Genome-Wide Identification and Characterization of Drought Stress Responsive microRNAs in Tibetan Wild Barley
Abstract
1. Introduction
2. Results
2.1. High-Throughput Sequencing of Barley Small RNAs
2.2. Identification of Conserved miRNAs and Novel miRNAs
2.3. Genotypic Differences in miRNA Expression Profiles under Drought Stress in Barley
2.4. qRT-PCR Validation for miRNA Expression
2.5. Annotation and Functional Analysis of miRNA Target Genes
3. Discussion
3.1. Drought-Tolerance Associated miRNAs Involved in Gene Expression
3.2. Drought-Tolerance Associated miRNAs Involved in Metabolism
3.3. Drought-Tolerance Associated miRNAs Involved in Signaling
3.4. Drought-Tolerance Associated miRNAs Involved in Transportation
4. Materials and Methods
4.1. Plant Materials and Drought Treatment
4.2. Small RNAs Library Construction and Next-Generation Sequencing
4.3. Bioinformatics Analysis of Small RNAs
4.4. Differential Expression Profiles of miRNAs in Response to Drought Stress
4.5. Target Gene Prediction and Functional Analysis
4.6. qRT-PCR Validation
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wu, J.; Geng, G.; Zhou, H.; Liu, J.; Wang, Q.; Yang, J. Global vulnerability to agricultural drought and its spatial characteristics. Sci. China Earth Sci. 2017, 60, 910–920. [Google Scholar] [CrossRef]
- Wang, Z.; Li, J.; Lai, C.; Wang, R.Y.; Chen, X.; Lian, Y. Drying tendency dominating the global grain production area. Glob. Food Secur. Agr. 2018, 16, 138–149. [Google Scholar] [CrossRef]
- Ali, F.; Bano, A.; Fazal, A. Recent methods of drought stress tolerance in plants. Plant Growth Regul. 2017, 82, 363–375. [Google Scholar] [CrossRef]
- Basso, M.F.; Ferreira, P.C.G.; Kobayashi, A.K.; Harmon, F.G.; Nepomuceno, A.L.; Molinari, H.B.C.; Grossi-de-Sa, M.F. MicroRNAs and new biotechnological tools for its modulation and improving stress tolerance in plants. Plant Biotechnol. J. 2019, 17, 1482–1500. [Google Scholar] [CrossRef] [PubMed]
- Song, X.; Li, Y.; Cao, X.; Qi, Y. MicroRNAs and their regulatory roles in plant-environment interactions. Annu. Rev. Plant Biol. 2019, 70, 489–525. [Google Scholar] [CrossRef]
- Noman, A.; Fahad, S.; Aqeel, M.; Ali, U.; Amanullah; Anwar, S.; Baloch, S.K.; Zainab, M. miRNAs: Major modulators for crop growth and development under abiotic stresses. Biotechnol. Lett. 2017, 39, 685–700. [Google Scholar] [CrossRef]
- Zhang, B.; Unver, T. A critical and speculative review on microRNA technology in crop improvement: Current challenges and future directions. Plant Sci. 2018, 274, 193–200. [Google Scholar] [CrossRef]
- Fard, E.M.; Bakhshi, B.; Farsi, M.; Kakhki, A.M.; Nikpay, N.; Ebrahimi, M.A.; Mardi, M.; Salekdeh, G.H. MicroRNAs regulate the main events in rice drought stress response by manipulating the water supply to shoots. Mol. Biosyst. 2017, 13, 2289–2302. [Google Scholar] [CrossRef]
