Protective Effects of Lactobacillus plantarum Lac16 on Clostridium perfringens Infection-Associated Injury in IPEC-J2 Cells
Abstract
:1. Introduction
2. Results
2.1. L. plantarum Lac16 Inhibited the Growth and Biofilm Formation of C. perfringens
2.2. L. plantarum Lac16 Enhanced mRNA Expression of Host Defense Peptides (HDPs) in IPEC-J2 Cells
2.3. L. plantarum Lac16 Alleviated C. perfringens Infection-Associated Lactate Dehydrogenase (LDH) Leakage
2.4. L. plantarum Lac16 Suppressed the Adhesion of C. perfringens to IPEC-J2 Cells
2.5. L. plantarum Lac16 Attenuated C. perfringens-Induced Damage to Intestinal Epithelial Barrier Function
2.6. L. plantarum Lac16 Alleviated C. perfringens-Induced Inflammatory Response
2.7. L. plantarum Lac16 Alleviated the Increase in mRNA Expression Levels of Pattern Recognition Receptors (PRRs) Induced by C. perfringens Infection
2.8. L. plantarum Lac16 Alleviated Inflammatory Response Induced by C. perfringens Infection by Nuclear Factor Kappa B (NF-κB) Signaling Pathways
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Culture Conditions
4.2. Bacteriostasis Detection of LFS to C. perfringens
4.3. Determination of Biofilm Formation of C. perfringens
4.4. Co-Culture Experiment and pH Determination of Bacterial Cultures
4.5. IPEC-J2 Cells Culture
4.6. Determination of Expression Levels of HDPs by Real-Time PCR
4.7. Cytotoxicity Assay
4.8. Determination of C. perfringens Adhesion to IPEC-J2 Cells
4.9. Cell Permeability to Fluorescein Sodium
4.10. Immunofluorescence Analysis
4.11. PAS Staining
4.12. Quantitative Real-Time PCR
4.13. Western Blot Analysis
4.14. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- O’Brien, D.K.; Melville, S.B. Effects of Clostridium perfringens Alpha-Toxin (PLC) and Perfringolysin O (PFO) on Cytotoxicity to Macrophages, on Escape from the Phagosomes of Macrophages, and on Persistence of C. perfringens in Host Tissues. Infect. Immun. 2004, 72, 5204–5215. [Google Scholar] [CrossRef] [Green Version]
- Hassan, K.; Elbourne, L.; Tetu, S.; Melville, S.B.; Rood, J.I.; Paulsen, I.T. Genomic analyses of Clostridium perfringens isolates from five toxinotypes. Res. Microbiol. 2015, 166, 255–263. [Google Scholar] [CrossRef]
- Songer, J.G. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 1996, 9, 216–234. [Google Scholar] [CrossRef]
- Lindström, M.; Heikinheimo, A.; Lahti, P.; Korkeala, H. Novel insights into the epidemiology of Clostridium perfringens type A food poisoning. Food Microbiol. 2011, 28, 192–198. [Google Scholar] [CrossRef]
- Charlebois, A.; Jacques, M.; Boulianne, M.; Archambault, M. Tolerance of Clostridium perfringens biofilms to disinfectants commonly used in the food industry. Food Microbiol. 2017, 62, 32–38. [Google Scholar] [CrossRef]
- Kondo, F. In vitro lecithinase activity and sensitivity to 22 antimicrobial agents of Clostridium perfringens isolated from necrotic enteritis of broiler chickens. Res. Veter-Sci. 1988, 45, 337–340. [Google Scholar] [CrossRef]
- Weese, J.S.; Staempfli, H.R.; Prescott, J.F.; Kruth, S.A.; Greenwood, S.J.; Weese, H.E. The Roles of Clostridium difficile and Enterotoxigenic Clostridium perfringens in Diarrhea in Dogs. J. Veter-Intern. Med. 2001, 15, 374–378. [Google Scholar] [CrossRef]
- Revitt-Mills, S.A.; Rood, J.I.; Adams, V. Clostridium perfringens extracellular toxins and enzymes: 20 and counting. Microbiol. Aust. 2015, 36, 114. [Google Scholar] [CrossRef]
- Petit, L.; Gibert, M.; Popoff, M.R. Clostridium perfringens: Toxinotype and genotype. Trends Microbiol. 1999, 7, 104–110. [Google Scholar] [CrossRef]
- Mengel, H.; Kruger, M.; Kruger, M.U.; Westphal, B.; Swidsinski, A.; Schwarz, S.; Mundt, H.-C.; Dittmar, K.; Daugschies, A. Necrotic enteritis due to simultaneous infection with Isospora suis and clostridia in newborn piglets and its prevention by early treatment with toltrazuril. Parasitol. Res. 2011, 110, 1347–1355. [Google Scholar] [CrossRef]
