Importance of Genetic Polymorphisms in MT1 and MT2 Genes in Metals Homeostasis and Their Relationship with the Risk of Acute Pancreatitis Occurrence in Smokers—Preliminary Findings
Abstract
1. Introduction
2. Results
2.1. The Concentration of Metals (Cu, Zn, Cd), Metallothionein, Selected Parameters of Pro/Antioxidative Balance and Inflammatory Markers in the Groups of AP Patients and Healthy Subjects
2.2. Results of Genotyping
2.3. The Concentration of Metals (Cu, Zn, Cd), Metallothionein, Selected Parameters of Pro/Antioxidative Balance and Inflammatory Markers in Context of Genotypic Variability of Single-Nucleotide Polymorphisms rs11640851 in the MT1A Gene
2.4. The Concentration of Metals (Cu, Zn, Cd), Metallothionein, Selected Parameters of Pro/Antioxidative Balance and Inflammatory Markers in Context of Genotypic Variability of the Single-Nucleotide Polymorphism rs964372 in the MT1B Gene
2.5. The Concentration of Metals (Cu, Zn, Cd), Metallothionein, Selected Parameters of Pro/Antioxidative Balance and Inflammatory Markers in Context of Genotypic Variability of Single-Nucleotide Polymorphisms rs10636 in the MT2A Gene
2.6. Results for the Odds Ratio Analysis and the Correlation Coefficients
3. Discussion
3.1. The Influence of SNP rs11640851 in the MT1A Gene on the Concentration of Metallothioneins, Metals and Selected Parameters of Pro/Antioxidative Balance
3.2. The Influence of SNP rs964372 in the MT1B Gene on the Concentration of Metallothioneins, Metals and Selected Parameters of Pro/Antioxidative Balance
3.3. The Influence of SNP rs10636 in the MT2A Gene on the Concentration of Metallothioneins, Metals and Selected Parameters of Pro/Antioxidative Balance
4. Materials and Methods
4.1. Subjects
4.2. Materials
4.3. Methods
4.4. Genotyping Analyses
4.5. Statistical Analysis
5. Conclusions
- Oxidative stress in the course of AP contributes to an increase in MT concentration in erythrocyte lysate.
- MT played an important role in the Cu and Zn homeostasis in both groups, healthy subjects and AP patients, which can be confirmed by a positive correlation between MT and these metals.
- Healthy subjects and AP patients with the AA genotype for SNP rs11640851 in the MT1A gene were the most sensitive to the harmful effects of tobacco smoke xenobiotics, as evidenced by an increase in Cd concentration in the blood.
- The presence of the CA genotype for SNP rs11640851 in the MT1A gene plays an important role in the disturbance of Zn homeostasis in AP patients, especially in smokers.
- The exposure to tobacco smoke xenobiotics increased the risk of AP occurrence in the subjects with the CC genotype for SNP rs11640851 in the MT1A gene by more than fourfold.
- SNP rs964372 in the MT1B gene was associated with an increase in MT concentration in the erythrocytes of AP patients with the GG genotype.
- The presence of the GC genotype for SNP rs10636 in the MT2A gene predisposed the smoking AP patients to a decreased plasma Zn concentration.
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kelleher, S.L.; McCormick, N.H.; Velasquez, V.; Lopez, V. Zinc in Specialized Secretory Tissues: Roles in the Pancreas, Prostate, and Mammary Gland. Adv. Nutr. Int. Rev. J. 2011, 2, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Zhao, T.; Huang, Q.; Su, Y.; Sun, W.; Huang, Q.; Wei, W. Zinc and Its Regulators in Pancreas. Inflammopharmacology 2019, 27, 453–464. [Google Scholar] [CrossRef] [PubMed]
- Dalton, T.; Fu, K.; Palmiter, R.D.; Andrews, G.K. Transgenic Mice That Overexpress Metallothionein-I Resist Dietary Zinc Deficiency. J. Nutr. 1996, 126, 825–833. [Google Scholar] [CrossRef] [PubMed]
- De Lisle, R.; Sarras, M.; Hidalgo, J.; Andrews, G. Metallothionein Is a Component of Exocrine Pancreas Secretion: Implications for Zinc Homeostasis. Am. J. Physiol. 1996, 271, C1103–C1110. [Google Scholar] [CrossRef] [PubMed]
- Raudenska, M.; Gumulec, J.; Podlaha, O.; Sztalmachova, M.; Babula, P.; Eckschlager, T.; Adam, V.; Kizek, R.; Masarik, M. Metallothionein Polymorphisms in Pathological Processes. Metallomics 2014, 6, 55–68. [Google Scholar] [CrossRef]
- Summers, K.L.; Sutherland, D.E.K.; Stillman, M.J. Single-Domain Metallothioneins: Evidence of the Onset of Clustered Metal Binding Domains in Zn-RhMT 1a. Biochemistry 2013, 52, 2461–2471. [Google Scholar] [CrossRef]
- Babula, P.; Masarik, M.; Adam, V.; Eckschlager, T.; Stiborova, M.; Trnkova, L.; Skutkova, H.; Provaznik, I.; Hubalek, J.; Kizek, R. Mammalian Metallothioneins: Properties and Functions. Met. Integr. Biomet. Sci. 2012, 4, 739–750. [Google Scholar] [CrossRef]
- Dong, G.; Chen, H.; Qi, M.; Dou, Y.; Wang, Q. Balance between Metallothionein and Metal Response Element Binding Transcription Factor 1 Is Mediated by Zinc Ions (Review). Mol. Med. Rep. 2015, 11, 1582–1586. [Google Scholar] [CrossRef]
- Liang, X.; Dempski, R.E.; Burdette, S.C. Zn(2+) at a Cellular Crossroads. Curr. Opin. Chem. Biol. 2016, 31, 120–125. [Google Scholar] [CrossRef]
- Krężel, A.; Maret, W. The Functions of Metamorphic Metallothioneins in Zinc and Copper Metabolism. Int. J. Mol. Sci. 2017, 18, 1237. [Google Scholar] [CrossRef]
- Irvine, G.W.; Pinter, T.B.J.; Stillman, M.J. Defining the Metal Binding Pathways of Human Metallothionein 1a: Balancing Zinc Availability and Cadmium Seclusion. Metallomics 2016, 8, 71–81. [Google Scholar] [CrossRef]
- Gungor, H.; Kara, H. Effects of Selenium, Zinc, Insulin and Metallothionein on Cadmium-Induced Oxidative Stress and Metallothionein Gene Expression Levels in Diabetic Rats. J. Basic Clin. Physiol. Pharmacol. 2020, 31. [Google Scholar] [CrossRef]
- Milnerowicz, H.; Chmarek, M.; Rabczyński, J.; Milnerowicz, S.; Nabzdyk, S.; Knast, W. Immunohistochemical Localization of Metallothionein in Chronic Pancreatitis. Pancreas 2004, 29, 28–32. [Google Scholar] [CrossRef] [PubMed]
- Milnerowicz, H.; Jabłonowska, M.; Bizoń, A. Change of Zinc, Copper, and Metallothionein Concentrations and the Copper-Zinc Superoxide Dismutase Activity in Patients with Pancreatitis. Pancreas 2009, 38, 681–688. [Google Scholar] [CrossRef] [PubMed]
