Wu, C.; Jia, X.; Dong, L.; Liu, L.; Chen, Y.; Bai, Y.; Zhang, M. Rice Bran Phenolic Extract Protects against Alcoholic Liver Injury in Mice by Alleviating Intestinal Microbiota Dysbiosis, Barrier Dysfunction, and Liver Inflammation Mediated by the Endotoxin–TLR4–NF-κB Pathway. J. Agric. Food Chem. 2020, 68, 1237–1247. [Google Scholar] [CrossRef]
- Ardiansyah; Nada, A.; Rahmawati, N.; Oktriani, A.; David, W.; Astuti, R.; Handoko, D.; Kusbiantoro, B.; Budijanto, S.; Shirakawa, H. Volatile Compounds, Sensory Profile and Phenolic Compounds in Fermented Rice Bran. Plants 2021, 10, 1073. [Google Scholar] [CrossRef]
- Fang, H.-Y.; Chen, Y.-K.; Chen, H.-H.; Lin, S.-Y.; Fang, Y.-T. Immunomodulatory effects of feruloylated oligosaccharides from rice bran. Food Chem. 2012, 134, 836–840. [Google Scholar] [CrossRef]
- Lin, C.C.; Chen, H.H.; Chen, Y.K.; Chang, H.C.; Lin, P.Y.; Pan, I.-H.; Chen, D.-Y.; Chen, C.-M.; Lin, S.Y. Rice bran feruloylated oligosaccharides activate dendritic cells via toll-like receptor 2 and 4 signaling. Molecules 2014, 19, 5325–5347. [Google Scholar] [CrossRef]
- Park, H.-Y.; Yu, A.-R.; Choi, I.-W.; Hong, H.-D.; Lee, K.-W.; Choi, H.-D. Immunostimulatory effects and characterization of a glycoprotein fraction from rice bran. Int. Immunopharmacol. 2013, 17, 191–197. [Google Scholar] [CrossRef]
- Park, Y.M.; Lee, H.Y.; Shin, D.Y.; Lee, Y.H.; Yang, Y.J.; Lee, H.S.; Lee, J.O.; Choi, K.S.; Kang, J.H.; Cho, Y.H.; et al. Immunostimulatory Activity of Black Rice Bran in Cyclophosphamide-Induced Immunosuppressed Rats. Nat. Prod. Commun. 2020, 15, 1934578X2093491. [Google Scholar] [CrossRef]
- Rashid, N.Y.A.; Razak, D.L.A.; Jamaluddin, A.; Sharifuddin, S.A.; Long, K. Bioactive compounds and antioxidant activity of rice bran fermented with lactic acid bacteria. Malays. J. Microbiol. 2015, 11, 156–162. [Google Scholar] [CrossRef]
- Forster, G.M.; Raina, K.; Kumar, A.; Kumar, S.; Agarwal, R.; Chen, M.-H.; Bauer, J.E.; McClung, A.M.; Ryan, E.P. Rice varietal differences in bioactive bran components for inhibition of colorectal cancer cell growth. Food Chem. 2013, 141, 1545–1552. [Google Scholar] [CrossRef]
- Limtrakul, P.; Yodkeeree, S.; Pitchakarn, P.; Punfa, W. Anti-inflammatory effects of proanthocyanidin-rich red rice extract via suppression of MAPK, AP-1 and NF-κB pathways in Raw 264.7 macrophages. Nutr. Res. Pract. 2016, 10, 251–258. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Jin, U.-H.; Allred, C.D.; Jayaraman, A.; Chapkin, R.S.; Safe, S. Special section on drug metabolism and the microbiome: Aryl hydrocarbon receptor activity of tryptophan metabolites in young adult mouse colonocytes. Drug Metab. Dispos. 2015, 43, 1536–1543. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.H.; Lin, C.H.; Hsu, P.C.; Sun, Y.Y.; Huang, Y.J.; Zhuo, J.H.; Wang, C.Y.; Gan, Y.L.; Hung, C.C.; Kuan, C.Y.; et al. Aryl hydrocarbon receptor mediates both proinflammatory and anti-inflammatory effects in lipopolysaccharide-activated microglia. Glia 2015, 63, 1138–1154. [Google Scholar] [CrossRef] [PubMed]
- Takamura, T.; Harama, D.; Matsuoka, S.; Shimokawa, N.; Nakamura, Y.; Okumura, K.; Ogawa, H.; Kitamura, M.; Nakao, A. Activation of the aryl hydrocarbon receptor pathway may ameliorate dextran sodium sulfate-induced colitis in mice. Immunol. Cell Biol. 2010, 88, 685–689. [Google Scholar] [CrossRef]