- Kiu, R.; Hall, L.J. An update on the human and animal enteric pathogen Clostridium perfringens. Emerg. Microbes Infect. 2018, 7, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Nedbalcová, K.; Zouharová, M. Resistance of isolates of Clostridium perfringens type a from pig management in the Czech Republic to the selected antimicrobials. Veterinářství 2018, 68, 640–644. [Google Scholar]
- Zheng, X.; Wang, X.; Teng, D.; Mao, R.; Hao, Y.; Yang, N.; Zong, L.; Wang, J. Mode of action of plectasin-derived peptides against gas gangrene-associated Clostridium perfringens type A. PLoS ONE 2017, 12, e0185215. [Google Scholar] [CrossRef] [Green Version]
- Fasina, Y.O.; Newman, M.M.; Stough, J.M.; Liles, M.R. Effect of Clostridium perfringens infection and antibiotic administration on microbiota in the small intestine of broiler chickens. Poult. Sci. 2016, 95, 247–260. [Google Scholar] [CrossRef]
- Luo, R.; Yang, Q.; Huang, X.; Yan, Z.; Gao, X.; Wang, W.; Xie, K.; Wang, P.; Gun, S. Clostridium perfringens beta2 toxin induced in vitro oxidative damage and its toxic assessment in porcine small intestinal epithelial cell lines. Gene 2020, 759, 144999. [Google Scholar] [CrossRef]
- Posthaus, H.; Kittl, S.; Tarek, B.; Bruggisser, J. Clostridium perfringens type C necrotic enteritis in pigs: Diagnosis, pathogenesis, and prevention. J. Veter-Diagn. Investig. 2020, 32, 203–212. [Google Scholar] [CrossRef] [Green Version]
- Gharaibeh, M.; Khalifeh, M.; Nawasreh, A.; Hananeh, W.; Awawdeh, M. Assessment of Immune Response and Efficacy of Essential Oils Application on Controlling Necrotic Enteritis Induced by Clostridium perfringens in Broiler Chickens. Molecules 2021, 26, 4527. [Google Scholar] [CrossRef]
- Rajput, D.S.; Zeng, D.; Khalique, A.; Rajput, S.S.; Wang, H.; Zhao, Y.; Sun, N.; Ni, X. Pretreatment with probiotics ameliorate gut health and necrotic enteritis in broiler chickens, a substitute to antibiotics. AMB Express 2020, 10, 220. [Google Scholar] [CrossRef]
- Al-Sagan, A.A.; Abudabos, A.M. Effect of a prebiotic, probiotic and symbiotic on performance of broilers under Clostridium Perfringens challenge. Thai J. Vet. Med. 2017, 47, 257–264. [Google Scholar]
- Friedlein, U.; Dorn-In, S.; Schwaiger, K. Antimicrobial effects of plant extracts against Clostridium perfringens with respect to food-relevant influencing factors. J. Food Prot. 2021, 84, 1809–1818. [Google Scholar] [CrossRef]
- Reid, G.; Jass, J.; Sebulsky, M.T.; McCormick, J.K. Potential Uses of Probiotics in Clinical Practice. Clin. Microbiol. Rev. 2003, 16, 658–672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Y.; Zeng, Z.; Xu, Y.; Ying, J.; Wang, B.; Majeed, M.; Majeed, S.; Pande, A.; Li, W. Application of Bacillus coagulans in Animal Husbandry and Its Underlying Mechanisms. Animals 2020, 10, 454. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Yin, F.; Zhu, C.; Yu, H.; Niven, S.; De Lange, C.; Gong, J. Evaluation of probiotic bacteria for their effects on the growth performance and intestinal microbiota of newly-weaned pigs fed fermented high-moisture maize. Livest. Sci. 2012, 145, 79–86. [Google Scholar] [CrossRef]
- Hao, Q.; Dong, B.R.; Wu, T. Probiotics for preventing acute upper respiratory tract infections. Cochrane Database Syst. Rev. 2015, CD006895. [Google Scholar] [CrossRef]
- Guo, S.; Liu, D.; Zhang, B.; Li, Z.; Li, Y.; Ding, B.; Guo, Y. Two Lactobacillus Species Inhibit the Growth and α-Toxin Production of Clostridium perfringens and Induced Proinflammatory Factors in Chicken Intestinal Epithelial Cells in Vitro. Front. Microbiol. 2017, 8, 2081. [Google Scholar] [CrossRef]
