Host Range, Morphology and Sequence Analysis of Ten Temperate Phages Isolated from Pathogenic Yersinia enterocolitica Strains
Abstract
1. Introduction
2. Results
2.1. Nine Y. enterocolitica Strains Released Phages That Are Lytic at Room Temperature
2.2. The Phages Are Myoviruses and Belong to Three Distinct Groups
2.3. Group 2 Phages Have the Broadest Host Range
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Culture Conditions
4.2. Isolation, Propagation and Purification of Phages
4.3. Host Range Determination
4.4. Transmission Electron Microscopy
4.5. Phage DNA Preparation, Short-Read WGS and Bioinformatics Analysis
4.6. Comparative Phage Genome Analyses
4.7. Nucleotide Sequencing Data
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Le Guern, A.S.; Martin, L.; Savin, C.; Carniel, E. Yersiniosis in France: Overview and potential sources of infection. Int. J. Infect. Dis. 2016, 46, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- European Food Safety Authority. European Centre for Disease Prevention and Control. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2014. EFSA J. 2015, 13, 4329–4520. [Google Scholar] [CrossRef] [Scilit]
- Fredriksson-Ahomaa, M.; Stolle, A.; Korkeala, H. Molecular epidemiology of Yersinia enterocolitica infections. FEMS Immunol. Med. Microbiol. 2006, 47, 315–329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fredriksson-Ahomaa, M.; Stolle, A.; Siitonen, A.; Korkeala, H. Sporadic human Yersinia enterocolitica infections caused by bioserotype 4/O : 3 originate mainly from pigs. J. Med. Microbiol. 2006, 55, 747–749. [Google Scholar] [CrossRef] [Scilit]
- Laukkanen, R.; Martinez, P.O.; Siekkinen, K.M.; Ranta, J.; Maijala, R.; Korkeala, H. Transmission of Yersinia pseudotuberculosis in the pork production chain from farm to slaughterhouse. Appl. Environ. Microbiol. 2008, 74, 5444–5450. [Google Scholar] [CrossRef] [Scilit]
- Bancerz-Kisiel, A.; Pieczywek, M.; Lada, P.; Szweda, W. The most important virulence markers of Yersinia enterocolitica and their role during infection. Genes 2018, 9, 235. [Google Scholar] [CrossRef] [Scilit]
- Savin, C.; Le Guern, A.S.; Lefranc, M.; Bremont, S.; Carniel, E.; Pizarro-Cerda, J. Isolation of a Yersinia enterocolitica biotype 1B strain in France, and evaluation of its genetic relatedness to other European and North American biotype 1B strains. Emerg. Microbes Infect. 2018, 7, 121. [Google Scholar] [CrossRef] [Scilit]
- Fredriksson-Ahomaa, M.; Cernela, N.; Hachler, H.; Stephan, R. Yersinia enterocolitica strains associated with human infections in Switzerland 2001–2010. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 1543–1550. [Google Scholar] [CrossRef] [Scilit]
- Stephan, R.; Joutsen, S.; Hofer, E.; Sade, E.; Bjorkroth, J.; Ziegler, D.; Fredriksson-Ahomaa, M. Characteristics of Yersinia enterocolitica biotype 1A strains isolated from patients and asymptomatic carriers. Eur. J. Clin. Microbiol. Infect. Dis. 2013, 32, 869–875. [Google Scholar] [CrossRef] [Scilit]
