A Dystrophin Exon-52 Deleted Miniature Pig Model of Duchenne Muscular Dystrophy and Evaluation of Exon Skipping
Abstract
:1. Introduction
2. Results
2.1. Generation of a Miniature Pig Model of Duchenne Muscular Dystrophy
2.2. Dystrophin Deficiency Causes Failed Recruitment of DAPs to the Sarcolemma of the Transgenic Pig Model
2.3. Severe Pathology in DMDex52del Pig Muscles
2.4. DMDex52del Pigs Exhibit Muscle Weakness and Poor Growth Rate
2.5. Design of Pig Antisense Oligonucleotide Sequences and Prediction of Exon Skipping Efficiency
2.6. PMO-Mediated Exon Skipping Is Feasible in DMDex52del Pig Skeletal Muscle Cells In Vitro
2.7. Peptide Conjugation to PMOs Potentiates Exon Skipping Efficiency in DMDex52del Pig Skeletal Muscle Cells
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Fetal Fibroblasts
4.3. Targeting Vector Construction
4.4. rAAV Vector Production
4.5. Generation of DMD Exon 52-Taregetted Pig Fibroblasts
4.6. Somatic Cell Nuclear Transfer and Embryo Transfer
4.7. Genotyping Assay and Southern Blotting
4.8. Creatine Kinase Levels
4.9. Tissue Samples
4.10. Histological Analyses
4.11. RT-PCR
4.12. Western Blotting
4.13. Design and Synthesis of Antisense Oligonucleotides
4.14. Primary Skeletal Muscle Cells of DMD Pigs
4.15. In Vitro PMO Transfection
4.16. Exon Skipping Efficiency
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hoffman, E.P.; Brown, R.H., Jr.; Kunkel, L.M. Dystrophin: The protein product of the Duchenne muscular dystrophy locus. Cell 1987, 51, 919–928. [Google Scholar] [CrossRef]
- Mah, J.K.; Korngut, L.; Dykeman, J.; Day, L.; Pringsheim, T.; Jette, N. A systematic review and meta-analysis on the epidemiology of Duchenne and Becker muscular dystrophy. Neuromuscul. Disord. 2014, 24, 482–491. [Google Scholar] [CrossRef]
- Bladen, C.L.; Salgado, D.; Monges, S.; Foncuberta, M.E.; Kekou, K.; Kosma, K.; Dawkins, H.; Lamont, L.; Roy, A.J.; Chamova, T.; et al. The TREAT-NMD DMD Global Database: Analysis of more than 7000 Duchenne muscular dystrophy mutations. Hum. Mutat. 2015, 36, 395–402. [Google Scholar] [CrossRef]
- Duan, D.; Goemans, N.; Takeda, S.; Mercuri, E.; Aartsma-Rus, A. Duchenne muscular dystrophy. Nat. Rev. Dis. Primers 2021, 7, 13. [Google Scholar] [CrossRef]
- Koeks, Z.; Bladen, C.L.; Salgado, D.; van Zwet, E.; Pogoryelova, O.; McMacken, G.; Monges, S.; Foncuberta, M.E.; Kekou, K.; Kosma, K.; et al. Clinical Outcomes in Duchenne Muscular Dystrophy: A Study of 5345 Patients from the TREAT-NMD DMD Global Database. J. Neuromuscul. Dis. 2017, 4, 293–306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mendell, J.R.; Shilling, C.; Leslie, N.D.; Flanigan, K.M.; al-Dahhak, R.; Gastier-Foster, J.; Kneile, K.; Dunn, D.M.; Duval, B.; Aoyagi, A.; et al. Evidence-based path to newborn screening for Duchenne muscular dystrophy. Ann. Neurol. 2012, 71, 304–313. [Google Scholar] [CrossRef] [PubMed]
- Cheeran, D.; Khan, S.; Khera, R.; Bhatt, A.; Garg, S.; Grodin, J.L.; Morlend, R.; Araj, F.G.; Amin, A.A.; Thibodeau, J.T.; et al. Predictors of Death in Adults with Duchenne Muscular Dystrophy-Associated Cardiomyopathy. J. Am. Heart Assoc. 2017, 6, e006340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Passamano, L.; Taglia, A.; Palladino, A.; Viggiano, E.; D’Ambrosio, P.; Scutifero, M.; Rosaria Cecio, M.; Torre, V.; De Luca, F.; Picillo, E.; et al. Improvement of survival in Duchenne Muscular Dystrophy: Retrospective analysis of 835 patients. Acta Myol. 2012, 31, 121–125. [Google Scholar]