- Li, Z.; Wang, W.; Liu, D.; Guo, Y. Effects of Lactobacillus acidophilus on the growth performance and intestinal health of broilers challenged with Clostridium perfringens. J. Anim. Sci. Biotechnol. 2018, 9, 25. [Google Scholar] [CrossRef] [Green Version]
- Xu, T.; Chen, Y.; Yu, L.; Wang, J.; Huang, M.; Zhu, N. Effects of Lactobacillus plantarum on intestinal integrity and immune responses of egg-laying chickens infected with Clostridium perfringens under the free-range or the specific pathogen free environment. BMC Veter-Res. 2020, 16, 47. [Google Scholar] [CrossRef] [Green Version]
- Kizerwetter-Swida, M.; Binek, M. Protective effect of potentially probiotic Lactobacillus strain on infection with pathogenic bacteria in chickens. Pol. J. Veter-Sci. 2009, 12, 15–20. [Google Scholar]
- Cao, L.; Yang, X.; Li, Z.; Sun, F.; Wu, X.; Yao, J. Reduced lesions in chickens with Clostridium perfringens-induced necrotic enteritis by Lactobacillus fermentum 1.20291. Poult. Sci. 2012, 91, 3065–3071. [Google Scholar] [CrossRef]
- Gong, L.; Wang, B.; Zhou, Y.; Tang, L.; Zeng, Z.; Zhang, H.; Li, W. Protective Effects of Lactobacillus plantarum 16 and Paenibacillus polymyxa 10 Against Clostridium perfringens Infection in Broilers. Front. Immunol. 2021, 11, 11. [Google Scholar] [CrossRef]
- Liu, H.-Y.; Roos, S.; Jonsson, H.; Ahl, D.; Dicksved, J.; Lindberg, J.E.; Lundh, T. Effects of Lactobacillus johnsonii and Lactobacillus reuteri on gut barrier function and heat shock proteins in intestinal porcine epithelial cells. Physiol. Rep. 2015, 3, e12355. [Google Scholar] [CrossRef]
- Brosnahan, A.J.; Brown, D.R. Porcine IPEC-J2 intestinal epithelial cells in microbiological investigations. Veter-Microbiol. 2012, 156, 229–237. [Google Scholar] [CrossRef] [Green Version]
- Hancock, R.E.W.; Sahl, H.-G. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat. Biotechnol. 2006, 24, 1551–1557. [Google Scholar] [CrossRef]
- Wang, J.; Zeng, Y.; Wang, S.; Liu, H.; Zhang, D.; Zhang, W.; Wang, Y.; Ji, H. Swine-Derived Probiotic Lactobacillus plantarum Inhibits Growth and Adhesion of Enterotoxigenic Escherichia coli and Mediates Host Defense. Front. Microbiol. 2018, 9, 1364. [Google Scholar] [CrossRef] [PubMed]
- Blyth, G.; Connors, L.; Fodor, C.; Cobo, E.R. The Network of Colonic Host Defense Peptides as an Innate Immune Defense against Enteropathogenic Bacteria. Front. Immunol. 2020, 11, 965. [Google Scholar] [CrossRef] [PubMed]
- Xiao, K.; Liu, C.; Tu, Z.; Xu, Q.; Chen, S.; Zhang, Y.; Wang, X.; Zhang, J.; Hu, C.-A.A.; Liu, Y. Activation of the NF-κB and MAPK signaling pathways contributes to the inflammatory responses, but not cell injury, in IPEC-1 cells challenged with hydrogen peroxide. Oxidative Med. Cell. Longev. 2020, 2020, 5803639. [Google Scholar] [CrossRef] [Green Version]
- Kumar, P.; Nagarajan, A.; Uchil, P. Analysis of Cell Viability by the Lactate Dehydrogenase Assay. Cold Spring Harb. Protoc. 2018, 2018, pdb.prot095497. [Google Scholar] [CrossRef] [PubMed]
- Collado, M.C.; Gueimonde, M.; Salminen, S. Probiotics in adhesion of pathogens: Mechanisms of action. In Bioactive Foods in Promoting Health; Elsevier: Amsterdam, The Netherlands, 2010; pp. 353–370. [Google Scholar]
- Bröer, S.; Fairweather, S.J. Amino Acid Transport across the Mammalian Intestine. Compr. Physiol. 2018, 9, 343–373. [Google Scholar] [CrossRef]
- Fairweather, S.J.; Shah, N.; Bröer, S. Heteromeric Solute Carriers: Function, Structure, Pathology and Pharmacology. Adv. Exp. Med. Biol. 2020, 21, 13–127. [Google Scholar] [CrossRef]
- Zhang, B.; Gan, L.; Shahid, M.S.; Lv, Z.; Fan, H.; Liu, D.; Guo, Y. In vivo and in vitro protective effect of arginine against intestinal inflammatory response induced by Clostridium perfringens in broiler chickens. J. Anim. Sci. Biotechnol. 2019, 10, 73. [Google Scholar] [CrossRef]