- Zhang, J.; Zhang, H.; Srivastava, A.K.; Pan, Y.; Bai, J.; Fang, J.; Shi, H.; Zhu, J. Knockdown of rice MicroRNA166 confers drought resistance by causing leaf rolling and altering stem xylem development. Plant Physiol. 2018, 176, 2082–2094. [Google Scholar] [CrossRef]
- Chen, J.; Li, L. Multiple regression analysis reveals microRNA regulatory networks in Oryza sativa under drought stress. Int. J. Genom. 2018, 2018, 9395261. [Google Scholar] [CrossRef]
- Yang, T.; Wang, Y.; Teotia, S.; Wang, Z.; Shi, C.; Sun, H.; Gu, Y.; Zhang, Z.; Tang, G. The interaction between miR160 and miR165/166 in the control of leaf development and drought tolerance in Arabidopsis. Sci. Rep. 2019, 9, 2832. [Google Scholar] [CrossRef] [PubMed]
- Hackenberg, M.; Gustafson, P.; Langridge, P.; Shi, B. Differential expression of microRNAs and other small RNAs in barley between water and drought conditions. Plant Biotechnol. J. 2015, 13, 2–13. [Google Scholar] [CrossRef] [PubMed]
- Ferdous, J.; Sanchez-Ferrero, J.C.; Langridge, P.; Milne, L.; Chowdhury, J.; Brien, C.; Tricker, P.J. Differential expression of microRNAs and potential targets under drought stress in barley. Plant Cell Environ. 2017, 40, 11–24. [Google Scholar] [CrossRef] [PubMed]
- Ferdous, J.; Whitford, R.; Nguyen, M.; Brien, C.; Langridge, P.; Tricker, P.J. Drought-inducible expression of Hv-miR827 enhances drought tolerance in transgenic barley. Funct. Integr. Genom. 2017, 17, 279–292. [Google Scholar] [CrossRef]
- Fard, E.M.; Bakhshi, B.; Keshavarznia, R.; Nikpay, N.; Shahbazi, M.; Salekdeh, G.H. Drought responsive microRNAs in two barley cultivars differing in their level of sensitivity to drought stress. Plant Physiol. Biochem. 2017, 118, 121–129. [Google Scholar] [CrossRef]
- Zhou, H.; Hussain, S.S.; Hackenberg, M.; Bazanova, N.; Eini, O.; Li, J.; Gustafson, P.; Shi, B. Identification and characterisation of a previously unknown drought tolerance-associated microRNA in barley. Plant J. 2018, 95, 138–149. [Google Scholar] [CrossRef]
- Dai, F.; Nevo, E.; Wu, D.; Comadran, J.; Zhou, M.; Qiu, L.; Chen, Z.; Beiles, A.; Chen, G.; Zhang, G. Tibet is one of the centers of domestication of cultivated barley. Proc. Natl. Acad. Sci. USA 2012, 109, 16969–16973. [Google Scholar] [CrossRef]
- Dai, F.; Chen, Z.; Wang, X.; Li, Z.; Jin, G.; Wu, D.; Cai, S.; Wang, N.; Wu, F.; Nevo, E.; et al. Transcriptome profiling reveals mosaic genomic origins of modern cultivated barley. Proc. Natl. Acad. Sci. USA 2014, 111, 13403–13408. [Google Scholar] [CrossRef]
- Zhao, J.; Sun, H.; Dai, H.; Zhang, G.; Wu, F. Difference in response to drought stress among Tibet wild barley genotypes. Euphytica 2010, 172, 395–403. [Google Scholar] [CrossRef]
- Yang, D.H.; Kwak, K.J.; Kim, M.K.; Park, S.J.; Yang, K.; Kang, H. Expression of Arabidopsis glycine-rich RNA-binding protein AtGRP2 or AtGRP7 improves grain yield of rice (Oryza sativa) under drought stress conditions. Plant Sci. 2014, 214, 106–112. [Google Scholar] [CrossRef]
