The Identification of Broomcorn Millet bZIP Transcription Factors, Which Regulate Growth and Development to Enhance Stress Tolerance and Seed Germination
Abstract
:1. Introduction
2. Results
2.1. Seed Germination Rate in Salt Treatment
2.2. Transcriptome Sequencing and Assembly
2.3. Gene Annotation and Functional Classification
2.4. Statistics of Differential Expression Genes (DEGs) in Salt Stress
2.5. GO Term and KEGG Enrichment Analysis for DEGs
2.6. Expression Analysis of TFs Involved in Seed Germination under Salt Stress
2.7. PmbZIPs Response to Various Stress Conditions in the Plant Seedling Stage
2.8. PmbZIPs Subcellular Localization and BiFC Assay
2.9. PmbABI5 Positively Regulates Root Growth in Arabidopsis and Rice
2.10. PmbABI5 Can Regulate PmNAC1 Expression
3. Discussion
4. Materials and Methods
4.1. Plant Materials and External Characteristics of Seeds
4.2. Salt Stress Treatment and Seed Germination Experiment
4.3. RNA-Seq Sampling and Total Ribonucleic Acid (RNA) Preparation
4.4. Complementary DNA (cDNA) Library Preparation for Transcriptome Sequencing
4.5. Raw Data Assembly and Gene Functional Annotation
4.6. Differential Expression Genes (DEGs) Analysis
4.7. Plant Seedling Stage Conditions and Stress Treatments
4.8. Quantitative Real-Time PCR
4.9. Subcellular Localization and BiFC Assay
4.10. Construction of Transgene Vector and Plant Transformation
4.11. Y1H Assays
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAOSTAT. Food Balance. 1993–2013 and 2010–2019. Available online: https://www.fao.org/faostat/en/#data/FBSH (accessed on 16 November 2021).
- Ritchie, H.; Roser, M. Crop Yields. Our World in Data. 2018. Available online: https://ourworldindata.org/ (accessed on 16 November 2021).
- Allakhverdiev, S.I.; Kreslavski, V.D.; Klimov, V.V.; Los, D.A.; Carpentier, R.; Mohanty, P. Heat stress: An overview of molecular responses in photosynthesis. Photosynth. Res. 2008, 98, 541–550. [Google Scholar] [CrossRef] [PubMed]
- Halford, N.G.; Curtis, T.Y.; Chen, Z.; Huang, J. Effects of abiotic stress and crop management on cereal grain composition: Implications for food quality and safety. J. Exp. Bot. 2014, 66, 1145–1156. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gong, Z.; Xiong, L.; Shi, H.; Yang, S.; Herrera-Estrella, L.R.; Xu, G.; Chao, D.-Y.; Li, J.; Wang, P.-Y.; Qin, F.; et al. Plant abiotic stress response and nutrient use efficiency. Sci. China Life Sci. 2020, 63, 635–674. [Google Scholar] [CrossRef] [PubMed]
- Barnabás, B.; Jäger, K.; Fehér, A. The effect of drought and heat stress on reproductive processes in cereals. Plant Cell Environ. 2008, 31, 11–38. [Google Scholar] [CrossRef]
- Yoshida, S.; Hasegawa, S. The rice root system: Its development and function. Drought Resist. Crop. Emphas. Rice 1981, 10, 97–134. [Google Scholar]
- Yu, Z.; Duan, X.; Luo, L.; Dai, S.; Ding, Z.; Xia, G. How Plant Hormones Mediate Salt Stress Responses. Trends Plant Sci. 2020, 25, 1117–1130. [Google Scholar] [CrossRef]