- Bortoluzzi, C.; Lumpkins, B.; Mathis, G.; França, M.; King, W.; Graugnard, D.; Dawson, K.; Applegate, T. Zinc source modulates intestinal inflammation and intestinal integrity of broiler chickens challenged with coccidia and Clostridium perfringens. Poult. Sci. 2019, 98, 2211–2219. [Google Scholar] [CrossRef] [PubMed]
- Berri, M.; Olivier, M.; Holbert, S.; Dupont, J.; Demais, H.; Le Goff, M.; Collen, P.N. Ulvan from Ulva armoricana (Chlorophyta) activates the PI3K/Akt signalling pathway via TLR4 to induce intestinal cytokine production. Algal Res. 2017, 28, 39–47. [Google Scholar] [CrossRef]
- Wellnitz, O.; Bruckmaier, R.M. The innate immune response of the bovine mammary gland to bacterial infection. Vet. J. 2012, 192, 148–152. [Google Scholar] [CrossRef] [PubMed]
- Qiao, J.; Sun, Z.; Liang, D.; Li, H. Lactobacillus salivarius alleviates inflammation via NF-κB signaling in ETEC K88-induced IPEC-J2 cells. J. Anim. Sci. Biotechnol. 2020, 11, 76. [Google Scholar] [CrossRef]
- Chen, L.; Guanglin, J.; Ying, Q.; Kang, S.; Yan, M.; Pengyan, W.; Jianjun, J. Effect of Pig Lactobacillus to Salmonella, Escherichia coli Adhesion on Pig Small Intestinal Epithelial Cell. Acta Agric. Boreali-Occident. Sin. 2013, 9, 18–23. [Google Scholar]
- Muyyarikkandy, M.S.; Amalaradjou, M.A. Lactobacillus bulgaricus, Lactobacillus rhamnosus and Lactobacillus paracasei Attenuate Salmonella Enteritidis, Salmonella Heidelberg and Salmonella Typhimurium Colonization and Virulence Gene Expression In Vitro. Int. J. Mol. Sci. 2017, 18, 2381. [Google Scholar] [CrossRef] [Green Version]
- Khaneghah, A.M.; Abhari, K.; Eş, I.; Soares, M.B.; Oliveira, R.B.; Hosseini, H.; Rezaei, M.; Balthazar, C.F.; Silva, R.; Cruz, A.G.; et al. Interactions between probiotics and pathogenic microorganisms in hosts and foods: A review. Trends Food Sci. Technol. 2020, 95, 205–218. [Google Scholar] [CrossRef]
- Geraldo, B.M.C.; Batalha, M.N.; Milhan, N.V.M.; Rossoni, R.D.; Scorzoni, L.; Anbinder, A.L. Heat-killed Lactobacillus reuteri and cell-free culture supernatant have similar effects to viable probiotics during interaction with Porphyromonas gingivalis. J. Periodontal Res. 2019, 55, 215–220. [Google Scholar] [CrossRef]
- Varga, J.; Therit, B.; Melville, S.B. Type IV Pili and the CcpA Protein Are Needed for Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium perfringens. Infect. Immun. 2008, 76, 4944–4951. [Google Scholar] [CrossRef] [Green Version]
- Biel, M.A. Photodynamic Therapy of Bacterial and Fungal Biofilm Infections. In Photodynamic Therapy; Humana Press: Totowa, NJ, USA, 2010; Volume 635, pp. 175–194. [Google Scholar]
- Ołdak, A.; Zielińska, D.; Rzepkowska, A.; Kołożyn-Krajewska, D. Comparison of Antibacterial Activity of Lactobacillus plantarum Strains Isolated from Two Different Kinds of Regional Cheeses from Poland: Oscypek and Korycinski Cheese. BioMed Res. Int. 2017, 2017, 6820369. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; McClane, B.A. Comparative Effects of Osmotic, Sodium Nitrite-Induced, and pH-Induced Stress on Growth and Survival of Clostridium perfringens Type A Isolates Carrying Chromosomal or Plasmid-Borne Enterotoxin Genes. Appl. Environ. Microbiol. 2006, 72, 7620–7625. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Adachi, K.; Ohtani, K.; Kawano, M.; Singh, R.P.; Yousuf, B.; Sonomoto, K.; Shimizu, T.; Nakayama, J. Metabolic dependent and independent pH-drop shuts down VirSR quorum sensing in Clostridium perfringens. J. Biosci. Bioeng. 2018, 125, 525–531. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Deng, J.; Li, Y.; Yang, Q. The effect of Lactobacillus on the expression of porcine β-defensin-2 in the digestive tract of piglets. Livest. Sci. 2011, 138, 259–265. [Google Scholar] [CrossRef]