- Sabolic, I.; Breljak, D.; Skarica, M.; Herak-Kramberger, C.M. Role of Metallothionein in Cadmium Traffic and Toxicity in Kidneys and Other Mammalian Organs. BioMetals 2010, 23, 897–926. [Google Scholar] [CrossRef] [PubMed]
- Tapiero, H.; Tew, K.D. Trace Elements in Human Physiology and Pathology: Zinc and Metallothioneins. Biomed. Pharmacother. 2003, 57, 399–411. [Google Scholar] [CrossRef]
- Lehman-McKeeman, L.D.; Klaassen, C.D. Induction of Metallothionein-I and Metallothionein-II in Rats by Cadmium and Zinc. Toxicol. Appl. Pharmacol. 1987, 88, 195–202. [Google Scholar] [CrossRef]
- Kershaw, W.C.; Klaassen, C.D. Degradation and Metal Composition of Hepatic Isometallothioneins in Rats. Toxicol. Appl. Pharmacol. 1992, 112, 24–31. [Google Scholar] [CrossRef]
- Hattori, Y.; Naito, M.; Satoh, M.; Nakatochi, M.; Naito, H.; Kato, M.; Takagi, S.; Matsunaga, T.; Seiki, T.; Sasakabe, T.; et al. Metallothionein MT2A A-5G Polymorphism as a Risk Factor for Chronic Kidney Disease and Diabetes: Cross-Sectional and Cohort Studies. Toxicol. Sci. 2016, 152, 181–193. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Li, H.; Yu, T.; Zhao, H.; Cherian, M.G.; Cai, L.; Liu, Y. Polymorphisms in Metallothionein-1 and -2 Genes Associated with the Risk of Type 2 Diabetes Mellitus and Its Complications. Am. J. Physiol. Endocrinol. Metab. 2008, 294, E987–E992. [Google Scholar] [CrossRef]
- Si, M.; Lang, J. The Roles of Metallothioneins in Carcinogenesis. J. Hematol. Oncol. J Hematol. Oncol 2018, 11, 107. [Google Scholar] [CrossRef]
- Cipriano, C.; Malavolta, M.; Costarelli, L.; Giacconi, R.; Muti, E.; Gasparini, N.; Cardelli, M.; Monti, D.; Mariani, E.; Mocchegiani, E. Polymorphisms in MT1a Gene Coding Region Are Associated with Longevity in Italian Central Female Population. Biogerontology 2006, 7, 357–365. [Google Scholar] [CrossRef]
- Zavras, A.I.; Yoon, A.J.; Chen, M.K.; Lin, C.W.; Yang, S.F. Metallothionein-1 Genotypes in the Risk of Oral Squamous Cell Carcinoma. Ann. Surg. Oncol. 2011, 18, 1478–1483. [Google Scholar] [CrossRef]
- Sigel, A.; Sigel, H.; Sigel, R.K.O. Metallothioneins and Related Chelators; Royal Society of Chemistry: London, UK, 2009; ISBN 978-1-84755-899-2. [Google Scholar]
- Milnerowicz, H.; Bukowski, R.; Jabłonowska, M.; Ściskalska, M.; Milnerowicz, S. The Antioxidant Profiles, Lysosomal and Membrane Enzymes Activity in Patients with Acute Pancreatitis. Mediat. Inflamm. 2014, 2014. [Google Scholar] [CrossRef][Green Version]
- Milnerowicz, H.; Ściskalska, M.; Dul, M. Pro-Inflammatory Effects of Metals in Persons and Animals Exposed to Tobacco Smoke. J. Trace Elem. Med. Biol. 2015, 29, 1–10. [Google Scholar] [CrossRef]
- Milnerowicz, H.; Ściskalska, M.; Dul, M. Molecular Mechanisms of the Impact of Smoke-Oxidants. Exp. Toxicol. Pathol. 2015, 67, 377–382. [Google Scholar] [CrossRef]
- Jablonowska, M.; Milnerowicz, H.; Rabczynski, J.; Milnerowicz, S.; Nabzdyk, S.; Patrzalek, D.; Milnerowicz, A. Immunohistochemical Localization of Interleukin-6 in Human Pancreatitis. Appl. Immunohistochem. Mol. Morphol. AIMM 2008, 16, 40–43. [Google Scholar] [CrossRef] [PubMed]
- Giacconi, R.; Muti, E.; Malavolta, M.; Cipriano, C.; Costarelli, L.; Bernardini, G.; Gasparini, N.; Mariani, E.; Saba, V.; Boccoli, G.; et al. The +838 C/G MT2A Polymorphism, Metals, and the Inflammatory/Immune Response in Carotid Artery Stenosis in Elderly People. Mol. Med. 2007, 13, 388–395. [Google Scholar] [CrossRef] [PubMed]
- Coyle, P.; Philcox, J.C.; Carey, L.C.; Rofe, A.M. Metallothionein: The Multipurpose Protein. Cell. Mol. Life Sci. CMLS 2002, 59, 627–647. [Google Scholar] [CrossRef] [PubMed]
- Manso, Y.; Adlard, P.A.; Carrasco, J.; Vašák, M.; Hidalgo, J. Metallothionein and Brain Inflammation. J. Biol. Inorg. Chem. JBIC Publ. Soc. Biol. Inorg. Chem. 2011, 16, 1103–1113. [Google Scholar] [CrossRef] [PubMed]
- Inoue, K.; Takano, H.; Shimada, A.; Satoh, M. Metallothionein as an Anti-Inflammatory Mediator. Mediat. Inflamm. 2009, 2009, 101659. [Google Scholar] [CrossRef]
- Adams, S.V.; Barrick, B.; Freney, E.P.; Shafer, M.M.; Makar, K.; Song, X.; Lampe, J.; Vilchis, H.; Ulery, A.; Newcomb, P.A. Genetic Variation in Metallothionein and Metal-Regulatory Transcription Factor 1 in Relation to Urinary Cadmium, Copper, and Zinc. Toxicol. Appl. Pharmacol. 2015, 289, 381–388. [Google Scholar] [CrossRef] [PubMed]
- Giacconi, R.; Bonfigli, A.R.; Testa, R.; Sirolla, C.; Cipriano, C.; Marra, M.; Muti, E.; Malavolta, M.; Costarelli, L.; Piacenza, F.; et al. +647 A/C and +1245 MT1A Polymorphisms in the Susceptibility of Diabetes Mellitus and Cardiovascular Complications. Mol. Genet. Metab. 2008, 94, 98–104. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.-C.; Chen, H.-I.; Chiu, Y.-W.; Tsai, C.-H.; Chuang, H.-Y. Metallothionein 1A Polymorphisms May Influence Urine Uric Acid and N-Acetyl-Beta-D-Glucosaminidase (NAG) Excretion in Chronic Lead-Exposed Workers. Toxicology 2013, 306, 68–73. [Google Scholar] [CrossRef]
- Kayaaltı, Z.; Aliyev, V.; Söylemezoğlu, T. The Potential Effect of Metallothionein 2A -5A/G Single Nucleotide Polymorphism on Blood Cadmium, Lead, Zinc and Copper Levels. Toxicol. Appl. Pharmacol. 2011, 256, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Vujasinovic, M.; Hedström, A.; Maisonneuve, P.; Valente, R.; von Horn, H.; Löhr, J.-M.; Haas, S.L. Zinc Deficiency in Patients with Chronic Pancreatitis. World J. Gastroenterol. 2019, 25, 600–607. [Google Scholar] [CrossRef] [PubMed]
- Jansen, J.; Rosenkranz, E.; Overbeck, S.; Warmuth, S.; Mocchegiani, E.; Giacconi, R.; Weiskirchen, R.; Karges, W.; Rink, L. Disturbed Zinc Homeostasis in Diabetic Patients by in Vitro and in Vivo Analysis of Insulinomimetic Activity of Zinc. J. Nutr. Biochem. 2012, 23, 1458–1466. [Google Scholar] [CrossRef] [PubMed]
- Juárez-Rebollar, D.; Rios, C.; Nava-Ruíz, C.; Méndez-Armenta, M. Metallothionein in Brain Disorders. Available online: https://www.hindawi.com/journals/omcl/2017/5828056/ (accessed on 19 April 2020).