- Kim, Y.; Chung, Y.S.; Lee, E.; Tripathi, P.; Heo, S.; Kim, K.-H. Root Response to Drought Stress in Rice (Oryza sativa L.). Int. J. Mol. Sci. 2020, 21, 1513. [Google Scholar] [CrossRef] [Green Version]
- Passioura, J. Water transport in and to roots. Ann. Rev. Plant Physiol. Plant Mol. Biol. 1988, 39, 245–265. [Google Scholar] [CrossRef]
- Steudle, E. Water uptake by roots: Effects of water deficit. J. Exp. Bot. 2000, 51, 1531–1542. [Google Scholar] [CrossRef] [Green Version]
- Ranathunge, K.; Shao, S.; Qutob, D.; Gijzen, M.; Peterson, C.A.; Bernards, M.A. Properties of the soybean seed coat cuticle change during development. Planta 2010, 231, 1171–1188. [Google Scholar] [CrossRef]
- Acosta-Motos, J.R.; Ortuño, M.F.; Bernal-Vicente, A.; Diaz-Vivancos, P.; Sanchez-Blanco, M.J.; Hernandez, J.A. Plant responses to salt stress: Adaptive mechanisms. Agronomy 2017, 7, 18. [Google Scholar] [CrossRef] [Green Version]
- Cassaniti, C.; Romano, D.; Flowers, T.J. The response of ornamental plants to saline irrigation water. In Irrigation: Water Management, Pollution and Alternative Strategies; InTech: Rijeka, Croation, 2012; pp. 131–158. [Google Scholar]
- Cassaniti, C.; Leonardi, C.; Flowers, T. The effects of sodium chloride on ornamental shrubs. Sci. Hortic. 2009, 122, 586–593. [Google Scholar] [CrossRef]
- Ding, Y.; Shi, Y.; Yang, S. Molecular Regulation of Plant Responses to Environmental Temperatures. Mol. Plant 2020, 13, 544–564. [Google Scholar] [CrossRef] [PubMed]
- Karmous, I.; Trevisan, R.; El Ferjani, E.; Chaoui, A.; Sheehan, D. Redox biology response in germinating Phaseolus vulgaris seeds exposed to copper: Evidence for differential redox buffering in seedlings and cotyledon. PLoS ONE 2017, 12, e0184396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eleftheriou, E.P.; Adamakis, I.-D.S.; Panteris, E.; Fatsiou, M. Chromium-Induced Ultrastructural Changes and Oxidative Stress in Roots of Arabidopsis thaliana. Int. J. Mol. Sci. 2015, 16, 15852–15871. [Google Scholar] [CrossRef] [Green Version]
- Farooq, M.A.; Ali, S.; Hameed, A.; Bharwana, S.; Rizwan, M.; Ishaque, W.; Farid, M.; Mahmood, K.; Iqbal, Z. Cadmium stress in cotton seedlings: Physiological, photosynthesis and oxidative damages alleviated by glycinebetaine. S. Afr. J. Bot. 2016, 104, 61–68. [Google Scholar] [CrossRef]
- Jafari, A.; Kamarehie, B.; Ghaderpoori, M.; Khoshnamvand, N.; Birjandi, M. The concentration data of heavy metals in Iranian grown and imported rice and human health hazard assessment. Data Brief 2017, 16, 453–459. [Google Scholar] [CrossRef] [PubMed]
- Dröge-Laser, W.; Snoek, B.L.; Snel, B.; Weiste, C. The Arabidopsis bZIP transcription factor family—An update. Curr. Opin. Plant Biol. 2018, 45, 36–49. [Google Scholar] [CrossRef] [PubMed]
- Izawa, T.; Foster, R.; Chua, N.H. Plant bZIP Protein DNA Binding Specificity. J. Mol. Biol. 1993, 230, 1131–1144. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.-I.; Hong, J.-H.; Ha, J.-O.; Kang, J.-Y.; Kim, S.Y. ABFs, a Family of ABA-responsive Element Binding Factors. J. Biol. Chem. 2000, 275, 1723–1730. [Google Scholar] [CrossRef] [Green Version]