- Kimura, A.; Naka, T.; Nakahama, T.; Chinen, I.; Masuda, K.; Nohara, K.; Fujii-Kuriyama, Y.; Kishimoto, T. Aryl hydrocarbon receptor in combination with Stat1 regulates LPS-induced inflammatory responses. J. Exp. Med. 2009, 206, 2027–2035. [Google Scholar] [CrossRef]
- Masuda, K.; Kimura, A.; Hanieh, H.; Nguyen, N.T.; Nakahama, T.; Chinen, I.; Otoyo, Y.; Murotani, T.; Yamatodani, A.; Kishimoto, T. Aryl hydrocarbon receptor negatively regulates LPS-induced IL-6 production through suppression of histamine production in macrophages. Int. Immunol. 2011, 23, 637–645. [Google Scholar] [CrossRef]
- Adelibieke, Y.; Yisireyili, M.; Ng, H.-Y.; Saito, S.; Nishijima, F.; Niwa, T. Indoxyl sulfate induces IL-6 expression in vascular endothelial and smooth muscle cells through OAT3-mediated uptake and activation of AhR/NF-κB pathway. Nephron Exp. Nephrol. 2014, 128, 1–8. [Google Scholar] [CrossRef]
- Denison, M.S.; Faber, S.C. And now for something completely different: Diversity in ligand-dependent activation of Ah receptor responses. Curr. Opin. Toxicol. 2017, 2, 124–131. [Google Scholar] [CrossRef]
- Yang, E.-J.; Kim, S.-I.; Park, S.-Y.; Bang, H.-Y.; Jeong, J.H.; So, J.-H.; Rhee, I.-K.; Song, K.-S. Fermentation enhances the in vitro antioxidative effect of onion (Allium cepa) via an increase in quercetin content. Food Chem. Toxicol. 2012, 50, 2042–2048. [Google Scholar] [CrossRef]
- Miyake, Y.; Ito, C.; Itoigawa, M.; Osawa, T. Isolation of the Antioxidant Pyranonigrin-A from Rice Mold Starters Used in the Manufacturing Process of Fermented Foods. Biosci. Biotechnol. Biochem. 2007, 71, 2515–2521. [Google Scholar] [CrossRef]
- Cho, H.-D.; Min, H.-J.; Won, Y.-S.; Ahn, H.-Y.; Cho, Y.-S.; Seo, K.-I. Solid state fermentation process with Aspergillus kawachii enhances the cancer-suppressive potential of silkworm larva in hepatocellular carcinoma cells. BMC Complement. Altern. Med. 2019, 19, 241. [Google Scholar] [CrossRef]
- Hirata, M.; Tsuge, K.; Jayakody, L.N.; Urano, Y.; Sawada, K.; Inaba, S.; Nagao, K.; Kitagaki, H. Structural determination of glucosylceramides in the distillation remnants of shochu, the japanese traditional liquor, and its production by Aspergillus kawachii. J. Agric. Food Chem. 2012, 60, 11473–11482. [Google Scholar] [CrossRef]
- Yeom, M.; Park, J.; Lim, C.; Sur, B.; Lee, B.; Han, J.-J.; Choi, H.-D.; Lee, H.; Hahm, D.-H. Glucosylceramide attenuates the inflammatory mediator expression in lipopolysaccharide-stimulated RAW264.7 cells. Nutr. Res. 2015, 35, 241–250. [Google Scholar] [CrossRef]
- Lim, H.S.; Cha, I.-T.; Roh, S.W.; Shin, H.-H.; Seo, M.-J. Enhanced production of gamma-aminobutyric acid by optimizing culture conditions of Lactobacillus brevis HYE1 isolated from kimchi, a Korean fermented food. J. Microbiol. Biotechnol. 2017, 27, 450–459. [Google Scholar] [CrossRef]
- Bajić, S.S.; Đokić, J.; Dinić, M.; Tomić, S.; Popović, N.; Brdarić, E.; Golić, N.; Tolinački, M. GABA potentiate the immunoregulatory effects of Lactobacillus brevis BGZLS10-17 via ATG5-dependent autophagy in vitro. Sci. Rep. 2020, 10, 1347. [Google Scholar] [CrossRef]