- Tan, Y.; Qin, Y.; Li, Y.; Li, M.; Ma, F. Overexpression of MpGR-RBP1, a glycine-rich RNA-binding protein gene from Malus prunifolia (Willd.) Borkh., confers salt stress tolerance and protects against oxidative stress in Arabidopsis. Plant Cell Tiss. Org. 2014, 119, 635–646. [Google Scholar] [CrossRef]
- Sun, M.; Jia, B.; Yang, J.; Cui, N.; Zhu, Y.; Sun, X. Genome-wide identification of the PHD-Finger family genes and their responses to environmental stresses in Oryza sativa L. Int. J. Mol. Sci. 2017, 18, 2005. [Google Scholar] [CrossRef]
- Wang, Q.; Liu, J.; Wang, Y.; Zhao, Y.; Jiang, H.; Cheng, B. Systematic analysis of the maize PHD-Finger gene family reveals a subfamily involved in abiotic stress response. Int. J. Mol. Sci. 2015, 16, 23517–23544. [Google Scholar] [CrossRef] [PubMed]
- Dronamraju, R.; Hepperla, A.J.; Shibata, Y.; Adams, A.T.; Magnuson, T.; Davis, I.J.; Strahl, B.D. Spt6 association with RNA polymerase II directs mRNA turnover during transcription. Mol. Cell 2018, 70, 1054–1066. [Google Scholar] [CrossRef]
- Jiang, S.; Liang, X.; Li, X.; Wang, S.; Lv, D.; Ma, C.; Li, X.; Ma, W.; Yan, Y. Wheat Drought-responsive grain proteome analysis by linear and nonlinear 2-DE and MALDI-TOF mass spectrometry. Int. J. Mol. Sci. 2012, 13, 16065–16083. [Google Scholar] [CrossRef]
- Cai, X.; Davis, E.J.; Ballif, J.; Liang, M.; Bushman, E.; Haroldsen, V.; Torabinejad, J.; Wu, Y. Mutant identification and characterization of the laccase gene family in Arabidopsis. J. Exp. Bot. 2006, 57, 2563–2569. [Google Scholar] [CrossRef]
- Cho, H.Y.; Lee, C.; Hwang, S.; Park, Y.C.; Lim, H.L.; Jang, C.S. Overexpression of the OsChI1 gene, encoding a putative laccase precursor, increases tolerance to drought and salinity stress in transgenic Arabidopsis. Gene 2014, 552, 98–105. [Google Scholar] [CrossRef]
- Zhao, X.; Pang, M.; Zhao, Q.; Ren, Y.; Hao, Y.; You, C. Cloning and expression analysis of tomato LeLACmiR397 gene. Acta Hortic. Sin. 2015, 42, 1285–1298. [Google Scholar]
- Ogawa, S.; Mitsuya, S. S-methylmethionine is involved in the salinity tolerance of Arabidopsis thaliana plants at germination and early growth stages. Physiol. Plant. 2012, 144, 13–19. [Google Scholar] [CrossRef]
- Szypulska, E.; Jankowski, K.; Weidner, S. ABA pretreatment can limit salinity-induced proteome changes in growing barley sprouts. Acta Physiol. Plant. 2017, 39, 190. [Google Scholar] [CrossRef]
- Mostofa, M.G.; Li, W.; Nguyen, K.H.; Fujita, M.; Lam-Son, P.T. Strigolactones in plant adaptation to abiotic stresses: An emerging avenue of plant research. Plant Cell Environ. 2018, 41, 2227–2243. [Google Scholar] [CrossRef] [PubMed]
- Kochian, L.V. Root architecture. J. Integr. Plant Biol. 2016, 58, 190–192. [Google Scholar] [CrossRef] [PubMed]
