A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2
Abstract
1. Introduction
2. Results
2.1. Primer Design
2.2. Specificity and Sensitivity of the SARS-CoV-2 RT-LAMP Assay
2.3. Visual Detection
2.4. Evaluation of the Novel SARS-CoV-2 RT-LAMP Assay Using Clinical Samples
3. Discussion
4. Materials and Methods
4.1. RNA Extraction
4.2. Reaction System of the Novel RT-LAMP Assay
4.3. Specificity of the Novel RT-LAMP Assay
4.4. Sensitivity and Limit of Detection (LOD)
4.5. Evaluation of the Novel SARS-CoV-2 Detection Assay Using Clinical Samples
4.6. Visual Detection
4.7. Ethics Statement
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
COVID-19 | Coronavirus disease 2019 |
SARS-CoV | Severe Acute Respiratory Syndrome Coronavirus |
MERS-CoV | Middle East respiratory syndrome coronavirus |
LAMP | Loop-mediated isothermal amplification |
RSV | Respiratory syncytial virus |
ACE2 | Angiotensin converting enzyme II |
POCT | Point-of-Care testing |
BALF | Bronchoalveolar lavage fluid |
NCBI | National Centre for Biotechnology Information |
References
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef]
- Wu, F.; Zhao, S.; Yu, B.; Chen, Y.-M.; Wang, W.; Song, Z.-G.; Hu, Y.; Tao, Z.-W.; Tian, J.-H.; Pei, Y.-Y.; et al. A new coronavirus associated with human respiratory disease in China. Nature 2020, 579, 265–269. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Yang, X.-L.; Wang, X.-G.; Hu, B.; Zhang, L.; Zhang, W.; Si, H.-R.; Zhu, Y.; Li, B.; Huang, C.-L.; et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020, 579, 270–273. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y. Compensation of ACE2 Function for Possible Clinical Management of 2019-nCoV-Induced Acute Lung Injury. Virol. Sin. 2020. Online ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Wrapp, D.; Wang, N.; Corbett, K.S.; Goldsmith, J.A.; Hsieh, C.-L.; Abiona, O.; Graham, B.S.; McLellan, J.S. Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science 2020, 367, 1260–1263. [Google Scholar] [CrossRef] [PubMed]
- Hui, D.S.; Azhar, E.E.; Madani, T.A.; Ntoumi, F.; Kock, R.; Dar, O.; Ippolito, G.; McHugh, T.D.; Memish, Z.A.; Drosten, C.; et al. The continuing 2019-nCoV epidemic threat of novel coronaviruses to global health —The latest 2019 novel coronavirus outbreak in Wuhan, China. Int. J. Infect. Dis. 2020, 91, 264–266. [Google Scholar] [CrossRef]
- Jiang, S.; Shi, Z.-L. The First Disease X is Caused by a Highly Transmissible Acute Respiratory Syndrome Coronavirus. Virol. Sin. 2020. Online ahead of print. [Google Scholar] [CrossRef]
- Lo, Y.D.; Chiu, R.W.K. Racing Towards the Development of Diagnostics for a Novel Coronavirus (2019-nCoV). Clin. Chem. 2020, 66, 503–504. [Google Scholar] [CrossRef]
- Chu, D.K.W.; Pan, Y.; Cheng, S.M.S.; Hui, K.P.Y.; Krishnan, P.; Liu, Y.; Ng, D.Y.M.; Wan, C.K.C.; Yang, P.; Wang, Q.; et al. Molecular Diagnosis of a Novel Coronavirus (2019-nCoV) Causing an Outbreak of Pneumonia. Clin. Chem. 2020, 66, 549–555. [Google Scholar] [CrossRef]
- Wan, Z.; Zhang, Y.; He, Z.; Liu, J.; Lan, K.; Hu, Y.; Zhang, C. A Melting Curve-Based Multiplex RT-qPCR Assay for Simultaneous Detection of Four Human Coronaviruses. Int. J. Mol. Sci. 2016, 17, 1880. [Google Scholar] [CrossRef]
- Li, Y.; Wan, Z.; Hu, Y.; Zhou, Y.; Chen, Q.; Zhang, C. A mismatch-tolerant RT-quantitative PCR: Application to broad-spectrum detection of respiratory syncytial virus. Biotechniques 2019, 66, 225–230. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Wan, Z.; Yang, S.; Li, Y.; Li, M.; Wang, B.; Hu, Y.; Xia, X.; Jin, X.; Yu, N.; et al. A Mismatch-Tolerant Reverse Transcription Loop-Mediated Isothermal Amplification Method and Its Application on Simultaneous Detection of All Four Serotype of Dengue Viruses. Front. Microbiol. 2019, 10, 1056. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhou, Y.; Ma, Y.; Xu, R.; Jin, X.; Zhang, C. A Mismatch-tolerant RT-LAMP Method for Molecular Diagnosis of Highly Variable Viruses. Bio-Protocol 2019, 9, e3415. [Google Scholar] [CrossRef]
- Ceraolo, C.; Giorgi, F.M. Genomic variance of the 2019-nCoV coronavirus. J. Med. Virol. 2020, 92, 522–528. [Google Scholar] [CrossRef]