- Sato, M.; Bremner, I. Oxygen Free Radicals and Metallothionein. Free Radic. Biol. Med. 1993, 14, 325–337. [Google Scholar] [CrossRef]
- Ściskalska, M.; Ołdakowska, M.; Marek, G.; Milnerowicz, H. Changes in the Activity and Concentration of Superoxide Dismutase Isoenzymes (Cu/Zn SOD, MnSOD) in the Blood of Healthy Subjects and Patients with Acute Pancreatitis. Antioxidants 2020, 9, 948. [Google Scholar] [CrossRef]
- Ronco, A.M.; Garrido, F.; Llanos, M.N. Smoking Specifically Induces Metallothionein-2 Isoform in Human Placenta at Term. Toxicology 2006, 223, 46–53. [Google Scholar] [CrossRef]
- Milnerowicz, H.; Sliwinska-Mosson, M.; Rabczynski, J.; Nowak, M.; Milnerowicz, S. Dysfunction of the Pancreas in Healthy Smoking Persons and Patients with Chronic Pancreatitis. Pancreas 2007, 34, 46–54. [Google Scholar] [CrossRef]
- Bakhtiari, S.; Azimi, S.; Mehdipour, M.; Amini, S.; Elmi, Z.; Namazi, Z. Effect of Cigarette Smoke on Salivary Total Antioxidant Capacity. J. Dent. Res. Dent. Clin. Dent. Prospects 2015, 9, 281–284. [Google Scholar] [CrossRef]
- Ruttkay-Nedecky, B.; Nejdl, L.; Gumulec, J.; Zitka, O.; Masarik, M.; Eckschlager, T.; Stiborova, M.; Adam, V.; Kizek, R. The Role of Metallothionein in Oxidative Stress. Int. J. Mol. Sci. 2013, 14, 6044–6066. [Google Scholar] [CrossRef]
- Bhatia, M.; Brady, M.; Shokuhi, S.; Christmas, S.; Neoptolemos, J.P.; Slavin, J. Inflammatory Mediators in Acute Pancreatitis. J. Pathol. 2000, 190, 117–125. [Google Scholar] [CrossRef]
- Sekovanić, A.; Jurasović, J.; Piasek, M. Metallothionein 2A Gene Polymorphisms in Relation to Diseases and Trace Element Levels in Humans. Arh. Hig. Rada Toksikol. 2020, 71, 27–47. [Google Scholar] [CrossRef] [PubMed]
- Milnerowicz, H.; Bizoń, A. Determination of Metallothionein in Biological Fluids Using Enzyme-Linked Immunoassay with Commercial Antibody. Acta Biochim. Pol. 2010, 57, 99–104. [Google Scholar] [CrossRef] [PubMed]
- Starska, K.; Krześlak, A.; Forma, E.; Olszewski, J.; Lewy-Trenda, I.; Osuch-Wójcikiewicz, E.; Bryś, M. Genetic Polymorphism of Metallothionein 2A and Risk of Laryngeal Cancer in a Polish Population. Med. Oncol. Northwood Lond. Engl. 2014, 31, 75. [Google Scholar] [CrossRef]
Healthy Subjects | Patients with AP | |||||
---|---|---|---|---|---|---|
Parameters in Erythrocyte Lysate | Non-Smokers (n = 26) | Smokers (n = 25) | p | Non-Smokers (n = 17) | Smokers (n = 23) | p |
MT [ng/g Hb] | 11.7 ± 3.3 (9.5; 10.5; 13.2) | 10.2 ± 2.4 (8.9; 9.6; 10.8) | 0.0764 | 27.8 ± 7.6 * (23.1; 28.8; 31.1) | 28.5 ± 4.5 ** (25.3; 27.7; 30.9) | 0.7321 |
SODs [U/g Hb] | 157.4 ± 60.0 (114.3; 142.2; 194.7) | 141.4 ± 48.8 (103.7; 140.0; 176.6) | 0.3504 | 416.1 ± 81.2 * (357.1; 401.1; 440.8) | 429.8 ± 77.9 ** (377.2; 403.9; 476.4) | 0.6613 |
Cd [µg/L] | 0.8 ± 0.3 (0.6; 0.8; 0.9) | 3.1 ± 1.2 (2.3; 3.0; 3.9) | <0.0001 | 0.6 ± 0.2 (0.5; 0.6; 0.8) | 3.8 ± 1.4 (2.6; 3.2; 5.5) | <0.0001 |
Parameters in plasma | Healthy subjects (n = 51) | AP patients (n = 40) | p | |||
MT [ng/mL] | 1.8 ± 0.3 (1.6; 1.7; 1.8) | 1.8 ± 0.2 (1.7: 1.7: 1.8) | 0.8049 | 1.7 ± 0.3 (1.5: 1.6: 1.9) | 1.7 ± 0.2 (1.5: 1.7: 1.8) | 0.5077 |
Cu [µg/L] | 1006.2 ± 128.1 (919.3; 994.6; 1107.0) | 1068.7 ± 160.7 (989.0; 1035.5; 1210) | 0.1520 | 1063.2 ± 198.6 (955.9; 996.6; 1014) | 1155.6 ± 1180.0 (1080.3; 1161.3; 1235.6) | 0.1476 |
Zn [µg/L] | 936.4 ± 129.0 (840.0; 914.0; 1010.1) | 940.7 ± 142.7 (852.5; 957.2; 1010.5) | 0.9159 | 759.8 ± 157.0 (684.7; 728.8; 856.5) | 623.8 ± 165.0 ** (487.3; 581.4; 786.7) | 0.0055 |