- Fukazawa, J.; Sakai, T.; Ishida, S.; Yamaguchi, I.; Kamiya, Y.; Takahashi, Y. REPRESSION OF SHOOT GROWTH, a bZIP Transcriptional Activator, Regulates Cell Elongation by Controlling the Level of Gibberellins. Plant Cell 2000, 12, 901–915. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, X.; Yang, Y.-N.; Xue, L.-J.; Zou, M.-J.; Liu, J.-Y.; Chen, F.; Xue, H.-W. Rice ABI5-Like1 Regulates Abscisic Acid and Auxin Responses by Affecting the Expression of ABRE-Containing Genes. Plant Physiol. 2011, 156, 1397–1409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bi, C.; Ma, Y.; Wu, Z.; Yu, Y.-T.; Liang, S.; Lu, K.; Wang, X.-F. Arabidopsis ABI5 plays a role in regulating ROS homeostasis by activating CATALASE 1 transcription in seed germination. Plant Mol. Biol. 2017, 94, 197–213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albertos, P.; Romero-Puertas, M.C.; Tatematsu, K.; Mateos, I.; Sánchez-Vicente, I.; Nambara, E.; Lorenzo, O. S-nitrosylation triggers ABI5 degradation to promote seed germination and seedling growth. Nat. Commun. 2015, 6, 8669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, T.-T.; Xu, H.-H.; Zhang, K.-X.; Guo, T.-T.; Lu, Y.-T. Glucose inhibits root meristem growth via ABA INSENSITIVE 5, which represses PIN1 accumulation and auxin activity in Arabidopsis. Plant Cell Environ. 2014, 37, 1338–1350. [Google Scholar] [CrossRef]
- Yoshida, T.; Fujita, Y.; Sayama, H.; Kidokoro, S.; Maruyama, K.; Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. AREB1, AREB2, and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent ABA signaling involved in drought stress tolerance and require ABA for full activation. Plant J. 2010, 61, 672–685. [Google Scholar] [CrossRef]
- Au, K.F.; Underwood, J.G.; Lee, L.; Wong, W.H.; Xing, Y.J.P.O. Improving PacBio Long Read Accuracy by Short Read Alignment. PLoS ONE 2012, 7, e46679. [Google Scholar] [CrossRef] [Green Version]
- Li, L.; Zhu, Z.; Zhao, Y.; Zhang, Q.; Wu, X.; Miao, B.; Cao, J.; Fei, S. FN1, SPARC, and SERPINE1 are highly expressed and significantly related to a poor prognosis of gastric adenocarcinoma revealed by microarray and bioinformatics. Sci. Rep. 2019, 9, 782. [Google Scholar] [CrossRef] [Green Version]
- Finch-Savage, W.E.; Leubner-Metzger, G. Seed dormancy and the control of germination. New Phytol. 2006, 171, 501–523. [Google Scholar] [CrossRef]
- Bai, Y.; Zhu, W.; Hu, X.; Sun, C.; Li, Y.; Wang, D.; Wang, Q.; Pei, G.; Zhang, Y.; Guo, A.; et al. Genome-Wide Analysis of the bZIP Gene Family Identifies Two ABI5-Like bZIP Transcription Factors, BrABI5a and BrABI5b, as Positive Modulators of ABA Signalling in Chinese Cabbage. PLoS ONE 2016, 11, e0158966. [Google Scholar] [CrossRef]