- Uga, Y.; Sugimoto, K.; Ogawa, S.; Rane, J.; Ishitani, M.; Hara, N.; Kitomi, Y.; Inukai, Y.; Ono, K.; Kanno, N.; et al. Control of root system architecture by DEEPER ROOTING 1 increases rice yield under drought conditions. Nat. Genet. 2013, 45, 1097–1102. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Li, C.; Yao, X.; Liu, S.; Zhang, P.; Chen, K. The Antarctic moss leucine-rich repeat receptor-like kinase (PnLRR-RLK2) functions in salinity and drought stress adaptation. Polar Biol. 2018, 41, 353–364. [Google Scholar] [CrossRef]
- Kang, J.; Li, J.; Gao, S.; Tian, C.; Zha, X. Overexpression of the leucine-rich receptor-like kinase gene LRK2 increases drought tolerance and tiller number in rice. Plant Biotechnol. J. 2017, 15, 1175–1185. [Google Scholar] [CrossRef] [PubMed]
- Baek, D.; Chun, H.J.; Kang, S.; Shin, G.; Park, S.J.; Hong, H.; Kim, C.; Kim, D.H.; Lee, S.Y.; Kim, M.C.; et al. A role for Arabidopsis miR399f in salt, drought, and ABA signaling. Mol. Cells 2016, 39, 111–118. [Google Scholar]
- Park, J.; Song, W.; Ko, D.; Eom, Y.; Hansen, T.H.; Schiller, M.; Lee, T.G.; Martinoia, E.; Lee, Y. The phytochelatin transporters AtABCC1 and AtABCC2 mediate tolerance to cadmium and mercury. Plant J. 2012, 69, 278–288. [Google Scholar] [CrossRef]
- Wu, F.B.; Zhang, G.P.; Dominy, P. Four barley genotypes respond differently to cadmium: Lipid peroxidation and activities of antioxidant capacity. Environ. Exp. Bot. 2003, 50, 67–78. [Google Scholar] [CrossRef]
- Zhang, M.; Jin, Z.Q.; Zhao, J.; Zhang, G.P.; Wu, F.B. Physiological and biochemical responses to drought stress in cultivated and Tibetan wild barley. Plant Growth Regul. 2015, 75, 567–574. [Google Scholar] [CrossRef]
- Forster, B.P.; Ellis, R.P.; Moir, J.; Talame, V.; Sanguineti, M.C.; Tuberosa, R.; This, D.; Teulat-Merah, B.; Ahmed, I.; Mariy, S.A.E.E.; et al. Genotype and phenotype associations with drought tolerance in barley tested in North Africa. Ann. Appl. Biol. 2004, 144, 157–168. [Google Scholar] [CrossRef]
- He, X.Y.; Zeng, J.B.; Cao, F.B.; Ahmed, I.M.; Zhang, G.; Vincze, E.; Wu, F.B. HvEXPB7, a novel β-expansin gene revealed by the root hair transcriptome of Tibetan wild barley, improves root hair growth under drought stress. J. Exp. Bot. 2015, 66, 7405–7419. [Google Scholar] [CrossRef] [PubMed]
- Mortazavi, A.; Williams, B.A.; McCue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Gerstein, M.; Snyder, M. RNA-Seq: A revolutionary tool for transcriptomics. Nat. Rev. Genet. 2009, 10, 57–63. [Google Scholar] [CrossRef] [PubMed]
- Nawrocki, E.P.; Burge, S.W.; Bateman, A.; Daub, J.; Eberhardt, R.Y.; Eddy, S.R.; Floden, E.W.; Gardner, P.P.; Jones, T.A.; Tate, J.; et al. Rfam 12.0: Updates to the RNA families database. Nucleic Acids Res. 2015, 43, D130–D137. [Google Scholar] [CrossRef] [PubMed]