- Verhaart, I.E.C.; Aartsma-Rus, A. Therapeutic developments for Duchenne muscular dystrophy. Nat. Rev. Neurol. 2019, 15, 373–386. [Google Scholar] [CrossRef]
- Sheikh, O.; Yokota, T. Developing DMD therapeutics: A review of the effectiveness of small molecules, stop-codon readthrough, dystrophin gene replacement, and exon-skipping therapies. Expert Opin. Investig. Drugs 2021, 30, 167–176. [Google Scholar] [CrossRef]
- Alfano, L.N.; Charleston, J.S.; Connolly, A.M.; Cripe, L.; Donoghue, C.; Dracker, R.; Dworzak, J.; Eliopoulos, H.; Frank, D.E.; Lewis, S.; et al. Long-term treatment with eteplirsen in nonambulatory patients with Duchenne muscular dystrophy. Medicine 2019, 98, e15858. [Google Scholar] [CrossRef]
- Frank, D.E.; Schnell, F.J.; Akana, C.; El-Husayni, S.H.; Desjardins, C.A.; Morgan, J.; Charleston, J.S.; Sardone, V.; Domingos, J.; Dickson, G.; et al. Increased dystrophin production with golodirsen in patients with Duchenne muscular dystrophy. Neurology 2020, 94, e2270–e2282. [Google Scholar] [CrossRef] [Green Version]
- Komaki, H.; Nagata, T.; Saito, T.; Masuda, S.; Takeshita, E.; Sasaki, M.; Tachimori, H.; Nakamura, H.; Aoki, Y.; Takeda, S. Systemic administration of the antisense oligonucleotide NS-065/NCNP-01 for skipping of exon 53 in patients with Duchenne muscular dystrophy. Sci. Transl. Med. 2018, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shirley, M. Casimersen: First Approval. Drugs 2021, 81, 875–879. [Google Scholar] [CrossRef] [PubMed]
- Tsoumpra, M.K.; Fukumoto, S.; Matsumoto, T.; Takeda, S.; Wood, M.J.A.; Aoki, Y. Peptide-conjugate antisense based splice-correction for Duchenne muscular dystrophy and other neuromuscular diseases. EBioMedicine 2019, 45, 630–645. [Google Scholar] [CrossRef] [Green Version]
- Gait, M.J.; Arzumanov, A.A.; McClorey, G.; Godfrey, C.; Betts, C.; Hammond, S.; Wood, M.J.A. Cell-Penetrating Peptide Conjugates of Steric Blocking Oligonucleotides as Therapeutics for Neuromuscular Diseases from a Historical Perspective to Current Prospects of Treatment. Nucleic Acid Ther. 2019, 29, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McGreevy, J.W.; Hakim, C.H.; McIntosh, M.A.; Duan, D. Animal models of Duchenne muscular dystrophy: From basic mechanisms to gene therapy. Dis. Models Mech. 2015, 8, 195–213. [Google Scholar] [CrossRef] [Green Version]
- Nghiem, P.P.; Kornegay, J.N. Gene therapies in canine models for Duchenne muscular dystrophy. Hum. Genet. 2019, 138, 483–489. [Google Scholar] [CrossRef] [PubMed]
- Yokota, T.; Lu, Q.L.; Partridge, T.; Kobayashi, M.; Nakamura, A.; Takeda, S.; Hoffman, E. Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann. Neurol. 2009, 65, 667–676. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, M.; Echigoya, Y.; Fukada, S.I.; Yokota, T. Current Translational Research and Murine Models for Duchenne Muscular Dystrophy. J. Neuromuscul. Dis. 2016, 3, 29–48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Echigoya, Y.; Nakamura, A.; Nagata, T.; Urasawa, N.; Lim, K.R.; Trieu, N.; Panesar, D.; Kuraoka, M.; Moulton, H.M.; Saito, T.; et al. Effects of systemic multiexon skipping with peptide-conjugated morpholinos in the heart of a dog model of Duchenne muscular dystrophy. Proc. Natl. Acad. Sci. USA 2017, 114, 4213–4218. [Google Scholar] [CrossRef] [Green Version]