Cu/Zn ratio | 1.1 ± 0.2 (1.0; 1.1; 1.2) | 1.1 ± 0.2 (1.0; 1.1; 1.2) | 0.8018 | 1.5 ± 0.3 * (1.4; 1.6; 1.7) | 1.7 ± 0.4 ** (1.4; 1.7; 2.1) | 0.0356 |
MDA[nmol/µL] | 0.9 ± 0.6 (0.4; 0.7; 1.5) | 0.7 ± 0.3 (0.3; 0.4; 1.1) | 0.2853 | 2.1 ± 0.7 * (1.7; 2.1; 2.3) | 2.5 ± 0.6 ** (2.2; 2.4; 2.9) | 0.1423 |
SODs [U/mL] | 10.1 ±1.3 (9.1; 10.3; 11.1) | 10.1 ± 1.5 (8.9; 10.1; 11.3) | 0.8814 | 8.7 ± 2.9(6.5; 8.3; 10.8) | 9.1 ± 2.7 (7.3; 8.2; 10.8) | 0.4783 |
TAC [µM CRE] | 30.1 ± 15.5 (19.2; 28.6; 41.1) | 27.7 ± 14.9 (17.8: 21.9; 32.2) | 0.7891 | 942.9 ± 227.2 * (782.6; 898.4; 1115.6) | 867.3 ± 279.1 ** (685.6; 740.5; 1203.2) | 0.4382 |
Cp [mg/dL] | 27.0 ± 13.0 (16.6; 24.2; 34.6) | 32.4 ± 10.5 (24.0; 28.8; 44.4) | 0.1745 | 20.4 ± 7.2 * (16.9; 18.0; 23.3) | 24.5 ± 7.9 ** (19.6; 25.9; 28.8) | 0.1296 |
hs-CRP [mg/dL] | 0.6 ± 0.3 (0.1; 0.4; 1.0) | 0.5 ± 0.3 (0.2: 0.4; 0.8) | 0.1445 | 129.1 ± 21.8 * (122.8; 133.6; 134.7) | 141.5 ± 52.3 ** (117.4; 138.5; 190.9) | 0.6353 |
IL-6 [pg/mL] | 0.5 ± 0.2 (0.2; 0.4; 0.6) | 0.5 ± 0.2 (0.2; 0.3; 0.8) | 0.8012 | 46.7 ± 30.8 * (30.9; 31.9; 74.6) | 72.2 ± 29.8 ** (47.0; 73.1; 97.4) | 0.2511 |
Polymorphism | Model | Genotype | Healthy Subjects | AP Patients | OR (95% CI) | p Value |
---|---|---|---|---|---|---|
rs11640851 (MT1A) | Codominant | AA CA CC | 13 (25.5%) 23 (45.1%) 15 (29.4%) | 14 (35%) 18 (45%) 8 (20%) | 1.00 1.38 (0.52–3.65) 2.02 (0.64–6.33) | 0.48 |
Dominant | A/A C/A-C/C | 13 (25.5%) 38 (74.5%) | 14 (35%) 26 (65%) | 1.00 1.57 (0.64–3.89) | 0.33 | |
Recessive | A/A-C/A C/C | 36 (70.6%) 15 (29.4%) | 32 (80%) 8 (20%) | 1.00 1.67 (0.62–4.45) | 0.30 | |
Overdominant | A/A-C/C C/A | 28 (54.9%) 23 (45.1%) | 22 (55%) 18 (45%) | 1.00 1.00 (0.44–2.31) | 0.99 | |
rs964372 (MT1B) | Codominant | G/G C/G C/C | 17 (33.3%) 21 (41.2%) 13 (25.5%) | 15 (37.5%) 17 (42.5%) 8 (20%) | 1.00 1.09 (0.42–2.80) 1.43 (0.47–4.40) | 0.81 |
Dominant | G/G C/G-C/C | 17 (33.3%) 34 (66.7%) | 15 (37.5%) 25 (62.5%) | 1.00 1.20 (0.51–2.85) | 0.68 | |
Recessive | G/G-C/G C/C | 38 (74.5%) 13 (25.5%) | 32 (80%) 8 (20%) | 1.00 1.37 (0.50–3.71) | 0.54 | |
Overdominant | G/G-C/C C/G | 30 (58.8%) 21 (41.2%) | 23 (57.5%) 17 (42.5%) | 1.00 0.95 (0.41–2.19) | 0.90 | |
rs10636 (MT2A) | Codominant | C/C G/C G/G | 8 (15.7%) 39 (76.5%) 4 (7.8%) | 6 (15%) 29 (72.5%) 5 (12.5%) | 1.00 1.01 (0.32–3.23) 0.60 (0.11–3.25) | 0.76 |
Dominant | C/C G/C-G/G | 8 (15.7%) 43 (84.3%) | 6 (15%) 34 (85%) | 1.00 0.95 (0.30–3.00) | 0.93 | |
Recessive | C/C-G/C G/G | 47 (92.2%) 4 (7.8%) | 35 (87.5%) 5 (12.5%) | 1.00 0.60 (0.15–2.38) | 0.46 | |
Overdominant | C/C-G/G G/C | 12 (23.5%) 39 (76.5%) | 11 (27.5%) 29 (72.5%) | 1.00 1.23 (0.48–3.18) | 0.67 |
Parameters in Erythrocyte Lysate | Non-Smokers | Smokers | ||||
---|---|---|---|---|---|---|
CA | AA | CC | CA | AA | CC | |
MT [ng/ g Hb] | 9.5; 10.3; 13.2 | 9.6; 9.9; 13.2 | 9.5; 10.7; 12.0 | 8.6; 9.5; 10.0 | 9.1; 9.7; 10.3 | 9.3; 11.2; 13.2 |
SODs [U/g Hb] | 94.5; 128.5; 145.8 | 115.0; 176.3; 235.6 | 132.7; 154.7; 213.5 | 112.5; 141.1; 173.9 | 81.3; 139.8; 179.4 | 67.5; 169.3; 255.9 |
Cd [µg/L] | 0.6; 0.7; 0.9 | 0.7; 0.8; 0.9 | 0.7; 0.8; 0.9 | 1.4; 2.6; 3.6 * | 2.3; 3.9; 4.7 ** | 2.5; 2.6; 2.6 *** |
Parameters in plasma | CA | AA | CC | CA | AA | CC |
MT [ng/L] | 1.6; 1.7; 1.7 | 1.7; 1.7; 1.8 | 1.7; 1.7; 1.8 | 1.7; 1.7; 1.8 | 1.7; 1.7; 1.8 | 1.6; 1.7; 1.8 |
Cu [µg/L] | 924.9; 996.9; 1107.0 | 919.3; 1046.2; 1092.9 | 911.2; 990.8; 1107.9 | 989.0; 1035.5; 1241.3 | 1000.4; 1094.1; 1232.5 | 977.7; 994.7; 1073.3 |