- Benson, D.A.; Cavanaugh, M.; Clark, K.; Karsch-Mizrachi, I.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBank. Nucleic Acids Res. 2018, 46, D41–D47. [Google Scholar] [CrossRef]
- Langmead, B.; Schatz, M.C.; Lin, J.; Pop, M.; Salzberg, S.L. Searching for SNPs with cloud computing. Genome Biol. 2009, 10, R134. [Google Scholar] [CrossRef]
- Kozomara, A.; Griffiths-Jones, S. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Res. 2014, 42, D68–D73. [Google Scholar] [CrossRef]
- Hofacker, I.L. Vienna RNA secondary structure server. Nucleic Acids Res. 2003, 31, 3429–3431. [Google Scholar] [CrossRef]
- t Hoen, P.A.C.; Ariyurek, Y.; Thygesen, H.H.; Vreugdenhil, E.; Vossen, R.H.A.M.; de Menezes, R.X.; Boer, J.M.; van Ommen, G.B.; den Dunnen, J.T. Deep sequencing-based expression analysis shows major advances in robustness, resolution and inter-lab portability over five microarray platforms. Nucleic Acids Res. 2008, 36, e141. [Google Scholar] [CrossRef]
- Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef]
- Wu, H.; Ma, Y.; Chen, T.; Wang, M.; Wang, X. PsRobot: A web-based plant small RNA meta-analysis toolbox. Nucleic Acids Res. 2012, 40, W22–W28. [Google Scholar] [CrossRef] [PubMed]
- Fahlgren, N.; Carrington, J.C. miRNA Target Prediction in Plants. In Plant MicroRNAs, Methods in Molecular Biology (Methods and Protocols); Meyers, B., Green, P., Eds.; Humana Press: Hertfordshire, UK, 2010; Volume 592, pp. 51–57. [Google Scholar]
- Qiu, C.W.; Zhao, J.; Chen, Q.; Wu, F. Genome-wide characterization of drought stress responsive long non-coding RNAs in Tibetan wild barley. Environ. Exp. Bot. 2019, 164, 124–134. [Google Scholar] [CrossRef]
- Gotz, S.; Garcia-Gomez, J.M.; Terol, J.; Williams, T.D.; Nagaraj, S.H.; Nueda, M.J.; Robles, M.; Talon, M.; Dopazo, J.; Conesa, A. High-throughput functional annotation and data mining with the Blast2GO suite. Nucleic Acids Res. 2008, 36, 3420–3435. [Google Scholar] [CrossRef]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef] [PubMed]
Library Type | XZ5 Control | XZ5 Drought | XZ54 Control | XZ54 Drought | Tadmor Control | Tadmor Drought |
---|---|---|---|---|---|---|
Total raw reads | 27,450,467 | 26,932,023 | 27,644,000 | 27,800,513 | 28,585,892 | 28,370,268 |
Total clean reads | 24,339,157 (88.67%) | 24,392,408 (90.57%) | 24,939,692 (90.22%) | 25,771,155 (92.70%) | 26,245,145 (91.81%) | 25,550,026 (90.06%) |
Mapped to Genome | 17,310,505 (71.12%) | 16,809,346 (68.91%) | 18,034,873 (72.31%) | 191,790,27 (74.42%) | 18,772,380 (71.53%) | 18,558,569 (72.64%) |
Total miRNA reads | 1,655,750 (6.80%) | 1,401,558 (5.75%) | 1,705,665 (6.84%) | 1,312,933 (5.09%) | 2,127,598 (8.11%) | 1,553,489 (6.08%) |
Conserved miRNAs | 64 | 64 | 65 | 62 | 64 | 64 |
Novel miRNAs | 944 | 797 | 972 | 877 | 1011 | 965 |
miRNA Name | Sequence | Fold Change | Target Gene | Annotation | ||
---|---|---|---|---|---|---|
XZ5 | XZ54 | Tadmor | ||||