- Hammerl, J.A.; Freytag, B.; Lanka, E.; Appel, B.; Hertwig, S. The pYV virulence plasmids of Yersinia pseudotuberculosis and Y. pestis contain a conserved DNA region responsible for the mobilization by the self-transmissible plasmid pYE854. Environ. Microbiol. Rep. 2012, 4, 433–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hammerl, J.A.; Klein, I.; Lanka, E.; Appel, B.; Hertwig, S. Genetic and functional properties of the self-transmissible Yersinia enterocolitica plasmid pYE854, which mobilizes the virulence plasmid pYV. J. Bacteriol. 2008, 190, 991–1010. [Google Scholar] [CrossRef] [Scilit]
- Hertwig, S.; Klein, I.; Hammerl, J.A.; Appel, B. Characterization of two conjugative Yersinia plasmids mobilizing pYV. Adv. Exp. Med. Biol. 2003, 529, 35–38. [Google Scholar] [CrossRef] [Scilit]
- Nicolle, P.; Mollaret, H.; Hamon, Y.; Vieu, J.F.; Brault, J.; Brault, G. Lysogenic, bacteriocinogenic and phage-typing study of species Yersinia enterocolitica. Ann. Inst. Pasteur. 1967, 112, 86–92. [Google Scholar]
- Nilehn, B.; Ericson, C. Studies on Yersinia enterocolitica. Bacteriophages liberated from chloroform treated cultures. Acta Pathol. Microbiol. Scand. 1969, 75, 177–187. [Google Scholar] [PubMed]
- Chouikha, I.; Charrier, L.; Filali, S.; Derbise, A.; Carniel, E. Insights into the infective properties of YpfPhi, the Yersinia pestis filamentous phage. Virology 2010, 407, 43–52. [Google Scholar] [CrossRef] [Scilit]
- Derbise, A.; Carniel, E. YpfPhi: A filamentous phage acquired by Yersinia pestis. Front. Microbiol. 2014, 5, 701. [Google Scholar] [CrossRef] [Scilit]
- Derbise, A.; Chenal-Francisque, V.; Pouillot, F.; Fayolle, C.; Prevost, M.C.; Medigue, C.; Hinnebusch, B.J.; Carniel, E. A horizontally acquired filamentous phage contributes to the pathogenicity of the plague bacillus. Mol. Microbiol. 2007, 63, 1145–1157. [Google Scholar] [CrossRef] [Scilit]
- Popp, A.; Hertwig, S.; Lurz, R.; Appel, B. Comparative study of temperate bacteriophages isolated from Yersinia. Syst. Appl. Microbiol. 2000, 23, 469–478. [Google Scholar] [CrossRef] [Scilit]
- Hertwig, S.; Popp, A.; Freytag, B.; Lurz, R.; Appel, B. Generalized transduction of small Yersinia enterocolitica plasmids. Appl. Environ. Microbiol. 1999, 65, 3862–3866. [Google Scholar] [CrossRef] [Scilit]
- Liang, J.; Kou, Z.; Qin, S.; Chen, Y.; Li, Z.; Li, C.; Duan, R.; Hao, H.; Zha, T.; Gu, W.; et al. Novel Yersinia enterocolitica prophages and a comparative analysis of genomic diversity. Front. Microbiol. 2019, 10, 1184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hertwig, S.; Klein, I.; Lurz, R.; Lanka, E.; Appel, B. PY54, a linear plasmid prophage of Yersinia enterocolitica with covalently closed ends. Mol. Microbiol. 2003, 48, 989–1003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hertwig, S.; Klein, I.; Schmidt, V.; Beck, S.; Hammerl, J.A.; Appel, B. Sequence analysis of the genome of the temperate Yersinia enterocolitica phage PY54. J. Mol. Biol. 2003, 331, 605–622. [Google Scholar] [CrossRef] [Scilit]
- Hammerl, J.A.; Barac, A.; Erben, P.; Fuhrmann, J.; Gadicherla, A.; Kumsteller, F.; Lauckner, A.; Müller, F.; Hertwig, S. Properties of two broad host range phages of Yersinia enterocolitica isolated from wild animals. Int. J. Mol. Sci. 2021, 22, 1381. [Google Scholar] [CrossRef] [Scilit]