- Liu, H.; Hou, C.; Wang, G.; Jia, H.; Yu, H.; Zeng, X.; A Thacker, P.; Zhang, G.; Qiao, S. Lactobacillus reuteri I5007 Modulates Intestinal Host Defense Peptide Expression in the Model of IPEC-J2 Cells and Neonatal Piglets. Nutrients 2017, 9, 559. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Zhang, W.; Wang, S.; Liu, H.; Zhang, D.; Wang, Y.; Ji, H. Swine-Derived Probiotic Lactobacillus plantarum Modulates Porcine Intestinal Endogenous Host Defense Peptide Synthesis Through TLR2/MAPK/AP-1 Signaling Pathway. Front. Immunol. 2019, 10, 2691. [Google Scholar] [CrossRef] [Green Version]
- Veldhuizen, E.J.; Rijnders, M.; Claassen, E.A.; van Dijk, A.; Haagsman, H.P. Porcine β-defensin 2 displays broad antimicrobial activity against pathogenic intestinal bacteria. Mol. Immunol. 2008, 45, 386–394. [Google Scholar] [CrossRef]
- Navarro, M.A.; McClane, B.A.; Uzal, F.A. Mechanisms of Action and Cell Death Associated with Clostridium perfringens Toxins. Toxins 2018, 10, 212. [Google Scholar] [CrossRef] [Green Version]
- Chan, F.K.-M.; Moriwaki, K.; De Rosa, M.J. Detection of Necrosis by Release of Lactate Dehydrogenase Activity. Methods Mol. Biol. 2013, 979, 65–70. [Google Scholar] [CrossRef] [Green Version]
- Rayamajhi, M.; Zhang, Y.; Miao, E.A. Detection of Pyroptosis by Measuring Released Lactate Dehydrogenase Activity. Methods Mol. Biol. 2013, 1040, 85–90. [Google Scholar] [CrossRef] [Green Version]
- Mazkour, S.; Shekarforoush, S.S.; Basiri, S.; Nazifi, S.; Yektaseresht, A.; Honarmand, M. Effects of two probiotic spores of Bacillus species on hematological, biochemical, and inflammatory parameters in Salmonella Typhimurium infected rats. Sci. Rep. 2020, 10, 8035. [Google Scholar] [CrossRef]
- Wu, Q.; Zhu, Y.-H.; Xu, J.; Liu, X.; Duan, C.; Wang, M.-J.; Wang, J.-F. Lactobacillus rhamnosus GR-1 Ameliorates Escherichia coli-Induced Activation of NLRP3 and NLRC4 Inflammasomes with Differential Requirement for ASC. Front. Microbiol. 2018, 9, 1661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qiao, Z.; Chen, J.; Zhou, Q.; Wang, X.; Shan, Y.; Yi, Y.; Liu, B.; Zhou, Y.; Lü, X. Purification, characterization, and mode of action of a novel bacteriocin BM173 from Lactobacillus crustorum MN047 and its effect on biofilm formation of Escherichia coli and Staphylococcus aureus. J. Dairy Sci. 2021, 104, 1474–1483. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Hussain, A.; Zhou, Y.; Zeng, Z.; Wang, Q.; Zou, P.; Gong, L.; Zhao, P.; Li, W. Saccharomyces boulardii attenuates inflammatory response induced by Clostridium perfringens via TLR4/TLR15-MyD8 pathway in HD11 avian macrophages. Poult. Sci. 2020, 99, 5356–5365. [Google Scholar] [CrossRef] [PubMed]
- Gudiña, E.J.; Fernandes, E.C.; Teixeira, J.A.; Rodrigues, L.R. Antimicrobial and anti-adhesive activities of cell-bound biosurfactant from Lactobacillus agilis CCUG31450. RSC Adv. 2015, 5, 90960–90968. [Google Scholar] [CrossRef] [Green Version]
- Salminen, S.; Nybom, S.; Meriluoto, J.; Collado, M.C.; Vesterlund, S.; El-Nezami, H. Interaction of probiotics and pathogens—benefits to human health? Curr. Opin. Biotechnol. 2010, 21, 157–167. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Devi, S.; Park, J.; Kim, I. Effects of complex probiotic supplementation in growing pig diets with and without palm kernel expellers on growth performance, nutrient digestibility, blood parameters, fecal microbial shedding and noxious gas emission. Anim. Sci. J. 2018, 89, 552–560. [Google Scholar] [CrossRef]
- A McClane, B. Clostridium perfringens type C isolates rapidly upregulate their toxin production upon contact with host cells. Virulence 2010, 1, 97–100. [Google Scholar] [CrossRef] [Green Version]