Zn [µg/L] | 822.5; 850.3; 951.0 | 803.5; 970.9; 1012.0 | 918.0; 1009.7; 1043.3 | 891.5; 970.7; 1001.3 | 860.4; 944.4; 1020.0 | 797.1; 846.1; 1002.1 |
Cu/Zn | 1.1; 1.2; 1.4 *** | 1.1; 1.1; 1.2 | 1.0; 1.0; 1.1 | 0.9; 1.1; 1.2 | 1.0; 1.1; 1.2 | 1.1; 1.1; 1.2 |
Cp [mg/dL] | 15.9; 31.7; 39.8 | 22.4; 26.0; 40.7 | 14.7; 19.8; 23.5 | 24.4; 31.9; 46.1 | 25.4; 26.9; 30.8 | 23.6; 34.4; 43.2 |
MDA [nmol/µL] | 0.5; 0.8; 1.4 | 0.3; 0.6; 1.7 | 0.4; 0.6; 1.1 | 0.2; 0.7; 1.0 | 0.2; 0.3; 0.4 | 0.7; 1.3; 1.4 |
SODs [U/mL] | 9.6; 10.3; 11.3 | 8.2; 10.2; 11.1 | 8.9; 10.2; 10.7 | 8.7; 10.1; 11.6 | 9.7; 11.2; 11.4 | 8.9; 9.3; 9.5 |
TAC [µM CRE] | 24.7; 28.6; 48.9 | 19.2; 19.2; 19.2 | 13.3; 28.9; 41.4 | 51.7; 51.7; 51.7 | 17.8; 25.0; 32.2 | 15.1; 18.5; 21.9 |
hs-CRP [mg/L] | 0.4; 0.5; 0.8 | 0.4; 0.6; 1.7 | 0.4; 0.5; 0.7 | 0.4; 0.5; 0.7 | 0.2; 0.3; 0.4 | 0.3; 0.5; 0.7 |
IL-6 [pg/mL] | 0.2; 0.3; 0.4 | 0.1; 0.7; 1.3 | 0.1; 0.4; 0.6 | 0.2; 0.3; 0.8 | 0.1; 0.3; 0.9 | 0.1; 0.2; 0.3 |
Parameters in Erythrocyte Lysate | Non-Smokers | Smokers | ||||
---|---|---|---|---|---|---|
CA | AA | CC | CA | AA | CC | |
MT [ng/ g Hb] | 25.7; 30.2; 31.8 | 22.6; 24.6; 29.0 | 14.4; 23.6; 32.8 | 22.9; 25.3; 30.0 | 28.4; 29.6; 34.7 | 26.8; 29.5; 33.7 |
SODs [U/g Hb] | 357.1; 413.8; 440.8 | 340.2; 383.0; 431.6 | 335.1; 434.9; 534.64 | 377.3; 403.9; 456.1 | 392.5; 400.0; 556.2 | 382.8; 431.6; 476.4 |
Cd [µg/L] | 0.5; 0.8; 1.0 | 0.6; 0.7; 0.8 | 0.2; 0.2; 0.3 | 2.6; 5.7; 9.8 * | 3.3; 4.2; 5.5 ** | 2.1; 2.4; 3.0 *** |
Parameters in plasma | CA | AA | CC | CA | AA | CC |
MT [ng/L] | 1.5; 1.6; 1.9 | 1.6; 1.6; 1.9 | 2.0; 2.1; 2.1 | 1.5; 1.6;; 1.8 | 1.4; 1.7; 1.9 | 1.6; 1.7; 1.9 |
Cu [µg/L] | 912.6; 978.3; 1007.3 | 977.9; 1189.0; 1428.0 | 987.5; 990.0; 992.5 | 1067.2; 1130.9; 1164.1 * | 1231.0; 1240.1; 1286.3 | 1093. 1126.3; 1173.7 |
Zn [µg/L] | 517.2; 600.0; 718.3 | 748.1; 834.0; 870.5 | 728.8; 883.0; 1037.1 | 413.9; 480.5; 609.6 | 402.4; 536.1; 786.7 ** | 441.2; 526.1; 603.2 |
Cu/Zn | 1.7; 1.7; 1.8 | 1.5; 1.6; 1.7 | 1.0; 1.2; 1.4 | 1.3; 1.7; 2.1 | 1.5; 1.9; 2.2 | 1.8; 2.0; 2.2 |
Cp [mg/dL] | 19.3; 25.0; 33.5 | 14.3; 17.2; 17.9 * | 18.0; 19.9; 21.8 | 18.6; 22.8; 26.0 | 21.3; 27.0; 31.1 ** | 24.8; 26.9; 38.8 |
MDA [nmol/µL] | 1.7; 2.2; 2.5 | 2.0; 2.1; 2.2 | 1.4; 1.4; 1.5 | 2.0; 2.5; 3.0 | 2.2; 2.6; 3.5 | 2.2; 2.3; 2.4 |
SODs [U/mL] | 6.3; 8.4; 13.3 | 7.2; 8.6; 10.2 | 4.7; 6.0; 7.3 | 7.3; 8.0; 10.8 | 6.8; 9.5; 11.7 | 7.3; 8.3; 10.5 |
TAC [µM CRE] | 771.8; 1107.8; 1289.6 | 793.4; 860.7; 948.6 | 800.7; 952.0; 1297.4 | 700.0; 743.4; 783.5 * | 646.4; 710.0; 1346.1 | 496.7; 604.2; 711.7 |
hs-CRP [mg/L] | 126.8; 130.7; 134.7 | 109.9; 128.2; 145.4 | 122.5; 127.6; 132.6 | 105.4; 151.7; 193.7 | 117.4; 154.1; 190.9 | 87.6; 135.5; 138.5 |
IL-6 [pg/mL] | 12.3; 30.9; 74.6 | 31.9; 31.9; 31.9 | 83.8; 83.8; 83.8 | 40.5; 92.7; 102.1 | 106.6; 106.6; 106.6 | 53.5; 53.5; 53.5 |
Parameters in Erythrocyte Lysate | Non-Smokers | Smokers | ||||
---|---|---|---|---|---|---|
CG | GG | CC | CG | GG | CC | |
MT [ng/ g Hb] | 9.5; 10.9; 16.4 | 9.4; 10.0; 11.2 | 9.5; 10.6; 11.7 | 9.2; 9.7; 11.1 | 8.6; 9.6; 9.9 | 8.5; 9.5; 12.4 |
SODs [U/g Hb] | 104.2; 120.4; 141.9 | 115.1; 138.8; 145.8 | 139.0; 166.0; 194.7 | 96.0; 141.4; 169.3 | 98.7; 126.2; 164.8 | 133.1; 160.2; 179.4 |
Cd [µg/L] | 0.7; 0.8; 0.9 | 0.7; 0.8; 0.9 | 0.4; 0.6; 0.9 | 1.3; 2.6; 2.6 * | 3.6; 3.6; 4.6 ** | 2.4; 3.0; 3.6 *** |
Parameters in plasma | CG | GG | CC | CG | GG | CC |