- Leon-Velarde, C.G.; Happonen, L.; Pajunen, M.; Leskinen, K.; Kropinski, A.M.; Mattinen, L.; Rajtor, M.; Zur, J.; Smith, D.; Chen, S.; et al. Yersinia enterocolitica-specific infection by bacteriophages TG1 and varphiR1-RT is dependent on temperature-regulated expression of the phage host receptor OmpF. Appl. Environ. Microbiol. 2016, 82, 5340–5353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jackel, C.; Hammerl, J.A.; Reetz, J.; Kropinski, A.M.; Hertwig, S. Campylobacter group II phage CP21 is the prototype of a new subgroup revealing a distinct modular genome organization and host specificity. BMC Genom. 2015, 16, 629. [Google Scholar] [CrossRef] [Scilit]
- Jackel, C.; Hertwig, S.; Scholz, H.C.; Nockler, K.; Reetz, J.; Hammerl, J.A. Prevalence, host range, and comparative genomic analysis of temperate Ochrobactrum phages. Front. Microbiol. 2017, 8, 1207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hammerl, J.A.; Vom Ort, N.; Barac, A.; Jäckel, C.; Grund, L.; Dreyer, S.; Heydel, C.; Kuczka, A.; Peters, H.; Hertwig, S. Analysis of Yersinia pseudotuberculosis Isolates recovered from deceased mammals of a German zoo animal collection. J. Clin. Microbiol. 2021, 59, e03125-20. [Google Scholar] [CrossRef] [Scilit]
- Deneke, C.; Brendebach, H.; Uelze, L.; Borowiak, M.; Malorny, B.; Tausch, S.H. Species-specific quality control, assembly and contamination detection in microbial isolate sequences with AQUAMIS. Genes 2021, 12, 644. [Google Scholar] [CrossRef] [Scilit]
- Wattam, A.R.; Brettin, T.; Davis, J.J.; Gerdes, S.; Kenyon, R.; Machi, D.; Mao, C.; Olson, R.; Overbeek, R.; Pusch, G.D.; et al. Assembly, annotation, and comparative genomics in PATRIC, the all bacterial bioinformatics resource center. Methods Mol. Biol. 2018, 1704, 79–101. [Google Scholar] [CrossRef] [Scilit]
- Meier-Kolthoff, J.P.; Goker, M. VICTOR: Genome-based phylogeny and classification of prokaryotic viruses. Bioinformatics 2017, 33, 3396–3404. [Google Scholar] [CrossRef] [Scilit]
- Göker, M.; Garcia-Blazquez, G.; Voglmayr, H.; Telleria, M.T.; Martin, M.P. Molecular taxonomy of phytopathogenic fungi: A case study in Peronospora. PLoS ONE 2009, 4, e6319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaas, R.S.; Leekitcharoenphon, P.; Aarestrup, F.M.; Lund, O. Solving the problem of comparing whole bacterial genomes across different sequencing platforms. PLoS ONE 2014, 9, e104984. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Strain (Accession No.) | Bio/ Serotype | Source (Year, German Federal State) | Phage (Accession No.) |
|---|---|---|---|
| 14-YE00030 (JAJTNN000000000) | B2/O:5,27 | Pork (2014, Saxony) | vB_YenM_30.14 (OM046629) |
| 16-YE00006 (JAJTNM000000000) | B2/O:5,27 | Pork (2016, Saxony Anhalt) | vB_YenM_06.16-1 (OM046622), vB_YenM_06-16-2 (OM046626) |
| 16-YE00201 (JAJTNL000000000) | 1B/O:8 | Wildlife (2016, Berlin) | vB_YenM_201.16 (OM046628) |
| 17-YE00031 (JAJTNK000000000) | B2/O:5,27 | Pork (2017, Saxony) | vB_YenM_31.17 (OM140653) |