- Huang, X.-S.; Liu, J.-H.; Chen, X.-J. Overexpression of PtrABF gene, a bZIP transcription factor isolated from Poncirus trifoliata, enhances dehydration and drought tolerance in tobacco via scavenging ROS and modulating expression of stress-responsive genes. BMC Plant Biol. 2010, 10, 230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leite, J.P.; Barbosa, E.G.; Marin, S.R.; Marinho, J.P.; Carvalho, J.F.; Pagliarini, R.F.; Cruz, A.S.; Oliveira, M.C.; Farias, J.R.; Neumaier, N.; et al. Overexpression of the activated form of the AtAREB1 gene (AtAREB1ΔQT) improves soybean responses to water deficit. Genet. Mol. Res. 2014, 13, 6272–6286. [Google Scholar] [CrossRef] [PubMed]
- Schoonheim, P.J.; Veiga, H.; Pereira, D.D.C.; Friso, G.; Van Wijk, K.J.; De Boer, A.H. A Comprehensive Analysis of the 14-3-3 Interactome in Barley Leaves Using a Complementary Proteomics and Two-Hybrid Approach. Plant Physiol. 2007, 143, 670–683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, J.; Hu, Y.; Wang, H.; Guo, Q.; Chen, Y.; Howe, G.A.; Yu, D. Molecular Mechanism Underlying the Synergetic Effect of Jasmonate on Abscisic Acid Signaling during Seed Germination in Arabidopsis. Plant Cell 2020, 32, 3846–3865. [Google Scholar] [CrossRef]
- Uno, Y.; Furihata, T.; Abe, H.; Yoshida, R.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Arabidopsis basic leucine zipper transcription factors involved in an abscisic acid-dependent signal transduction pathway under drought and high-salinity conditions. Proc. Natl. Acad. Sci. USA 2000, 97, 11632–11637. [Google Scholar] [CrossRef] [Green Version]
- Hobo, T.; Kowyama, Y.; Hattori, T. A bZIP factor, TRAB1, interacts with VP1 and mediates abscisic acid-induced transcription. Proc. Natl. Acad. Sci. USA 1999, 96, 15348–15353. [Google Scholar] [CrossRef] [Green Version]
- Zhao, H.; Nie, K.; Zhou, H.; Yan, X.; Zhan, Q.; Zheng, Y.; Song, C.-P. ABI5 modulates seed germination via feedback regulation of the expression of the PYR/PYL/RCAR ABA receptor genes. New Phytol. 2020, 228, 596–608. [Google Scholar] [CrossRef]
- Wang, T.; Huang, S.; Zhang, A.; Guo, P.; Liu, Y.; Xu, C.; Cong, W.; Liu, B.; Xu, Z. JMJ17–WRKY40 and HY5–ABI5 modules regulate the expression of ABA-responsive genes in Arabidopsis. New Phytol. 2021, 230, 567–584. [Google Scholar] [CrossRef]
- Skubacz, A.; Daszkowska-Golec, A.; Szarejko, I. The Role and Regulation of ABI5 (ABA-Insensitive 5) in Plant Development, Abiotic Stress Responses and Phytohormone Crosstalk. Front. Plant Sci. 2016, 7, 1884. [Google Scholar] [CrossRef] [Green Version]
- Lopez-Molina, L.; Mongrand, S.; Chua, N.-H. A postgermination developmental arrest checkpoint is mediated by abscisic acid and requires the ABI5 transcription factor in Arabidopsis. Proc. Natl. Acad. Sci. USA 2001, 98, 4782–4787. [Google Scholar] [CrossRef] [Green Version]