MT [ng/L] | 1.6; 1.7; 1.8 | 1.6; 1.7; 1.7) | 1.7; 1.8; 1.8 | 1.7; 1.7; 1.8) | 1.7; 1.7; 1.8 | 1.7; 1.7; 1.8 |
Cu [µg/L] | 973.3; 1042.1; 1130.3 | 830.1; 959.8; 1018.4 | 919.3; 984.1; 1092.9 | 1001.3; 1057.3; 1154.9 | 894.0; 1015.1; 1245.2 | 1000.4; 1030.1; 1094.7 |
Zn [µg/L] | 843.2; 902.5; 1059.4 | 909.9; 1001.0; 1070.1 | 803.5; 854.5; 923.8 | 797.1; 922.2; 1002.1 | 839.2; 858.9; 1019.0 | 944.4; 983.6; 1020.0 *** |
Cu/Zn | 1.1; 1.2; 1.2 | 0.9; 1.1; 1.2 | 1.0; 1.1; 1.3 | 1.0; 1.1; 1.2 | 1.0; 1.2; 1.5 | 1.0; 1.1; 1.2 |
MDA [nmol/µL] | 0.4; 0.7; 1.9 | 0.6; 0.9; 1.1 | 0.3; 0.5; 1.6 | 0.2; 0.8; 1.3 | 0.3; 0.7; 1.2 | 0.3; 0.3; 0.4 |
SODs [U/mL] | 10.2; 10.8; 11.4 | 9.3; 9.8; 10.5 | 8.2; 8.9; 10.5 | 9.6; 10.2; 11.2 | 8.9; 9.3; 11.2 | 9.1; 10.3; 11.4 |
TAC [µM CRE] | 24.7; 48.9; 55.4 | 28.6; 34.9; 41.1 | 12.0; 16.3; 24.1 | 15.1; 23.6; 32.2 | 21.9; 36.8; 51.7 | 14.5; 17.8; 17.8 |
Cp [mg/dL] | 17.2; 25.6; 35.5 | 13.5; 19.8; 24.9 | 19.2; 33.4; 55.0 | 23.6; 26.2; 43.2 | 24.4; 34.4; 38.3 | 25.4; 30.8; 45.6 |
hs-CRP [mg/L] | 0.4; 0.5; 0.6 | 0.4; 0.8; 0.9 | 0.4; 0.4; 0.5 | 0.4; 0.4; 0.5 | 0.3; 0.4; 0.5 | 0.2; 0.6; 0.9 |
IL-6 [pg/mL] | 0.1; 0.4; 0.6 | 0.2; 0.6; 1.5 | 0.1; 0.2; 0.7 | 0.1; 0.2; 0.3 | 0.2; 0.3; 0.5 | 0.2; 0.5; 1.0 |
Parameters in Erythrocyte Lysate | Non-Smokers | Smokers | ||||
---|---|---|---|---|---|---|
CG | GG | CC | CG | GG | CC | |
MT [ng/ g Hb] | 26.1; 29.3; 31.5 | 21.3; 22.6; 25.7 | 24.6; 27.9; 31.2 | 26.6; 27.8; 29.8 | 26.9; 32.3; 35.6 *, ** | 22.2; 23.3; 26.8 |
SODs [U/g Hb] | 326.2; 385.9; 483.1 | 357.1; 377.5; 440.8 | 388.5; 476.6; 564.8 | 371.2; 384.9; 403.9 | 415.8; 459.6; 555.0 | 361.8; 398.5; 456.1 |
Cd [µg/L] | 0.3; 0.5; 0.6 | 0.8; 0.8; 1.0 | 0.5; 0.7; 1.0 | 2.6; 4.3; 5.6 *** | 2.6; 3.0; 3.3 * | 1.2; 3.6; 5.9 |
Parameters in plasma | CG | GG | CC | CG | GG | CC |
MT [ng/L] | 1.6; 1.6; 2.1 | 1.5; 1.6; 1.6 | 1.6; 1.7; 1.9 | 1.5; 1.6; 1.8 | 1.5; 1.7; 1.9 | 1.5; 1.8; 1.9 |
Cu [µg/L] | 990.0; 996.6; 1242.9 | 909.0; 952.3; 1163.4 | 1007.1; 1134.4; 1261.7 | 1093.4; 1133.7; 1286.3 | 1044.1; 1172.6; 1235.6 | 1158.6; 1166.1; 1173.7 |
Zn [µg/L] | 728.8; 811.5; 856.5 | 517.2; 617.8; 718.3 | 684.8; 784.6; 884.4 | 439.3; 506.2; 572.9 *** | 487.3; 564.8; 786.7 | 395.0; 413.9; 480.5 |
Cu/Zn | 1.4; 1.5; 1.7 | 1.8; 1.8; 1.9 *** | 1.1; 1.4; 1.7 | 1.6; 1.9; 2.1 | 1.5; 1.8; 2.1 | 1.4; 1.9; 2.4 |
MDA [nmol/µL] | 1.7; 2.1; 2.2 | 1.6; 2.0; 2.3 | 1.9; 2.4; 2.9 | 2.2; 2.5; 2.9 | 2.0; 2.4; 2.6 | 2.4; 2.4; 3.2 |
SODs [U/mL] | 6.3; 6.9; 7.8 | 8.7; 11.1; 13.8 | 10.2; 10.9; 11.6 | 8.2; 9.2; 11.3 | 6.8; 8.7; 10.9 | 7.1; 7.5; 7.8 |
TAC [µM CRE] | 739.4; 952.0; 1289.6 | 786.3; 830.7; 1302.8 | 113.3; 793.4; 1297.4 | 673.2; 718.9; 755.1 | 659.8; 764.9; 1308.6 | 113.3; 711.7; 1203.2 |
Cp [mg/dL] | 17.5; 18.0; 19.3 | 14.3; 19.0; 26.7 | 12.3; 15.1; 17.9 | 19.4; 24.5; 30.8 *** | 21.3; 26.8; 29.8 | 15.3; 25.8; 26.0 |
hs-CRP [mg/L] | 122.8; 139.9; 157.1 | 97.1; 133.6; 134.7 | 105.4; 135.0; 164.6 | 117.4; 129.5; 190.9 | 46.2; 132.6; 138.5 | 121.9; 158.3; 185.9 |
IL-6 [pg/mL] | 30.9; 52.8; 74.6 | 24.5; 28.2; 31.9 | 53.5; 83.8; 92.7 | 40.5; 71.3; 102.6 | 12.5; 46.8; 74.3 | 53.5; 73.1; 92.7 |
Parameters in Erythrocyte Lysate | Non-Smokers | Smokers | ||||
---|---|---|---|---|---|---|
GC | CC | GG | GC | CC | GG | |
MT [ng/ g Hb] | 9.5; 10.5; 15.1 | 9.5; 10.1; 10.7 | 8.0; 13.3; 18.6 | 9.0; 9.5; 10.0 * | 8.6; 8.8; 11.0 | 12.4; 14.8; 17.2 |