| 17-YE00056 (JAJTNJ000000000) | B2/O:5,27 | Pork (2017, Saxony Anhalt) | vB_YenM_56.17 (OM046627) |
| 17-YE00210 (JAJTNI000000000) | B2/O:5,27 | Sheep feces (2017, Schleswig-Holstein) | vB_YenM_210.17 (OM046625) |
| 18-YE00029 (JAJTNH000000000) | B2/O:5,27 | Pork (2018, Saxony) | vB_YenM_29.18 (OM046621) |
| 18-YE00042 (JAJTNO000000000) | B2/O:9 | Pork (2018, Saxony) | vB_YenM_42.18 (OM046624) |
| 09-YE00021 (JAJTNG000000000) | B2/O:5,27 | Pork (2009, Saxony Anhalt) | vB_YenM_21.09 (OM046623) |
| vB_YenM Phage | Nucleotide Sequence of the Attachment Site (Size in Nucleotides) 5′-3′ Direction | Y. enterocolitica Host | Integration Site (Affected Element) |
|---|---|---|---|
| vB_YenM_06.16-1 group | |||
| 06.16-1 | ATAACAC (7 nt) | 16-YE00006 | Intergenic A |
| 21.09 | ATAACAC (7 nt) | 21-YE00009 | Intergenic A |
| 29.18 | ATAACAC (7 nt) | 18-YE00029 | Intergenic A |
| 30.14 | ATAACAC (7 nt) | 14-YE00030 | Intergenic A |
| 210.17 | ATAACAC (7 nt) | 17-YE00210 | Intergenic A |
| vB_YenM_06.16-2 group | |||
| 06.16-2 | GACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAATTTTAGCT (57 nt) | 16-YE00006 | tRNA-Ile |
| 31.17 | AAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATGGAAA (57 nt) | 17-YE00031 | YcbX family protein |
| 56.17 | GACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT (50 nt) | 17-YE00056 | tRNA-Ile |
| 201.16 | GACTCATAATCGCTTGGTCACTGGTTCAAGTCCAGTAGGGGCCACCAAAT (50 nt) | 16-YE00201 | tRNA-Ile |
| vB_YenM_42.18 group | |||
| 42.18 | ACAACCTGCTA (11 nt) | 18-YE00042 | Intergenic B |
| Phage Groups | 1 | 2 | 3 | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Isolate ID | 06.16-1 | 21.09 | 29.18 | 30.14 | 210.17 | 06.16-2 | 31.17 | 56.17 | 201.16 | 42.18 |
| 1A (O-type) | ||||||||||
| 13-YE00003 (O:8) | - | - | - | - | - | - | - | - | - | - |
| 12-YE00021 (O:7,8) | - | - | - | - | - | - | - | - | - | - |
| 14-YE00065 (O:5) | - | - | - | - | - | - | - | + | - | - |
| 18-YE00017 (O:5) | + | - | - | - | - | + | - | + | - | - |
| 13-YE00025 (O:5,27) | - | - | - | - | - | - | + | - | - | - |
| 16-YE00080 (O:27) | - | - | - | - | - | - | - | + | - | - |
| 16-YE00083 (O:27) | - | - | - | - | - | - | - | - | - | - |
| 13-YE00019 (O:3) | - | - | - | - | - | - | - | - | - | - |
| 12-YE00030 (O:6,31) | - | - | - | - | - | - | - | - | - | - |
| 07-YE00015 (O:13,17) | - | - | - | - | - | - | - | - | - | - |
| 17-YE00192 (O:41,43) | - | - | - | - | - | - | - | - | - | - |
| 11-YE00037 (rough) | - | - | - | - | - | - | - | - | - | - |
| 11-YE00038 (rough) | - | - | - | - | - | - | - | - | - | - |
| 13-YE00020 (n.d.) | - | - | - | - | - | - | - | - | - | - |
| B1/O:8 | ||||||||||
| YE181 * (DSM 27689) | - | - | - | - | - | - | - | - | - | - |
| 13-YE00006 | - | - | - | - | - | - | - | + | + | - |
| 16-YE00128 | - | - | - | - | - | - | - | - | - | - |
| 16-YE00196 | - | - | - | - | - | - | - | + | + | - |
| 16-YE00197 | - | - | - | - | - | - | - | + | + | - |
| 16-YE00198 | - | - | - | - | - | - | - | + | + | - |
| 16-YE00201 | - | - | - | - | - | - | - | - | - | - |
| 17-YE00142 | - | - | - | - | - | - | - | - | - | - |