hvu-miR397a | CCGUUGAGUGCAGCGUUGAUG | −2.10 | 2.07 | 3.11 | MLOC_54246.3 | Laccase-23 (Oryza sativa) |
hvu-miR399 | UGCCAAAGGAGAUUUGCCCCG | −1.66 | −0.97 | −1.21 | MLOC_52822.6 | PHOSPHATE2 (Brachypodium distachyon) |
Novel-m0406-3p | CUUGGUCAAACUUAAAGAUGU | −1.47 | −0.35 | 0.54 | MLOC_70587.1 | PHD finger protein (Arabidopsis thaliana) |
Novel-m0521-5p | UCUUAUGUUGUGGGACGGAGG | −1.09 | −0.65 | −0.81 | MLOC_10013.2 | LRR receptor-like protein kinase (A. thaliana) |
MLOC_50162.1 | Sucrose synthase 1 (O. sativa) | |||||
MLOC_67419.2 | Ser/Thr-protein kinase PBS1 (A. thaliana) | |||||
MLOC_67450.11 | Beta-carotene isomerase D27 (O. sativa) | |||||
MLOC_73965.1 | Homocysteine S-methyltransferase 3 (B. distachyon) | |||||
Novel-m0598-3p | UUUCGAUGUGCAACCAUGGUC | −1.33 | −0.26 | 0.42 | MLOC_34795.2 | RNA polymerase, 25-kDa subunit (A. thaliana) |
Novel-m0624-3p | UGAGCCGAACCAAUAUCACUC | −1.05 | −0.06 | 0.50 | MLOC_55820.2 | Pectinesterase (A. thaliana) |
Novel-m0793-3p | UGCCAAAGGAGAACUGCCCUG | −1.12 | −0.57 | 0.45 | MLOC_52822.6 | PHOSPHATE2 (B. distachyon) |
Novel-m1587-5p | UUGAAGAUUAGGUGGCGGCG | −1.41 | −0.24 | −0.89 | MLOC_56261.3 | ABC transporter C family member 2-like (B. distachyon) |
Novel-m1738-3p | UGAACAUCCCAGAGCCACCGG | −2.95 | −0.35 | −1.21 | MLOC_3895.3 | Dro1 gene for early auxin response protein (O. sativa) |
Novel-m1900-5p | UGCCUGGCUCCCUGUAUGCC | −1.95 | −0.20 | 1.03 | MLOC_16998.3 | Glycine-rich RNA-binding protein 10 (Brassica napus) |
Novel-m2311-5p | GGAAUGUUGUCUGGCUCGGG | −2.22 | −0.35 | −1.00 | MLOC_61629.2 | Transcription elongation factor SPT6 (Vitis vinifera) |
Novel-m2328-3p | GCGUGCAAGGAGCCAAGCAUG | −1.18 | 0.05 | −0.43 | MLOC_6972.2 | DNA cross-link repair 1A protein (B. distachyon) |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qiu, C.-W.; Liu, L.; Feng, X.; Hao, P.-F.; He, X.; Cao, F.; Wu, F. Genome-Wide Identification and Characterization of Drought Stress Responsive microRNAs in Tibetan Wild Barley. Int. J. Mol. Sci. 2020, 21, 2795. https://doi.org/10.3390/ijms21082795
Qiu C-W, Liu L, Feng X, Hao P-F, He X, Cao F, Wu F. Genome-Wide Identification and Characterization of Drought Stress Responsive microRNAs in Tibetan Wild Barley. International Journal of Molecular Sciences. 2020; 21(8):2795. https://doi.org/10.3390/ijms21082795
Chicago/Turabian StyleQiu, Cheng-Wei, Li Liu, Xue Feng, Peng-Fei Hao, Xiaoyan He, Fangbin Cao, and Feibo Wu. 2020. "Genome-Wide Identification and Characterization of Drought Stress Responsive microRNAs in Tibetan Wild Barley" International Journal of Molecular Sciences 21, no. 8: 2795. https://doi.org/10.3390/ijms21082795
APA StyleQiu, C.-W., Liu, L., Feng, X., Hao, P.-F., He, X., Cao, F., & Wu, F. (2020). Genome-Wide Identification and Characterization of Drought Stress Responsive microRNAs in Tibetan Wild Barley. International Journal of Molecular Sciences, 21(8), 2795. https://doi.org/10.3390/ijms21082795