- Yu, X.; Bao, B.; Echigoya, Y.; Yokota, T. Dystrophin-deficient large animal models: Translational research and exon skipping. Am. J. Transl. Res. 2015, 7, 1314–1331. [Google Scholar] [PubMed]
- Wells, D.J. Tracking progress: An update on animal models for Duchenne muscular dystrophy. Dis. Models Mech. 2018, 11, dmm035774. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rogers, C.S.; Hao, Y.; Rokhlina, T.; Samuel, M.; Stoltz, D.A.; Li, Y.; Petroff, E.; Vermeer, D.W.; Kabel, A.C.; Yan, Z.; et al. Production of CFTR-null and CFTR-DeltaF508 heterozygous pigs by adeno-associated virus-mediated gene targeting and somatic cell nuclear transfer. J. Clin. Investig. 2008, 118, 1571–1577. [Google Scholar] [CrossRef] [PubMed]
- Jang, G.; Kim, M.K.; Lee, B.C. Current status and applications of somatic cell nuclear transfer in dogs. Theriogenology 2010, 74, 1311–1320. [Google Scholar] [CrossRef]
- Hryhorowicz, M.; Lipiński, D.; Hryhorowicz, S.; Nowak-Terpiłowska, A.; Ryczek, N.; Zeyland, J. Application of Genetically Engineered Pigs in Biomedical Research. Genes 2020, 11, 670. [Google Scholar] [CrossRef]
- Echigoya, Y.; Lim, K.R.Q.; Nakamura, A.; Yokota, T. Multiple Exon Skipping in the Duchenne Muscular Dystrophy Hot Spots: Prospects and Challenges. J. Pers. Med. 2018, 8, 41. [Google Scholar] [CrossRef] [Green Version]
- Klymiuk, N.; Blutke, A.; Graf, A.; Krause, S.; Burkhardt, K.; Wuensch, A.; Krebs, S.; Kessler, B.; Zakhartchenko, V.; Kurome, M.; et al. Dystrophin-deficient pigs provide new insights into the hierarchy of physiological derangements of dystrophic muscle. Hum. Mol. Genet. 2013, 22, 4368–4382. [Google Scholar] [CrossRef] [Green Version]
- Yu, H.H.; Zhao, H.; Qing, Y.B.; Pan, W.R.; Jia, B.Y.; Zhao, H.Y.; Huang, X.X.; Wei, H.J. Porcine Zygote Injection with Cas9/sgRNA Results in DMD-Modified Pig with Muscle Dystrophy. Int. J. Mol. Sci. 2016, 17, 1668. [Google Scholar] [CrossRef] [Green Version]
- Matsunari, H.; Watanabe, M.; Nakano, K.; Enosawa, S.; Umeyama, K.; Uchikura, A.; Yashima, S.; Fukuda, T.; Klymiuk, N.; Kurome, M.; et al. Modeling lethal X-linked genetic disorders in pigs with ensured fertility. Proc. Natl. Acad. Sci. USA 2018, 115, 708–713. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moretti, A.; Fonteyne, L.; Giesert, F.; Hoppmann, P.; Meier, A.B.; Bozoglu, T.; Baehr, A.; Schneider, C.M.; Sinnecker, D.; Klett, K.; et al. Somatic gene editing ameliorates skeletal and cardiac muscle failure in pig and human models of Duchenne muscular dystrophy. Nat. Med. 2020, 26, 207–214. [Google Scholar] [CrossRef]
- Janghra, N.; Morgan, J.E.; Sewry, C.A.; Wilson, F.X.; Davies, K.E.; Muntoni, F.; Tinsley, J. Correlation of Utrophin Levels with the Dystrophin Protein Complex and Muscle Fibre Regeneration in Duchenne and Becker Muscular Dystrophy Muscle Biopsies. PLoS ONE 2016, 11, e0150818. [Google Scholar] [CrossRef]