| B2/O:9 | ||||||||||
| YE182 * | - | - | - | - | - | - | - | - | - | - |
| YE183 * (Evira 663) | - | - | - | - | - | - | - | - | - | - |
| 16-YE00235 | - | - | - | - | - | - | - | - | - | - |
| 17-YE00133 | - | - | - | - | - | - | - | - | - | - |
| 17-YE00134 | - | - | - | - | - | - | - | - | - | - |
| 17-YE00143 | - | - | - | - | - | - | - | - | - | - |
| 17-YE00155 | - | - | - | - | - | - | - | - | - | - |
| 17-YE00218 | - | - | - | - | - | - | - | + | - | - |
| 18-YE00008 | - | - | - | - | - | - | - | + | + | - |
| 18-YE00014 | - | - | - | - | - | - | - | - | - | - |
| 18-YE00022 | - | - | - | - | - | + | - | + | + | - |
| B2/O:5,27 | ||||||||||
| YE180 * (DSM 11504) | + | + | - | - | - | - | + | + | + | - |
| 17-YE00021 | + | + | + | + | + | + | + | + | + | - |
| 17-YE00031 | + | + | + | + | + | + | - | + | + | - |
| 17-YE00041 | + | + | - | + | - | + | - | + | + | - |
| 17-YE00056 | - | - | - | - | - | + | + | - | + | + |
| 17-YE00097 | + | + | - | - | + | + | + | + | + | - |
| 17-YE00169 | - | - | - | - | + | - | - | - | + | - |
| 17-YE00203 | + | + | + | + | + | + | + | + | + | - |
| B4/O:3 | ||||||||||
| YE179 * (DSM 9676) | - | - | - | - | - | + | - | + | - | + |
| YE184 * (Evira 595) | - | - | - | - | - | + | - | - | - | - |
| 17-YE00038 | - | - | - | - | - | - | - | - | - | - |
| 17-YE00058 | - | - | - | - | - | - | + | - | + | - |
| 17-YE00168 | - | - | - | - | - | + | - | + | + | + |
| 17-YE00222 | - | - | - | - | - | + | - | + | + | + |
| 18-YE00001 | - | - | - | - | - | + | - | + | + | + |
| 18-YE00010 | - | - | - | - | - | + | - | + | + | + |
| 18-YE00025 | - | - | - | - | - | + | - | + | + | + |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hammerl, J.A.; El-Mustapha, S.; Bölcke, M.; Trampert, H.; Barac, A.; Jäckel, C.; Gadicherla, A.K.; Hertwig, S. Host Range, Morphology and Sequence Analysis of Ten Temperate Phages Isolated from Pathogenic Yersinia enterocolitica Strains. Int. J. Mol. Sci. 2022, 23, 6779. https://doi.org/10.3390/ijms23126779
Hammerl JA, El-Mustapha S, Bölcke M, Trampert H, Barac A, Jäckel C, Gadicherla AK, Hertwig S. Host Range, Morphology and Sequence Analysis of Ten Temperate Phages Isolated from Pathogenic Yersinia enterocolitica Strains. International Journal of Molecular Sciences. 2022; 23(12):6779. https://doi.org/10.3390/ijms23126779
Chicago/Turabian StyleHammerl, Jens Andre, Sabrin El-Mustapha, Michelle Bölcke, Hannah Trampert, Andrea Barac, Claudia Jäckel, Ashish K. Gadicherla, and Stefan Hertwig. 2022. "Host Range, Morphology and Sequence Analysis of Ten Temperate Phages Isolated from Pathogenic Yersinia enterocolitica Strains" International Journal of Molecular Sciences 23, no. 12: 6779. https://doi.org/10.3390/ijms23126779
APA StyleHammerl, J. A., El-Mustapha, S., Bölcke, M., Trampert, H., Barac, A., Jäckel, C., Gadicherla, A. K., & Hertwig, S. (2022). Host Range, Morphology and Sequence Analysis of Ten Temperate Phages Isolated from Pathogenic Yersinia enterocolitica Strains. International Journal of Molecular Sciences, 23(12), 6779. https://doi.org/10.3390/ijms23126779