- Collado, M.C.; Grześkowiak, Ł.; Salminen, S. Probiotic Strains and Their Combination Inhibit In Vitro Adhesion of Pathogens to Pig Intestinal Mucosa. Curr. Microbiol. 2007, 55, 260–265. [Google Scholar] [CrossRef]
- Chelakkot, C.; Ghim, J.; Ryu, S.H. Mechanisms regulating intestinal barrier integrity and its pathological implications. Exp. Mol. Med. 2018, 50, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Fan, H.; Chen, Z.; Lin, R.; Liu, Y.; Wu, X.; Puthiyakunnon, S.; Wang, Y.; Zhu, B.; Zhang, Q.; Bai, Y.; et al. Bacteroides fragilis Strain ZY-312 Defense against Cronobacter sakazakii-Induced Necrotizing Enterocolitis In Vitro and in a Neonatal Rat Model. mSystems 2019, 4, e00305-19. [Google Scholar] [CrossRef] [Green Version]
- Hartsock, A.; Nelson, W.J. Adherens and tight junctions: Structure, function and connections to the actin cytoskeleton. Biochim. Biophys. Acta (BBA)-Biomembr. 2008, 1778, 660–669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, B.; Moon, K.M.; Kim, C.Y. Tight Junction in the Intestinal Epithelium: Its Association with Diseases and Regulation by Phytochemicals. J. Immunol. Res. 2018, 2018, 2645465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Awad, W.A.; Hess, C.; Hess, M. Enteric Pathogens and Their Toxin-Induced Disruption of the Intestinal Barrier through Alteration of Tight Junctions in Chickens. Toxins 2017, 9, 60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blackwood, B.P.; Yuan, C.Y.; Wood, D.R.; Nicolas, J.D.; Grothaus, J.S.; Hunter, C.J. Probiotic Lactobacillus Species Strengthen Intestinal Barrier Function and Tight Junction Integrity in Experimental Necrotizing Enterocolitis. J. Probiotics Health 2017, 5, 159. [Google Scholar] [CrossRef]
- Che, S.-Y.; Yuan, J.-W.; Zhang, L.; Ruan, Z.; Sun, X.-M.; Lu, H. Puerarin prevents epithelial tight junction dysfunction induced by ethanol in Caco-2 cell model. J. Funct. Foods 2020, 73, 104079. [Google Scholar] [CrossRef]
- Eichner, M.; Protze, J.; Piontek, A.; Krause, G.; Piontek, J. Targeting and alteration of tight junctions by bacteria and their virulence factors such as Clostridium perfringens enterotoxin. Pflügers Arch.-Eur. J. Physiol. 2016, 469, 77–90. [Google Scholar] [CrossRef]
- Xiao, Z.; Liu, L.; Tao, W.; Pei, X.; Wang, G.; Wang, M. 334 Clostridium tyrobutyricum protect intestinal barrier function from LPS-induced apoptosis via p38/JNK signaling pathway in IPEC-J2. J. Anim. Sci. 2018, 96, 166–167. [Google Scholar] [CrossRef]
- Kimura, J.; Abe, H.; Kamitani, S.; Toshima, H.; Fukui, A.; Miyake, M.; Kamata, Y.; Sugita-Konishi, Y.; Yamamoto, S.; Horiguchi, Y. Clostridium perfringens Enterotoxin Interacts with Claudins via Electrostatic Attraction. J. Biol. Chem. 2010, 285, 401–408. [Google Scholar] [CrossRef] [Green Version]
- Krause, G.; Winkler, L.; Mueller, S.L.; Haseloff, R.F.; Piontek, J.; Blasig, I.E. Structure and function of claudins. Biochim. Biophys. Acta (BBA)—Biomembr. 2008, 1778, 631–645. [Google Scholar] [CrossRef] [Green Version]
- Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef]
- Zakrzewski, S.S.; Richter, J.F.; Krug, S.; Jebautzke, B.; Lee, I.-F.M.; Rieger, J.; Sachtleben, M.; Bondzio, A.; Schulzke, J.D.; Fromm, M.; et al. Improved Cell Line IPEC-J2, Characterized as a Model for Porcine Jejunal Epithelium. PLoS ONE 2013, 8, e79643. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, T.T.T.; Nguyen, H.T.; Wang, P.-C.; Chen, S.-C. Identification and expression analysis of two pro-inflammatory cytokines, TNF-α and IL-8, in cobia (Rachycentron canadum L.) in response to Streptococcus dysgalactiae infection. Fish Shellfish. Immunol. 2017, 67, 159–171. [Google Scholar] [CrossRef]