- Matsumura, K.; Ervasti, J.M.; Ohlendieck, K.; Kahl, S.D.; Campbell, K.P. Association of dystrophin-related protein with dystrophin-associated proteins in mdx mouse muscle. Nature 1992, 360, 588–591. [Google Scholar] [CrossRef] [PubMed]
- Zucconi, E.; Valadares, M.C.; Vieira, N.M.; Bueno, C.R., Jr.; Secco, M.; Jazedje, T.; da Silva, H.C.; Vainzof, M.; Zatz, M. Ringo: Discordance between the molecular and clinical manifestation in a golden retriever muscular dystrophy dog. Neuromuscul. Disord. 2010, 20, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Echigoya, Y.; Lee, J.; Rodrigues, M.; Nagata, T.; Tanihata, J.; Nozohourmehrabad, A.; Panesar, D.; Miskew, B.; Aoki, Y.; Yokota, T. Mutation types and aging differently affect revertant fiber expansion in dystrophic mdx and mdx52 mice. PLoS ONE 2013, 8, e69194. [Google Scholar] [CrossRef] [PubMed]
- Valentine, B.A.; Cooper, B.J.; de Lahunta, A.; O’Quinn, R.; Blue, J.T. Canine x-linked muscular dystrophy. An animal model of duchenne muscular dystrophy: Clinical studies. J. Neurol. Sci. 1988, 88, 69–81. [Google Scholar] [CrossRef]
- Nakamura, A.; Kobayashi, M.; Kuraoka, M.; Yuasa, K.; Yugeta, N.; Okada, T.; Takeda, S. Initial pulmonary respiration causes massive diaphragm damage and hyper-CKemia in Duchenne muscular dystrophy dog. Sci. Rep. 2013, 3, 2183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Echigoya, Y.; Mouly, V.; Garcia, L.; Yokota, T.; Duddy, W. In silico screening based on predictive algorithms as a design tool for exon skipping oligonucleotides in duchenne muscular dystrophy. PLoS ONE 2015, 10, e0120058. [Google Scholar] [CrossRef] [PubMed]
- Echigoya, Y.; Lim, K.R.Q.; Trieu, N.; Bao, B.; Miskew Nichols, B.; Vila, M.C.; Novak, J.S.; Hara, Y.; Lee, J.; Touznik, A.; et al. Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy. Mol. Ther. J. Am. Soc. Gene Ther. 2017, 25, 2561–2572. [Google Scholar] [CrossRef] [Green Version]
- Lim, K.R.; Maruyama, R.; Yokota, T. Eteplirsen in the treatment of Duchenne muscular dystrophy. Drug Des. Dev. Ther. 2017, 11, 533–545. [Google Scholar] [CrossRef] [Green Version]
- Goemans, N.; Mercuri, E.; Belousova, E.; Komaki, H.; Dubrovsky, A.; McDonald, C.M.; Kraus, J.E.; Lourbakos, A.; Lin, Z.; Campion, G.; et al. A randomized placebo-controlled phase 3 trial of an antisense oligonucleotide, drisapersen, in Duchenne muscular dystrophy. Neuromuscul. Disord. 2018, 28, 4–15. [Google Scholar] [CrossRef] [Green Version]
- Godfrey, C.; Desviat, L.R.; Smedsrod, B.; Pietri-Rouxel, F.; Denti, M.A.; Disterer, P.; Lorain, S.; Nogales-Gadea, G.; Sardone, V.; Anwar, R.; et al. Delivery is key: Lessons learnt from developing splice-switching antisense therapies. EMBO Mol. Med. 2017, 9, 545–557. [Google Scholar] [CrossRef]
- Tone, Y.; Mamchaoui, K.; Tsoumpra, M.K.; Hashimoto, Y.; Terada, R.; Maruyama, R.; Gait, M.J.; Arzumanov, A.A.; McClorey, G.; Imamura, M.; et al. Immortalized Canine Dystrophic Myoblast Cell Lines for Development of Peptide-Conjugated Splice-Switching Oligonucleotides. Nucleic Acid Ther. 2021, 31, 172–181. [Google Scholar] [CrossRef]