- Olsen, A.N.; Ernst, H.A.; Leggio, L.L.; Skriver, K. NAC transcription factors: Structurally distinct, functionally diverse. Trends Plant Sci. 2005, 10, 79–87. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, K.; Takasaki, H.; Mizoi, J.; Shinozaki, K.; Yamaguchi-Shinozaki, K. NAC transcription factors in plant abiotic stress responses. Biochim. Biophys. Acta 2012, 1819, 97–103. [Google Scholar] [CrossRef] [PubMed]
- Puranik, S.; Sahu, P.P.; Srivastava, P.S.; Prasad, M. NAC proteins: Regulation and role in stress tolerance. Trends Plant Sci. 2012, 17, 369–381. [Google Scholar] [CrossRef] [PubMed]
- Jensen, M.K.; Skriver, K. NAC transcription factor gene regulatory and protein-protein interaction networks in plant stress responses and senescence. IUBMB Life 2014, 66, 156–166. [Google Scholar] [CrossRef]
- Tran, L.-S.P.; Nakashima, K.; Sakuma, Y.; Simpson, S.D.; Fujita, Y.; Maruyama, K.; Fujita, M.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Isolation and Functional Analysis of Arabidopsis Stress-Inducible NAC Transcription Factors That Bind to a Drought-Responsive cis-Element in the early responsive to dehydration stress 1 Promoter. Plant Cell 2004, 16, 2481–2498. [Google Scholar] [CrossRef] [Green Version]
- Bu, Q.; Jiang, H.; Li, C.-B.; Zhai, Q.; Zhang, J.; Wu, X.; Sun, J.; Xie, Q.; Li, C. Role of the Arabidopsis thaliana NAC transcription factors ANAC019 and ANAC055 in regulating jasmonic acid-signaled defense responses. Cell Res. 2008, 18, 756–767. [Google Scholar] [CrossRef] [Green Version]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [Green Version]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [Green Version]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef]
- Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
- Hiei, Y.; Komari, T. Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed. Nat. Protoc. 2008, 3, 824–834. [Google Scholar] [CrossRef] [PubMed]












| Variety | Treat | Seed Germination Rate | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Day 1 | Day 2 | Day 3 | Day 4 | Day 5 | Day 6 | Day 7 | Day 8 | ||
| Jinmi 4 | CK | 0% | 0% | 59% | 73% | 76% | 83% | 85% | 88% |
| NaCl | 0% | 0% | 2% | 13% | 16% | 18% | 24% | 24% | |
| Jinmi 9 | CK | 0% | 0% | 35% | 50% | 56% | 57% | 57% | 57% |
| NaCl | 0% | 0% | 7% | 24% | 26% | 26% | 26% | 26% | |
| Longmi 7 | CK | 0% | 0% | 51% | 65% | 77% | 81% | 84% | 85% |
| NaCl | 0% | 0% | 0% | 13% | 20% | 23% | 25% | 26% | |
| Longmi 8 | CK | 0% | 0% | 16% | 38% | 44% | 54% | 56% | 58% |
| NaCl | 0% | 0% | 3% | 16% | 23% | 24% | 26% | 26% | |
| Neimi 5 | CK | 0% | 0% | 36% | 43% | 44% | 51% | 51% | 52% |
| NaCl | 0% | 0% | 0% | 8% | 14% | 15% | 15% | 15% | |
| Neimi 6 | CK | 0% | 0% | 40% | 53% | 61% | 63% | 64% | 64% |
| NaCl | 0% | 0% | 2% | 14% | 21% | 24% | 26% | 26% | |
| Ningmi 10 | CK | 0% | 0% | 20% | 35% | 39% | 42% | 44% | 45% |
| NaCl | 0% | 0% | 1% | 5% | 17% | 19% | 23% | 23% | |
| Ningmi 11 | CK | 0% | 0% | 53% | 62% | 67% | 71% | 74% | 75% |
| NaCl | 0% | 0% | 1% | 1% | 1% | 1% | 1% | 1% | |
| Qingmi 1 | CK | 0% | 0% | 9% | 22% | 23% | 33% | 35% | 35% |
| NaCl | 0% | 0% | 1% | 5% | 6% | 6% | 6% | 6% | |