SODs [U/g Hb] | 138.8; 145.8; 218.7 | 92.0; 94.5; 115.1 | 104.2; 178.4; 252.5 | 103.7; 140.1; 184.5 | 81.3; 112.5; 142.4 | 104.2; 139.0; 173.9 |
Cd [µg/L] | 0.5; 0.7; 0.8 | 0.7; 0.9; 1.6 | 0.8; 0.9; 0.9 | 2.3; 3.0; 3.9 * | 1.3; 3.6; 4.7 | 2.6; 3.3; 4.0 |
Parameters in plasma | GC | CC | GG | GC | CC | GG |
MT [ng/L] | 1.6; 1.7; 1.8 | 1.7; 1.7; 1.7) | 1.7; 1.8; 1.9 | 1.7; 1.7; 1.8 | 1.6; 1.7; 1.8 | 1.7; 1.7; 1.8 |
Cu [µg/L] | 920.7; 1018.4; 1100.0 | 868.5; 924.9; 1018.4 | 986.9; 1048.8; 1110.7 | 989.0; 1034.3; 1210.6 | 687.6; 1024.9; 1232.5 | 1011.8; 1052.9; 1094.1 |
Zn [µg/L] | 838.5; 918.0; 1075.4 | 854.2; 902.0; 992.3 | 895.4; 933.1; 970.9 | 839.2; 920.4; 1002.1 | 924.0; 1019.0; 1337.0 | 970.1; 985.9; 1001.7 |
Cu/Zn | 1.0; 1.2; 1.3 | 1.0; 1.0; 1.2 | 1.1; 1.1; 1.2 | 1.0; 1.1; 1.2 | 0.9; 1.0; 1.1 | 1.0; 1.1; 1.1 |
MDA [nmol/µL] | 0.3; 0.6; 0.9 | 1.2; 1.9; 2.2 * | 1.6; 1.9; 2.2 | 0.3; 0.4; 1.3 | 0.2; 0.7; 1.2 | 0.2; 0.3; 0.3 |
SODs [U/mL] | 8.9; 10.2; 11.1 | 9.7; 10.3; 10.5 | 8.7; 10.0; 11.4 | 9.1; 9.9; 11.2 | 8.3; 10.3; 11.9 | 8.7; 10.0; 11.4 |
TAC [µM CRE] | 19.2; 28.6; 41.1 | 27.9; 28.7; 29.8 | 36.2; 36.2; 36.2 | 17.8; 21.9; 32.2 | 21.9; 26.5; 39.6 | 14.5; 27.8; 37.1 |
Cp [mg/dL] | 19.8; 26.4; 39.8 | 14.0; 15.9; 19.2 | 14.1; 19.9; 25.6 | 19.8; 26.4; 39.8 | 14.0; 15.9; 19.2 | 14.1; 19.9; 25.6 |
hs-CRP [mg/L] | 0.4; 0.5; 0.7 | 0.5; 0.8; 1.3 | 0.4; 0.5; 0.5 | 0.3; 0.4; 0.7 | 0.4; 0.5; 0.5 | 0.2; 0.4; 0.5 |
IL-6 [pg/mL] | 0.2; 0.4; 0.6 | 0.1; 0.4; 0.7 | 0.1; 0.7; 1.3 | 0.2; 0.3; 0.5 | 0.8; 0.9; 0.9 | 0.3; 0.5; 0.6 |
Parameters in Erythrocyte Lysate | Non-Smokers | Smokers | ||||
---|---|---|---|---|---|---|
GC | CC | GG | GC | CC | GG | |
MT [ng/ g Hb] | 22.5; 27.1; 30.6 | 22.6; 27.2; 31.8 | 29.0 30.9; 32.8 | 24.2; 26.8; 29.8 | 25.7; 28.2; 33.6 | 33.7; 34.7; 36.6 * |
SODs [U/g Hb] | 357.1; 401.1; 431.6 * | 377.5; 409.2; 440.8 | 312.3; 423.5; 534.6 | 371.2; 398.5; 440.2 | 391.4; 439.5; 516.4 | 476.4; 532.4; 588.4 |
Cd [µg/L] | 0.5; 0.6; 0.8 | 0.8; 0.9; 1.0 | 03; 0.5; 0.8 | 2.5; 3.6; 5.6 ** | 3.0; 3.4; 3.9 | 2.1; 2.7; 3.3 |
Parameters in plasma | GC | CC | GG | GC | CC | GG |
MT [ng/L] | 1.6; 1.7; 1.9 | 1.4; 1.5; 1.6 | 1.6; 1.7; 1.9 | 1.5; 1.6; 1.8 | 1.61; 1.7; 1.8 | 1.4; 1.6; 2.0 |
Cu [µg/L] | 948.7; 996.6; 1007.1 | 955.9; 1163.4; 1370.9 | 987.5; 1236.3; 1485.1 | 1158.6; 1173.7; 1240.1 ** | 952.6; 1073.6; 1235.7 | 1067.2; 1093.4; 1231.0 |
Zn [µg/L] | 684.7; 723.6; 811.5 | 517.2; 625.5; 733.8 | 856.5; 946.8; 1037.1 | 395.0; 445.1; 536.1 **, *** | 564.4; 733.6; 866.6 | 553.2; 670.0; 786.7 |
Cu/Zn | 1.4; 1.5; 1.7 | 1.8; 1.9; 1.9 | 1.0; 1.3; 1.7 | 1.6; 2.1; 2.2 ** | 1.3; 1.6; 1.9 | 1.4; 1.8; 2.2 |
MDA [nmol/µL] | 1.9; 2.1; 2.3 | 1.6; 2.0; 2.5 | 2.0; 2.1; 2.2 | 2.0; 2.3; 2.8 | 2.4; 2.5; 3.0 | 2.6; 3.2; 3.7 |
SODs [U/mL] | 6.9; 8.4; 10.0 | 11.4; 12.8; 14.2 | 4.7; 5.5; 6.2 | 7.3; 8.2; 10.9 | 6.5; 9.1; 11.2 | 6.8; 8.9; 9.4 |
TAC [µM CRE] | 793.4; 1107.7; 1297.4 | 771.8; 786.3; 806.7 | 798.6; 950.3; 1019.7 | 673.2; 734.1; 1228.9 | 446.4; 867.4; 1167.3 | 496.7; 659.8; 685.6 |
Cp [mg/dL] | 14.3; 18.0; 23.3 | 19.0; 22.9; 26.7 | 17.5; 18.5; 19.5 | 19.4; 25.9; 28.2 | 19.6; 26.8; 29.8 | 12.0; 21.3; 33.8 |
hs-CRP [mg/L] | 122.8; 133.6; 134.7 | 97.1; 114.3; 131.6 | 106.5; 131.8; 157.1 | 123.4; 138.5; 184.5 | 42.6; 87.6; 132.6 | 124.6; 127.7; 130.9 |
IL-6 [pg/mL] | 30.9; 31.9; 74.6 | 24.5; 24.5; 24.5 | 29.3; 29.3; 29.3 | 47.0; 73.1; 97.4 | 40.5; 71.3; 102.6 | 74.3; 74.3; 74.3 |
Parameters | AP Patients | |
---|---|---|
Non-Smokers Mean ± SD | Smokers Mean ± SD | |