- Yin, H.; Moulton, H.M.; Seow, Y.; Boyd, C.; Boutilier, J.; Iverson, P.; Wood, M.J. Cell-penetrating peptide-conjugated antisense oligonucleotides restore systemic muscle and cardiac dystrophin expression and function. Hum. Mol. Genet. 2008, 17, 3909–3918. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Teramoto, N.; Sugihara, H.; Yamanouchi, K.; Nakamura, K.; Kimura, K.; Okano, T.; Shiga, T.; Shirakawa, T.; Matsuo, M.; Nagata, T.; et al. Pathological evaluation of rats carrying in-frame mutations in the dystrophin gene: A new model of Becker muscular dystrophy. Dis. Models Mech. 2020, 13, dmm044701. [Google Scholar] [CrossRef]
- Wong, T.W.Y.; Ahmed, A.; Yang, G.; Maino, E.; Steiman, S.; Hyatt, E.; Chan, P.; Lindsay, K.; Wong, N.; Golebiowski, D.; et al. A novel mouse model of Duchenne muscular dystrophy carrying a multi-exonic Dmd deletion exhibits progressive muscular dystrophy and early-onset cardiomyopathy. Dis. Models Mech. 2020, 13, dmm045369. [Google Scholar] [CrossRef] [PubMed]
- Lim, K.R.Q.; Nguyen, Q.; Dzierlega, K.; Huang, Y.; Yokota, T. CRISPR-Generated Animal Models of Duchenne Muscular Dystrophy. Genes 2020, 11, 342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rogers, C.S.; Stoltz, D.A.; Meyerholz, D.K.; Ostedgaard, L.S.; Rokhlina, T.; Taft, P.J.; Rogan, M.P.; Pezzulo, A.A.; Karp, P.H.; Itani, O.A.; et al. Disruption of the CFTR gene produces a model of cystic fibrosis in newborn pigs. Science 2008, 321, 1837–1841. [Google Scholar] [CrossRef] [Green Version]
- Hou, D.R.; Jin, Y.; Nie, X.W.; Zhang, M.L.; Ta, N.; Zhao, L.H.; Yang, N.; Chen, Y.; Wu, Z.Q.; Jiang, H.B.; et al. Derivation of porcine embryonic stem-like cells from in vitro-produced blastocyst-stage embryos. Sci. Rep. 2016, 6, 25838. [Google Scholar] [CrossRef] [Green Version]
- Du, X.; Feng, T.; Yu, D.; Wu, Y.; Zou, H.; Ma, S.; Feng, C.; Huang, Y.; Ouyang, H.; Hu, X.; et al. Barriers for Deriving Transgene-Free Pig iPS Cells with Episomal Vectors. Stem Cells 2015, 33, 3228–3238. [Google Scholar] [CrossRef] [Green Version]
- Secher, J.O.; Liu, Y.; Petkov, S.; Luo, Y.; Li, D.; Hall, V.J.; Schmidt, M.; Callesen, H.; Bentzon, J.F.; Sørensen, C.B.; et al. Evaluation of porcine stem cell competence for somatic cell nuclear transfer and production of cloned animals. Anim. Reprod. Sci. 2017, 178, 40–49. [Google Scholar] [CrossRef] [Green Version]
- Echigoya, Y.; Aoki, Y.; Miskew, B.; Panesar, D.; Touznik, A.; Nagata, T.; Tanihata, J.; Nakamura, A.; Nagaraju, K.; Yokota, T. Long-term efficacy of systemic multiexon skipping targeting dystrophin exons 45–55 with a cocktail of vivo-morpholinos in mdx52 mice. Mol. Ther. Nucleic Acids 2015, 4, e225. [Google Scholar] [CrossRef] [PubMed]
- Meyers, T.A.; Townsend, D. Cardiac Pathophysiology and the Future of Cardiac Therapies in Duchenne Muscular Dystrophy. Int. J. Mol. Sci. 2019, 20, 4098. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yokota, T.; Lu, Q.L.; Morgan, J.E.; Davies, K.E.; Fisher, R.; Takeda, S.; Partridge, T.A. Expansion of revertant fibers in dystrophic mdx muscles reflects activity of muscle precursor cells and serves as an index of muscle regeneration. J. Cell Sci. 2006, 119, 2679–2687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yugeta, N.; Urasawa, N.; Fujii, Y.; Yoshimura, M.; Yuasa, K.; Wada, M.R.; Nakura, M.; Shimatsu, Y.; Tomohiro, M.; Takahashi, A.; et al. Cardiac involvement in Beagle-based canine X-linked muscular dystrophy in Japan (CXMDJ): Electrocardiographic, echocardiographic, and morphologic studies. BMC Cardiovasc. Disord. 2006, 6, 47. [Google Scholar] [CrossRef] [Green Version]