- Ertel, W.; Kremer, J.; Kenney, J.; Steckholzer, U.; Jarrar, D.; Trentz, O.; Schildberg, F. Downregulation of proinflammatory cytokine release in whole blood from septic patients. Blood 1995, 85, 1341–1347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiao, Y.; Yan, H.; Diao, H.; Yu, B.; He, J.; Yu, J.; Zheng, P.; Mao, X.; Luo, Y.; Chen, D. Early Gut Microbiota Intervention Suppresses DSS-Induced Inflammatory Responses by Deactivating TLR/NLR Signalling in Pigs. Sci. Rep. 2017, 7, 3224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kamada, N.; Seo, S.-U.; Chen, G.Y.; Núñez, G. Role of the gut microbiota in immunity and inflammatory disease. Nat. Rev. Immunol. 2013, 13, 321–335. [Google Scholar] [CrossRef] [PubMed]
- Miyake, K. Innate immune sensing of pathogens and danger signals by cell surface Toll-like receptors. Semin. Immunol. 2007, 19, 3–10. [Google Scholar] [CrossRef]
- Brubaker, S.W.; Bonham, K.S.; Zanoni, I.; Kagan, J.C. Innate Immune Pattern Recognition: A Cell Biological Perspective. Annu. Rev. Immunol. 2015, 33, 257–290. [Google Scholar] [CrossRef] [Green Version]
- Vora, P.; Youdim, A.; Thomas, L.S.; Fukata, M.; Tesfay, S.Y.; Lukasek, K.; Michelsen, K.S.; Wada, A.; Hirayama, T.; Arditi, M.; et al. β-Defensin-2 Expression Is Regulated by TLR Signaling in Intestinal Epithelial Cells. J. Immunol. 2004, 173, 5398–5405. [Google Scholar] [CrossRef] [Green Version]
- Wu, Q.; Liu, M.-C.; Yang, J.; Wang, J.-F.; Zhu, Y.-H. Lactobacillus rhamnosus GR-1 Ameliorates Escherichia coli-Induced Inflammation and Cell Damage via Attenuation of ASC-Independent NLRP3 Inflammasome Activation. Appl. Environ. Microbiol. 2016, 82, 1173–1182. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.; Cui, K.; Wu, M.; Xu, D.; Mai, K.; Ai, Q. Polyunsaturated Fatty Acids Influence LPS-Induced Inflammation of Fish Macrophages Through Differential Modulation of Pathogen Recognition and p38 MAPK/NF-κB Signaling. Front. Immunol. 2020, 11, 559332. [Google Scholar] [CrossRef]
- Quadri, S.S.; Cooper, C.; Ghaffar, D.; Vaishnav, H.; Nahar, L. The Pathological Role of Pro (Renin) Receptor in Renal Inflammation. J. Exp. Pharmacol. 2021, 13, 339–344. [Google Scholar] [CrossRef]
- Coulombe, P.; Meloche, S. Atypical mitogen-activated protein kinases: Structure, regulation and functions. Biochim. Biophys. Acta (BBA)—Bioenerg. 2007, 1773, 1376–1387. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Z.; Xueying, L.; Chunlin, L.; Wen, X.; Rongrong, Z.; Jing, H.; Meilan, J.; Yuwei, X.; Zili, W. Effect of berberine on LPS-induced expression of NF-κB/MAPK signalling pathway and related inflammatory cytokines in porcine intestinal epithelial cells. Innate Immun. 2020, 26, 627–634. [Google Scholar] [CrossRef] [PubMed]
- Qi, F.; Bai, S.; Wang, D.; Xu, L.; Hu, H.; Zeng, S.; Chai, R.; Liu, B. Macrophages produce IL-33 by activating MAPK signaling pathway during RSV infection. Mol. Immunol. 2017, 87, 284–292. [Google Scholar] [CrossRef]
- Qi, M.; Elion, E.A. MAP kinase pathways. J. Cell Sci. 2005, 118, 3569–3572. [Google Scholar] [CrossRef] [Green Version]
- Conti, F.; Boucherit, N.; Baldassarre, V.; Trouplin, V.; Toman, R.; Mottola, G.; Mege, J.-L.; Ghigo, E. Coxiella burnetii lipopolysaccharide blocks p38α-MAPK activation through the disruption of TLR-2 and TLR-4 association. Front. Cell. Infect. Microbiol. 2015, 4, 182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, J.; Kim, H.J.; Nguyen, T.T.H.; Kim, S.C.; Ree, J.; Choi, T.G.; Sohng, J.K.; Park, Y.I. Emodin 8-O-glucoside primes macrophages more strongly than emodin aglycone via activation of phagocytic activity and TLR-2/MAPK/NF-κB signalling pathway. Int. Immunopharmacol. 2020, 88, 106936. [Google Scholar] [CrossRef]
- Vallabhapurapu, S.; Karin, M. Regulation and Function of NF-κB Transcription Factors in the Immune System. Annu. Rev. Immunol. 2009, 27, 693–733. [Google Scholar] [CrossRef] [PubMed]