- Gao, J.; Li, Y.; Wan, Y.; Hu, T.; Liu, L.; Yang, S.; Gong, Z.; Zeng, Q.; Wei, Y.; Yang, W.; et al. A novel postbiotic from Lactobacillus rhamnosus GG with a beneficial effect on intestinal barrier function. Front. Microbiol. 2019, 10, 477. [Google Scholar] [CrossRef]
- Islam, J.; Shirakawa, H.; Nguyen, T.K.; Aso, H.; Komai, M. Simultaneous analysis of serotonin, tryptophan and tryptamine levels in common fresh fruits and vegetables in Japan using fluorescence HPLC. Food Biosci. 2016, 13, 56–59. [Google Scholar] [CrossRef]
- Geng, T.; Yan, Y.; Xu, L.; Cao, M.; Xu, Y.; Pu, J.; Yan, J.C. CD137 signaling induces macrophage M2 polarization in atherosclerosis through STAT6/PPARδ pathway. Cell. Signal. 2020, 72, 109628. [Google Scholar] [CrossRef]







| Gene Name | Forward Primer | Reverse Primer | Accession Number | 
|---|---|---|---|
| Eukaryotic translation elongation factor 1 alpha 1 (Eef1a1) | GATGGCCCCAAATTCTTGAAG | GGACCATGTCAACAATGGCAG | NM_010106.2 | 
| Interleukin-1β (Il-1β) | CTGTGTCTTTCCCGTGGACC | CAGCTCATATGGGTCCGACA | NM_008361.4 | 
| Tumor necrosis factor α (Tnf-α) | GACGTGGAACTGGCAGAAGAG | TCTGGAAGCCCCCCATCT | NM_013693.3, NM_001278601.1 | 
| Interleukin-6 (Il-6) | AGAGGAGACTTCACAGAGGATACCA | AATCAGAATTGCCATTGCACAAC | NM_031168.2, NM_001314054.1 | 
| Inducible nitric oxide synthase (iNos) | CAGGTGCACACAGGCTACT | GAGCACGCTGAGTACCTCATT | NM_001313922.1, NM_001313921.1, NM_010927.4 | 
| Interleukin 10 (Il-10) | TGAATTCCCTGGGTGAGAAGCTGA | TGGCCTTGTAGACACCTTGGTCTT | NM_010548.2 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Agista, A.Z.; Tanuseputero, S.A.; Koseki, T.; Ardiansyah; Budijanto, S.; Sultana, H.; Ohsaki, Y.; Yeh, C.-L.; Yang, S.-C.; Komai, M.; et al. Tryptamine, a Microbial Metabolite in Fermented Rice Bran Suppressed Lipopolysaccharide-Induced Inflammation in a Murine Macrophage Model. Int. J. Mol. Sci. 2022, 23, 11209. https://doi.org/10.3390/ijms231911209
Agista AZ, Tanuseputero SA, Koseki T, Ardiansyah, Budijanto S, Sultana H, Ohsaki Y, Yeh C-L, Yang S-C, Komai M, et al. Tryptamine, a Microbial Metabolite in Fermented Rice Bran Suppressed Lipopolysaccharide-Induced Inflammation in a Murine Macrophage Model. International Journal of Molecular Sciences. 2022; 23(19):11209. https://doi.org/10.3390/ijms231911209
Chicago/Turabian StyleAgista, Afifah Zahra, Sharon Angela Tanuseputero, Takuya Koseki, Ardiansyah, Slamet Budijanto, Halima Sultana, Yusuke Ohsaki, Chiu-Li Yeh, Suh-Ching Yang, Michio Komai, and et al. 2022. "Tryptamine, a Microbial Metabolite in Fermented Rice Bran Suppressed Lipopolysaccharide-Induced Inflammation in a Murine Macrophage Model" International Journal of Molecular Sciences 23, no. 19: 11209. https://doi.org/10.3390/ijms231911209
APA StyleAgista, A. Z., Tanuseputero, S. A., Koseki, T., Ardiansyah, Budijanto, S., Sultana, H., Ohsaki, Y., Yeh, C.-L., Yang, S.-C., Komai, M., & Shirakawa, H. (2022). Tryptamine, a Microbial Metabolite in Fermented Rice Bran Suppressed Lipopolysaccharide-Induced Inflammation in a Murine Macrophage Model. International Journal of Molecular Sciences, 23(19), 11209. https://doi.org/10.3390/ijms231911209
 
        





 
       