- Fine, D.M.; Shin, J.H.; Yue, Y.; Volkmann, D.; Leach, S.B.; Smith, B.F.; McIntosh, M.; Duan, D. Age-matched comparison reveals early electrocardiography and echocardiography changes in dystrophin-deficient dogs. Neuromuscul. Disord. 2011, 21, 453–461. [Google Scholar] [CrossRef] [Green Version]
- Zhao, J.; Whyte, J.; Prather, R.S. Effect of epigenetic regulation during swine embryogenesis and on cloning by nuclear transfer. Cell Tissue Res. 2010, 341, 13–21. [Google Scholar] [CrossRef] [PubMed]
- Jeong, P.S.; Sim, B.W.; Park, S.H.; Kim, M.J.; Kang, H.G.; Nanjidsuren, T.; Lee, S.; Song, B.S.; Koo, D.B.; Kim, S.U. Chaetocin Improves Pig Cloning Efficiency by Enhancing Epigenetic Reprogramming and Autophagic Activity. Int. J. Mol. Sci. 2020, 21, 4836. [Google Scholar] [CrossRef]
- Su, X.; Chen, W.; Cai, Q.; Liang, P.; Chen, Y.; Cong, P.; Huang, J. Production of non-mosaic genome edited porcine embryos by injection of CRISPR/Cas9 into germinal vesicle oocytes. J. Genet. Genom. Yi Chuan Xue Bao 2019, 46, 335–342. [Google Scholar] [CrossRef]
- Xie, J.; Ge, W.; Li, N.; Liu, Q.; Chen, F.; Yang, X.; Huang, X.; Ouyang, Z.; Zhang, Q.; Zhao, Y.; et al. Efficient base editing for multiple genes and loci in pigs using base editors. Nat. Commun. 2019, 10, 2852. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Araki, E.; Nakamura, K.; Nakao, K.; Kameya, S.; Kobayashi, O.; Nonaka, I.; Kobayashi, T.; Katsuki, M. Targeted disruption of exon 52 in the mouse dystrophin gene induced muscle degeneration similar to that observed in Duchenne muscular dystrophy. Biochem. Biophys. Res. Commun. 1997, 238, 492–497. [Google Scholar] [CrossRef] [PubMed]
- Aoki, Y.; Nakamura, A.; Yokota, T.; Saito, T.; Okazawa, H.; Nagata, T.; Takeda, S. In-frame dystrophin following exon 51-skipping improves muscle pathology and function in the exon 52-deficient mdx mouse. Mol. Ther. J. Am. Soc. Gene Ther. 2010, 18, 1995–2005. [Google Scholar] [CrossRef] [PubMed]
- Echigoya, Y.; Lim, K.R.Q.; Melo, D.; Bao, B.; Trieu, N.; Mizobe, Y.; Maruyama, R.; Mamchaoui, K.; Tanihata, J.; Aoki, Y.; et al. Exons 45-55 Skipping Using Mutation-Tailored Cocktails of Antisense Morpholinos in the DMD Gene. Mol. Ther. J. Am. Soc. Gene Ther. 2019. [Google Scholar] [CrossRef]
- Park, D.S.; Cerrone, M.; Morley, G.; Vasquez, C.; Fowler, S.; Liu, N.; Bernstein, S.A.; Liu, F.Y.; Zhang, J.; Rogers, C.S.; et al. Genetically engineered SCN5A mutant pig hearts exhibit conduction defects and arrhythmias. J. Clin. Investig. 2015, 125, 403–412. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lai, L.; Prather, R.S. Production of cloned pigs by using somatic cells as donors. Cloning Stem Cells 2003, 5, 233–241. [Google Scholar] [CrossRef] [PubMed]
- Pomp, D.; Good, B.A.; Geisert, R.D.; Corbin, C.J.; Conley, A.J. Sex identification in mammals with polymerase chain reaction and its use to examine sex effects on diameter of day-10 or -11 pig embryos. J. Anim. Sci. 1995, 73, 1408–1415. [Google Scholar] [CrossRef] [PubMed]
- White, K.A.; Swier, V.J.; Cain, J.T.; Kohlmeyer, J.L.; Meyerholz, D.K.; Tanas, M.R.; Uthoff, J.; Hammond, E.; Li, H.; Rohret, F.A.; et al. A porcine model of neurofibromatosis type 1 that mimics the human disease. JCI Insight 2018, 3. [Google Scholar] [CrossRef] [PubMed]