- Tak, P.P.; Firestein, G.S. NF-κB: A key role in inflammatory diseases. J. Clin. Investig. 2001, 107, 7–11. [Google Scholar] [CrossRef]
- Xia, B.; Yu, J.; He, T.; Liu, X.; Su, J.; Wang, M.; Wang, J.; Zhu, Y. Lactobacillus johnsonii L531 ameliorates enteritis via elimination of damaged mitochondria and suppression of SQSTM1-dependent mitophagy in a Salmonella infantis model of piglet diarrhea. FASEB J. 2019, 34, 2821–2839. [Google Scholar] [CrossRef] [Green Version]
- Yin, H.; Ye, P.; Lei, Q.; Cheng, Y.; Yu, H.; Du, J.; Pan, H.; Cao, Z. In vitro probiotic properties of Pediococcus pentosaceus L1 and its effects on enterotoxigenic Escherichia coli-induced inflammatory responses in porcine intestinal epithelial cells. Microb. Pathog. 2020, 144, 104163. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Kong, Q.; Roland, K.L.; Wolf, A.; Curtiss, R. Multiple effects of Escherichia coli Nissle 1917 on growth, biofilm formation, and inflammation cytokines profile of Clostridium perfringens type A strain CP4. Pathog. Dis. 2014, 70, 390–400. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Nie, Y.; Hu, J.; Hou, Q.; Zheng, W.; Zhang, X.; Yang, T.; Ma, L.; Yan, X. Lactobacillus frumenti improves antioxidant capacity via nitric oxide synthase 1 in intestinal epithelial cells. FASEB J. 2019, 33, 10705–10716. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Sequence (5′→3′) | Reverse Sequence (5′→3′) | Accession Number |
---|---|---|---|
β-actin | CCAGGTCATCACCATCGGCAAC | CAGCACCGTGTTGGCGTAGAG | DQ845171.1 |
pBD1 | TTCCTCCTCATGGTCCTGTT | AGGTGCCGATCTGTTTCATC | NM_213838.1 |
pBD2 | TGTCTGCCTCCTCTCTTCC | AACAGGTCCCTTCAATCCTG | AY506573.1 |
pBD3 | CCTTCTCTTTGCCTTGCTCTT | GCCACTCACAGAACAGCTACC | XM_021074698.1 |
pEP2C | ACTGCTTGTTCTCCAGAGCC | TGGCACAGATGACAAAGCCT | BK005522.1 |
Mucin 2 | GGTCATGCTGGAGCTGGACAGT | TGCCTCCTCGGGGTCGTCAC | XM_021082584.1 |
IL-1β | AGAGGGACATGGAGAAGCGA | GCCCTCTGGGTATGGCTTT | NM_001302388.2 |
IL-6 | ATCAGGAGACCTGCTTGATG | TGGTGGCTTTGTCTGGATTC | NM_001252429.1 |
IL-8 | TCCTGCTTTCTGCAGCTCTC | GGGTGGAAAGGTGTGGAATG | NM_213867.1 |
TNF-α | CTGTAGGTTGCTCCCACCTG | CCAGTAGGGCGGTTACAGAC | NM_214022.1 |
TLR-1 | GTCAGTCAGCACCGCAGTAA | CAGACAAACTGGAGGGTGGT | NM_001031775 |
TLR-2 | TCACTTGTCTAACTTATCATCCTCT | TCAGCGAAGGTGTCATTATTGC | NM_213761.1 |
TLR-4 | GCCATCGCTGCTAACATCATC | CTCATACTCAAAGATACACCATCG | NM_001113039.2 |
NOD-1 | CTGTCGTCAACACCGATCCA | CCAGTTGGTGACGCAGCTT | AB187219.1 |
NOD-2 | CCTTTTGAAGATGCTGCCTG | GATTCTCTGCCCCATCGTAG | NM_001105295.1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.; Wang, B.; Wang, Q.; Tang, L.; Zou, P.; Zeng, Z.; Zhang, H.; Gong, L.; Li, W. Protective Effects of Lactobacillus plantarum Lac16 on Clostridium perfringens Infection-Associated Injury in IPEC-J2 Cells. Int. J. Mol. Sci. 2021, 22, 12388. https://doi.org/10.3390/ijms222212388
Zhou Y, Wang B, Wang Q, Tang L, Zou P, Zeng Z, Zhang H, Gong L, Li W. Protective Effects of Lactobacillus plantarum Lac16 on Clostridium perfringens Infection-Associated Injury in IPEC-J2 Cells. International Journal of Molecular Sciences. 2021; 22(22):12388. https://doi.org/10.3390/ijms222212388
Chicago/Turabian StyleZhou, Yuanhao, Baikui Wang, Qi Wang, Li Tang, Peng Zou, Zihan Zeng, Huihua Zhang, Li Gong, and Weifen Li. 2021. "Protective Effects of Lactobacillus plantarum Lac16 on Clostridium perfringens Infection-Associated Injury in IPEC-J2 Cells" International Journal of Molecular Sciences 22, no. 22: 12388. https://doi.org/10.3390/ijms222212388
APA StyleZhou, Y., Wang, B., Wang, Q., Tang, L., Zou, P., Zeng, Z., Zhang, H., Gong, L., & Li, W. (2021). Protective Effects of Lactobacillus plantarum Lac16 on Clostridium perfringens Infection-Associated Injury in IPEC-J2 Cells. International Journal of Molecular Sciences, 22(22), 12388. https://doi.org/10.3390/ijms222212388