- Zhao, S.; Lin, Q.; Ran, J.; Musa, S.S.; Yang, G.; Wang, W.; Lou, Y.; Gao, D.; Yang, L.; He, D.; et al. Preliminary estimation of the basic reproduction number of novel coronavirus (2019-nCoV) in China, from 2019 to 2020: A data-driven analysis in the early phase of the outbreak. Int. J. Infect. Dis. 2020, 92, 214–217. [Google Scholar] [CrossRef]
- Riou, J.; Althaus, C.L. Pattern of early human-to-human transmission of Wuhan 2019 novel coronavirus (2019-nCoV), December 2019 to January 2020. Eurosurveillance 2020, 25, 2000058. [Google Scholar] [CrossRef]
- Zou, L.; Ruan, F.; Huang, M.; Liang, L.; Huang, H.; Hong, Z.; Yu, J.; Kang, M.; Song, Y.; Xia, J.; et al. SARS-CoV-2 Viral Load in Upper Respiratory Specimens of Infected Patients. N. Engl. J. Med. 2020, 382, 1177–1179. [Google Scholar] [CrossRef]
- Wang, W.; Xu, Y.; Gao, R.; Lu, R.; Han, K.; Wu, G.; Tan, W. Detection of SARS-CoV-2 in Different Types of Clinical Specimens. JAMA 2020. Online ahead of print. [Google Scholar] [CrossRef]
- Guan, W.-J.; Ni, Z.-Y.; Hu, Y.; Liang, W.-H.; Ou, C.-Q.; He, J.-X.; Liu, L.; Shan, H.; Lei, C.-L.; Hui, D.S.; et al. Clinical Characteristics of Coronavirus Disease 2019 in China. N. Engl. J. Med. 2020. [Google Scholar] [CrossRef] [PubMed]
- Thai, H.T.C.; Le, M.Q.; Vuong, C.D.; Parida, M.; Minekawa, H.; Notomi, T.; Hasebe, F.; Morita, K. Development and Evaluation of a Novel Loop-Mediated Isothermal Amplification Method for Rapid Detection of Severe Acute Respiratory Syndrome Coronavirus. J. Clin. Microbiol. 2004, 42, 1956–1961. [Google Scholar] [CrossRef] [PubMed]
- Lu, R.; Wu, X.; Wan, Z.; Li, Y.; Zuo, L.; Qin, J.; Jin, X.; Zhang, C. Development of a Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2. Virol. Sin. 2020. Online ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Tanner, N.A.; Zhang, Y.; Evans, T.C. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes. Biotechniques 2015, 58, 59–68. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, C.; Zhao, M.; Liu, K.; Li, H.; Li, N.; Gao, L.; Yang, X.; Ma, T.; Zhu, J.; et al. A direct isothermal amplification system adapted for rapid SNP genotyping of multifarious sample types. Biosens. Bioelectron. 2018, 115, 70–76. [Google Scholar] [CrossRef]
- Forootan, A.; Sjöback, R.; Bjorkman, J.; Sjögreen, B.; Linz, L.; Kubista, M. Methods to determine limit of detection and limit of quantification in quantitative real-time PCR (qPCR). Biomol. Detect. Quantif. 2017, 12, 1–6. [Google Scholar] [CrossRef]
Primers | Sequence (5’-3’) | Length (nt) |
---|---|---|
F3 | GCCAAAAGGCTTCTACGCA | 19 |
B3 | TTGCTCTCAAGCTGGTTCAA | 20 |
FIP | TCCCCTACTGCTGCCTGGAGCAGTCAAGCCTCTTCTCGTT | 40 |
BIP | TCTCCTGCTAGAATGGCTGGCATCTGTCAAGCAGCAGCAAAG | 42 |
LB | TGGCGGTGATGCTGCTCTT | 19 |
Dilution | Standard (Copies/Reaction) | Positive/Total Tested |
---|---|---|
1× | 1963 | 10/10 |
5× | 393 | 10/10 |
5× | 79 | 8/10 |
5× | 16 | 6/10 |
5× | 3 | 2/10 |
LOD | 118.6 copies/reaction |
RT-qPCR Assay | The novel RT-LAMP Assay | Total | Positive Rate (%) | Concordance Rate (%) | |
---|---|---|---|---|---|
Positive | Negative | ||||
Positive | 34 | 2 | 36 | 64.3% | 92.9% |
negative | 2 | 18 | 20 | ||
Total | 36 | 20 | 56 | ||
Positive rate (%) | 63.4% |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, R.; Wu, X.; Wan, Z.; Li, Y.; Jin, X.; Zhang, C. A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2. Int. J. Mol. Sci. 2020, 21, 2826. https://doi.org/10.3390/ijms21082826
Lu R, Wu X, Wan Z, Li Y, Jin X, Zhang C. A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2. International Journal of Molecular Sciences. 2020; 21(8):2826. https://doi.org/10.3390/ijms21082826
Chicago/Turabian StyleLu, Renfei, Xiuming Wu, Zhenzhou Wan, Yingxue Li, Xia Jin, and Chiyu Zhang. 2020. "A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2" International Journal of Molecular Sciences 21, no. 8: 2826. https://doi.org/10.3390/ijms21082826
APA StyleLu, R., Wu, X., Wan, Z., Li, Y., Jin, X., & Zhang, C. (2020). A Novel Reverse Transcription Loop-Mediated Isothermal Amplification Method for Rapid Detection of SARS-CoV-2. International Journal of Molecular Sciences, 21(8), 2826. https://doi.org/10.3390/ijms21082826