- Walker, S.C.; Shin, T.; Zaunbrecher, G.M.; Romano, J.E.; Johnson, G.A.; Bazer, F.W.; Piedrahita, J.A. A highly efficient method for porcine cloning by nuclear transfer using in vitro-matured oocytes. Cloning Stem Cells 2002, 4, 105–112. [Google Scholar] [CrossRef]
- Sieren, J.C.; Meyerholz, D.K.; Wang, X.J.; Davis, B.T.; Newell, J.D., Jr.; Hammond, E.; Rohret, J.A.; Rohret, F.A.; Struzynski, J.T.; Goeken, J.A.; et al. Development and translational imaging of a TP53 porcine tumorigenesis model. J. Clin. Investig. 2014, 124, 4052–4066. [Google Scholar] [CrossRef] [Green Version]
- Yokota, T.; Hoffman, E.; Takeda, S. Antisense oligo-mediated multiple exon skipping in a dog model of duchenne muscular dystrophy. Methods Mol. Biol. 2011, 709, 299–312. [Google Scholar] [CrossRef] [Green Version]
Name | Oligo Sequence (5′ to 3′) | Target Exon | mer | Predicted Skip % | Ranking | Distance from Ac |
---|---|---|---|---|---|---|
pEx51_Ac0 | GTGTCACCAGAGTAACAGTCTGACTAGTAG | 51 | 30 | 79.7 | 6 | 0 |
pEx51_Ac5 | GGGTTGTGTCACCAGAGTAACAGTCTGACT | 51 | 30 | 89.1 | 1 | 5 |
pEx51_Ac48 | ATGGCATTTCTGGTTTGGAGATGGCAGTTT | 51 | 30 | 37.1 | 80 | 48 |
pEte_Ac65 | CTCCAACAGCAAGGAAGATGGCATTTCTGG | 51 | 30 | 55.4 | 34 | 65 |
pDri_Ac67 | GCAAGGAAGATGGCATTTCT | 51 | 20 | NA | NA | 67 |
pEx53_Ac9 | GTTCCTGGACCTCATCCCACTGACTCTGTA | 53 | 30 | 88.8 | 1 | 9 |
pEx53_Ac17 | CTGAAGGTGTTCCTGGACCTCATCCCACTG | 53 | 30 | 77.8 | 7 | 17 |
pEx53_Ac18 | TCTGAAGGTGTTCCTGGACCTCATCCCACT | 53 | 30 | 70.0 | 16 | 18 |
pEx53_Ac26 | CCTTCTGTTCTGAAGGTGTTCCTGGACCTC | 53 | 30 | 75.6 | 10 | 26 |
pEx53_Ac30 | GTTGCCTTCTGTTCTGAAGGTGTTCCTGGA | 53 | 30 | 53.4 | 30 | 30 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Echigoya, Y.; Trieu, N.; Duddy, W.; Moulton, H.M.; Yin, H.; Partridge, T.A.; Hoffman, E.P.; Kornegay, J.N.; Rohret, F.A.; Rogers, C.S.; et al. A Dystrophin Exon-52 Deleted Miniature Pig Model of Duchenne Muscular Dystrophy and Evaluation of Exon Skipping. Int. J. Mol. Sci. 2021, 22, 13065. https://doi.org/10.3390/ijms222313065
Echigoya Y, Trieu N, Duddy W, Moulton HM, Yin H, Partridge TA, Hoffman EP, Kornegay JN, Rohret FA, Rogers CS, et al. A Dystrophin Exon-52 Deleted Miniature Pig Model of Duchenne Muscular Dystrophy and Evaluation of Exon Skipping. International Journal of Molecular Sciences. 2021; 22(23):13065. https://doi.org/10.3390/ijms222313065
Chicago/Turabian StyleEchigoya, Yusuke, Nhu Trieu, William Duddy, Hong M. Moulton, HaiFang Yin, Terence A. Partridge, Eric P. Hoffman, Joe N. Kornegay, Frank A. Rohret, Christopher S. Rogers, and et al. 2021. "A Dystrophin Exon-52 Deleted Miniature Pig Model of Duchenne Muscular Dystrophy and Evaluation of Exon Skipping" International Journal of Molecular Sciences 22, no. 23: 13065. https://doi.org/10.3390/ijms222313065
APA StyleEchigoya, Y., Trieu, N., Duddy, W., Moulton, H. M., Yin, H., Partridge, T. A., Hoffman, E. P., Kornegay, J. N., Rohret, F. A., Rogers, C. S., & Yokota, T. (2021). A Dystrophin Exon-52 Deleted Miniature Pig Model of Duchenne Muscular Dystrophy and Evaluation of Exon Skipping. International Journal of Molecular Sciences, 22(23), 13065. https://doi.org/10.3390/ijms222313065