| Qingmi 2 | CK | 0% | 0% | 50% | 51% | 51% | 51% | 51% | 51% |
| NaCl | 0% | 0% | 16% | 23% | 23% | 23% | 25% | 25% | |
| Yumi 9 | CK | 0% | 0% | 97% | 100% | 100% | 100% | 100% | 100% |
| NaCl | 0% | 0% | 50% | 78% | 80% | 80% | 80% | 80% | |
| Yumi 8 | CK | 0% | 0% | 31% | 39% | 54% | 63% | 68% | 68% |
| NaCl | 0% | 0% | 0% | 16% | 26% | 28% | 38% | 42% | |
| Tianmi 1 | CK | 0% | 0% | 74% | 80% | 82% | 82% | 82% | 82% |
| NaCl | 0% | 0% | 24% | 41% | 47% | 47% | 47% | 49% | |
| Xingmi 1 | CK | 0% | 0% | 22% | 63% | 76% | 78% | 79% | 79% |
| NaCl | 0% | 0% | 0% | 0% | 1% | 1% | 2% | 2% | |
| Yanmi 7 | CK | 0% | 0% | 52% | 92% | 96% | 96% | 96% | 96% |
| NaCl | 0% | 0% | 0% | 3% | 23% | 27% | 30% | 31% | |
| Yanmi 8 | CK | 0% | 0% | 55% | 84% | 94% | 95% | 95% | 95% |
| NaCl | 0% | 0% | 0% | 2% | 11% | 20% | 24% | 29% | |
| Yumi 1 | CK | 0% | 0% | 37% | 64% | 69% | 71% | 74% | 75% |
| NaCl | 0% | 0% | 2% | 10% | 22% | 22% | 22% | 23% | |
| Sample ID | Clean Reads | Clean Bases | Q30 | GC Content | Mapped Reads | Uniq. Mapped Reads |
|---|---|---|---|---|---|---|
| Y9_CK1 | 29,724,228 | 8,894,995,347 | 88.79% | 62.95% | 80.66% | 79.15% |
| Y9_NA1 | 30,282,360 | 9,064,513,521 | 89.53% | 63.13% | 82.53% | 81.01% |
| Y9_CK2 | 30,648,074 | 9,178,726,745 | 88.54% | 58.36% | 82.39% | 80.08% |
| Y9_NA2 | 28,758,908 | 8,613,482,668 | 89.95% | 58.54% | 84.41% | 82.22% |
| Y9_CK3 | 29,993,545 | 8,981,924,205 | 89.85% | 58.21% | 84.57% | 82.51% |
| Y9_NA3 | 30,141,521 | 9,020,749,193 | 89.17% | 58.29% | 82.69% | 79.96% |
| Y1_CK1 | 28,755,425 | 8,607,858,315 | 88.49% | 60.93% | 72.93% | 71.51% |
| Y1_NA1 | 31,833,050 | 9,532,800,895 | 88.97% | 61.87% | 79.63% | 78.08% |
| Y1_CK2 | 27,836,385 | 8,333,972,016 | 89.90% | 58.94% | 79.83% | 77.98% |
| Y1_NA2 | 29,149,177 | 8,726,183,941 | 89.70% | 59.85% | 79.87% | 77.73% |
| Y1_CK3 | 26,299,506 | 7,872,286,537 | 88.83% | 58.50% | 77.64% | 75.49% |
| Y1_NA3 | 30,135,668 | 9,022,400,108 | 88.91% | 58.98% | 80.64% | 78.25% |
| Database | Annotated Number | Percentage (%) | 300 ≤ Length < 1000 | Length ≥ 1000 |
|---|---|---|---|---|
| COG | 18,435 | 30.56 | 5529 | 12,720 |
| GO | 44,154 | 73.19 | 16,756 | 26,132 |
| KEGG | 17,925 | 29.71 | 6798 | 10,722 |
| KOG | 28,998 | 48.06 | 9803 | 18,747 |
| Pfam | 47,074 | 78.03 | 17,310 | 28,871 |
| Swiss-Prot | 37,227 | 61.70 | 13,031 | 23,556 |
| eggNOG | 56,482 | 93.62 | 22,693 | 31,930 |
| Nr | 59,971 | 99.40 | 24,734 | 32,843 |
| All Annotated | 60,331 | 100.00 | 24,955 | 32,893 |
| Groups | Differentially Expressed Genes | Upregulated Genes | Downregulated Genes |
|---|---|---|---|
| Y9_CK1 vs. Y9_NA1 | 88 | 34 | 54 |
| Y9_CK2 vs. Y9_NA2 | 1898 | 613 | 1285 |
| Y9_CK3 vs. Y9_NA3 | 4316 | 2860 | 1456 |
| Y1_CK1 vs. Y1_NA1 | 77 | 58 | 19 |
| Y1_CK2 vs. Y1_NA2 | 425 | 97 | 328 |
| Y1_CK3 vs. Y1_NA3 | 3051 | 1447 | 1604 |
| Y1_CK1 vs. Y9_CK1 | 1182 | 718 | 464 |
| Y1_CK2 vs. Y9_CK2 | 2442 | 954 | 1488 |
| Y1_CK3 vs. Y9_CK3 | 1968 | 568 | 1400 |