Ranson Criteria [score] | 2.66 ± 1.03 | 2.52 ± 0.69 |
Lipase [U/l] | 576.71 ± 393.13 | 692.00 ± 268.95 |
Erythrocytes [1012/L] | 3.86 ± 0.66 | 4.16 ± 0.94 |
Leukocytes [109/L] | 10.24 ± 4.49 | 10.55 ± 4.41 |
Hemoglobin [g/dL] | 11.24 ± 1.86 | 11.79 ± 2.15 |
Hematocrit [%] | 35.49 ± 4.42 | 36.36 ± 6.22 |
Bilirubin (total) [mg/dL] | 1.26 ± 0.57 | 0.99 ± 0.61 |
Alkaline phosphatase [U/L] | 69.17 ± 19.02 | 77.75 ± 22.34 |
Glucose [mg/dL] | 90.17 ± 19.49 | 94.86 ± 17.47 |
Urea [mg/dL] | 32.33 ± 18.55 | 19.43 ± 8.71 |
Creatinine [mg/dL] | 0.75 ± 0.09 | 0.97 ± 0.83 |
Cotinine [ng/mL] | 3.3 ± 7.9 | 104.3 ± 61.4 1) |
Pack-year [pack of cigarettes per day × smoking time] | not applicable | 25.7 ± 21.5 |
SNP | Gene | Chromosome/ Chromosome Position | Genotype | Starters Sequency 5′-3′ (Contents of Nucleotides Bases) | Melting Temperature [°C] | Annealing Temperature [°C] | The Content of GC Pairs [%] |
---|---|---|---|---|---|---|---|
rs11640851 | MT1A | 16/56639315 | A/C | F: AAGGGGGAAGTGGACACTCA (20) | 60.4 | 58 | 55.0 |
R: GTCAGGAGACAACTGGTGGA (20) | 59.0 | 55.0 | |||||
rs964372 | MT1B | 16/56652118 | C/G | F: CACAGTGTCCCTGGGTTAG (19) | 57.1 | 57 | 57.9 |
R: TAGGTGGGTGACATGGAGC (19) | 58.7 | 57.9 | |||||
rs10636 | MT2A | 16/56609431 | C/G | F: CCGCTCCCAGATGTAAAGAA (20) | 57.3 | 55 | 50.0 |
R: GGCATATAAAGAAAACCAGAGACA(24) | 57.0 | 37.5 |
SNP | Gene | Product Length | Restriction Enzymes, Company, Catalog Number, Recognized Sequence | Cuts Temperature [°C] | Genotype, Fragments After Restrictions |
---|---|---|---|---|---|
rs11640851 | MT1A | 367 bp | MnII Thermo Fisher Scientific Cat. No. ER1072 | 37 | CA: 191 bp, 145 bp, 110 bp, 66 bp, 46 bp AA: 191bp, 110 bp, 66 bp CC: 145 bp. 110 bp, 66 bp, 46 bp |
5′ CCTCN7↓ 3′ 3′ GGAGN6↑5′ | |||||
rs964372 | MT1B | 180 bp | HaeIII Thermo Fisher Scientific Cat. No. ER0151 | 37 | CG: 86 bp, 94 bp, 180 bp AA:86 bp, 94bp CC: 180 bp |
5′ GG↓CC 3′ 3′ CC↑GG 5′ | |||||
rs10636 | MT2A | 157 bp | MaeIII | 55 | GC: 63 bp, 95 bp, 157 bp CC: 63 bp, 95 bp GG: 157 bp |
Sigma-Aldrich, Cat. No. 10822230001 5′ ↓GTNAC 3′ 3′ CANTG↑ 5′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ściskalska, M.; Ołdakowska, M.; Milnerowicz, H. Importance of Genetic Polymorphisms in MT1 and MT2 Genes in Metals Homeostasis and Their Relationship with the Risk of Acute Pancreatitis Occurrence in Smokers—Preliminary Findings. Int. J. Mol. Sci. 2021, 22, 5725. https://doi.org/10.3390/ijms22115725
Ściskalska M, Ołdakowska M, Milnerowicz H. Importance of Genetic Polymorphisms in MT1 and MT2 Genes in Metals Homeostasis and Their Relationship with the Risk of Acute Pancreatitis Occurrence in Smokers—Preliminary Findings. International Journal of Molecular Sciences. 2021; 22(11):5725. https://doi.org/10.3390/ijms22115725
Chicago/Turabian StyleŚciskalska, Milena, Monika Ołdakowska, and Halina Milnerowicz. 2021. "Importance of Genetic Polymorphisms in MT1 and MT2 Genes in Metals Homeostasis and Their Relationship with the Risk of Acute Pancreatitis Occurrence in Smokers—Preliminary Findings" International Journal of Molecular Sciences 22, no. 11: 5725. https://doi.org/10.3390/ijms22115725
APA StyleŚciskalska, M., Ołdakowska, M., & Milnerowicz, H. (2021). Importance of Genetic Polymorphisms in MT1 and MT2 Genes in Metals Homeostasis and Their Relationship with the Risk of Acute Pancreatitis Occurrence in Smokers—Preliminary Findings. International Journal of Molecular Sciences, 22(11), 5725. https://doi.org/10.3390/ijms22115725