| Y1_NA1 vs. Y9_NA1 | 910 | 548 | 362 |
| Y1_NA2 vs. Y9_NA2 | 1406 | 628 | 778 |
| Y1_NA3 vs. Y9_NA3 | 1338 | 477 | 861 |
| Variety | Serial Number 1 | Seed Coat Color | Waxy or Non-Waxy | Hardness |
|---|---|---|---|---|
| Jinmi 4 | a | white | waxy | fragile |
| Jinmi 9 | b | white | waxy | fragile |
| Longmi 7 | c | red | unknown | hard |
| Longmi 8 | d | red | unknown | hard |
| Neimi 5 | e | yellow | non-waxy | hard |
| Neimi 6 | f | yellow | non-waxy | hard |
| Ningmi 10 | g | red | unknown | hard |
| Ningmi 11 | h | red | unknown | hard |
| Qingmi 1 | i | red | unknown | hard |
| Qingmi 2 | j | yellow | non-waxy | hard |
| Yumi 9 | k | yellow | non-waxy | hard |
| Yumi 8 | l | red | unknown | hard |
| Tianmi 1 | m | red | unknown | hard |
| Xingmi 1 | n | black | unknown | hard |
| Yanmi 7 | o | yellow | non-waxy | hard |
| Yanmi 8 | p | yellow | non-waxy | hard |
| Yumi 1 | q | white | waxy | fragile |
| Gene Name | Description | Primers |
|---|---|---|
| PmbZIP33 | F | CCTTGGCAATGGACTGATGC |
| PmbZIP33 | R | GATGACAGGTCGCTGTACCC |
| PmbZIP131 | F | ACTGTGAGCCCGGTGGATAC |
| PmbZIP131 | R | CTCCCTCAAATGGGTACGGC |
| PmbZIP125 | F | CAGCGTCAAGACGGTGGAC |
| PmbZIP125 | R | GGAACTCCTCGAGCGTCATC |
| PmABI5 | F | TCAAGAACAGGGAGTCTGCG |
| PmABI5 | R | CCGTCCGAATGGATTCCTCA |
| PmbZIP97 | F | ATTCCGCCATGAAGTCGAGG |
| PmbZIP97 | R | GACTCCTGCATGGCTATGGG |
| PmbZIP89 | F | CAAAGGAACGAACACGCAGG |
| PmbZIP89 | R | GGCAAAGAGGTCGATGTCCA |
| PmbZIP118 | F | GCAGCGGCGGATGATAAAAA |
| PmbZIP118 | R | CAACTTGCCGGCTCATTCTC |
| Actin | F | GCGAGCTTCCCTGTAGGTAG |
| Actin | R | CGAACCCAGCCTTCACCATAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
An, P.; Li, X.; Liu, T.; Shui, Z.; Chen, M.; Gao, X.; Wang, Z. The Identification of Broomcorn Millet bZIP Transcription Factors, Which Regulate Growth and Development to Enhance Stress Tolerance and Seed Germination. Int. J. Mol. Sci. 2022, 23, 6448. https://doi.org/10.3390/ijms23126448
An P, Li X, Liu T, Shui Z, Chen M, Gao X, Wang Z. The Identification of Broomcorn Millet bZIP Transcription Factors, Which Regulate Growth and Development to Enhance Stress Tolerance and Seed Germination. International Journal of Molecular Sciences. 2022; 23(12):6448. https://doi.org/10.3390/ijms23126448
Chicago/Turabian StyleAn, Peipei, Xiang Li, Tianxiang Liu, Zhijie Shui, Mingxun Chen, Xin Gao, and Zhonghua Wang. 2022. "The Identification of Broomcorn Millet bZIP Transcription Factors, Which Regulate Growth and Development to Enhance Stress Tolerance and Seed Germination" International Journal of Molecular Sciences 23, no. 12: 6448. https://doi.org/10.3390/ijms23126448
APA StyleAn, P., Li, X., Liu, T., Shui, Z., Chen, M., Gao, X., & Wang, Z. (2022). The Identification of Broomcorn Millet bZIP Transcription Factors, Which Regulate Growth and Development to Enhance Stress Tolerance and Seed Germination. International Journal of Molecular Sciences, 23(12), 6448. https://doi.org/10.3390/ijms23126448

