Increased Flavonol Levels in Tobacco Expressing AcFLS Affect Flower Color and Root Growth
Abstract
1. Introduction
2. Results
2.1. Recombinant AcFLS-HRB Protein Exhibits both F3H and FLS Activity
2.2. Transgenic Tobacco Expressing AcFLS-HRB Has Lighter-Pink Flowers than the Wild-Type
2.3. Expression of AcFLS-HRB in Tobacco Increases Flavonol and Decreases Anthocyanin Levels in Flowers
2.4. Anthocyanin Biosynthesis Genes Are Down-Regulated in AcFLS-HRB Transgenic Tobacco Petals
2.5. Increased Flavonol Levels in Tobacco Expressing AcFLS-HRB Promote Primary Root and Root Hair Growth
2.6. Exogenous Rutin Treatment Enhances Primary Root and Root Hair Growth in Wild-Type Tobacco Seedlings
3. Discussion
4. Materials and Methods
4.1. Expression of Recombinant AcFLS-HRB Protein in E. coli and In Vivo Feeding Assay
4.2. Vector Construction for Tobacco Transformation
4.3. Transformation of Tobacco Plants
4.4. HPLC Analysis of Flavonoids
4.5. Protein Extraction and Immunoblot Analysis
4.6. RNA Extraction and qPCR Analysis
4.7. Tobacco Seedling Culture and Exogenous Rutin Treatment
4.8. DPBA Staining
4.9. Chemical Standards
4.10. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Winkel-Shirley, B. Biosynthesis of flavonoids and effects of stress. Curr. Opin. Plant Biol. 2002, 5, 218–223. [Google Scholar] [CrossRef]
- Williams, C.A.; Grayer, R.J. Anthocyanins and other flavonoids. Nat. Prod. Rep. 2004, 21, 539–573. [Google Scholar] [CrossRef]
- Ferrer, J.L.; Austin, M.B.; Stewart, C.; Noe, J.P. Structure and function of enzymes involved in the biosynthesis of phenylpropanoids. Plant Physiol. Biochem. 2008, 46, 356–370. [Google Scholar] [CrossRef]
- Zhang, S.Z.; Yang, X.N.; Coburn, R.A.; Morris, M.E. Structure activity relationships and quantitative structure activity relationships for the flavonoid-mediated inhibition of breast cancer resistance protein. Biochem. Pharmacol. 2005, 70, 627–639. [Google Scholar] [CrossRef]
- Jacobs, M.; Rubery, P.H. Naturally occurring auxin transport regulators. Science 1988, 241, 346–349. [Google Scholar] [CrossRef]
- Hungria, M.; Joseph, C.M.; Phillips, D.A. Anthocyanidins and flavonols, major nod gene inducers from seeds of a black-seeded common bean (Phaseolus vulgaris L.). Plant Physiol. 1991, 97, 751–758. [Google Scholar] [CrossRef]
- Mo, Y.; Nagel, C.; Taylor, L.P. Biochemical complementation of chalcone synthase mutants defines a role for flavonols in functional pollen. Proc. Natl. Acad. Sci. USA 1992, 89, 7213–7217. [Google Scholar] [CrossRef]
- Vogt, T.; Wollenweber, E.; Taylor, L.P. The structural requirements of flavonols that induce pollen germination of conditionally male fertile Petunia. Phytochemistry 1995, 38, 589–592. [Google Scholar] [CrossRef]
- Solovchenko, A.; Schmitz-Eiberger, M. Significance of skin flavonoids for UV-B-protection in apple fruits. J. Exp. Bot. 2003, 54, 1977–1984. [Google Scholar] [CrossRef]
- Winkel-Shirley, B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001, 126, 485–493. [Google Scholar] [CrossRef]
- Hassan, S.; Mathesius, U. The role of flavonoids in root-rhizosphere signaling: Opportunities and challenges for improving plant-microbe interactions. J. Exp. Bot. 2012, 63, 3429–3444. [Google Scholar] [CrossRef]
- Sparvoli, F.; Martin, C.; Scienza, A.; Gavazzi, G.; Tonelli, C. Cloning and molecular analysis of structural genes involved in flavonoid and stilbene biosynthesis in grape (Vitis vinifera L.). Plant Mol. Biol. 1994, 24, 743–755. [Google Scholar] [CrossRef]
- Yu, B.; Zhang, D.; Huang, C.H.; Qian, M.J.; Zheng, X.Y.; Teng, Y.W.; Su, J.; Shu, Q. Isolation of anthocyanin biosynthetic genes in red Chinese sand pear (Pyrus pyrifolia Nakai) and their expression as affected by organ/tissue, cultivar, bagging and fruit side. Sci. Hort. 2012, 136, 29–37. [Google Scholar] [CrossRef]
- Huang, J.; Gu, M.; Lai, Z.; Fan, B.; Shi, K.; Zhou, Y.H.; Yu, J.Q.; Chen, Z. Functional analysis of the arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 2010, 153, 1526–1538. [Google Scholar] [CrossRef]
- Cos, P.; Calomme, M.; Sindambiwe, J.B.; Bruyne, T.D.; Cimanga, K.; Pieters, L.; Vlietinck, A.J.; Berghe, D.V. Cytotoxicity and lipid peroxidation-inhibiting activity of flavonoids. Planta Med. 2001, 67, 515–519. [Google Scholar] [CrossRef]
- Bowles, D.; Lim, E.K.; Poppenberger, B.; Vaistij, F.E. Glycosyltransferases of lipophilic small molecules. Annu. Rev. Plant Biol. 2006, 57, 567–597. [Google Scholar] [CrossRef]
- Winkel-Shirley, B. The biosynthesis of flavonoids. In The Science of Flavonoids; Grotewold, E., Ed.; Springer Science+Business Media, Inc.: New York, NY, USA, 2006; pp. 71–95. [Google Scholar] [CrossRef]
- Moreira, M.R.; Kanashiro, A.; Kabeya, L.M.; Polizello, A.C.; Azzolini, A.E.; Curti, C.; Oliveira, C.A.; T-do Amaral, A.; Lucisano-Valim, Y.M. Neutrophil effector functions triggered by Fc-gamma and/or complement receptors are dependent on B-ring hydroxylation pattern and physicochemical properties of flavonols. Life Sci. 2007, 81, 317–326. [Google Scholar] [CrossRef]
- Xiao, J.; Cao, H.; Wang, Y.; Zhao, J.; Wei, X. Glycosylation of dietary flavonoids decreases the affinities for plasma protein. J. Agri. Food Chem. 2009, 57, 6642–6648. [Google Scholar] [CrossRef]
- Nielsen, K.; Deroles, S.C.; Markham, K.R.; Bradley, M.J.; Podivinsky, E.; Manson, D. Antisense flavanol synthase alters co-pigmentation and flower color in lisianthus. Mol. Breeding 2002, 9, 615–622. [Google Scholar] [CrossRef]
- Davies, K.M.; Schwinn, K.E.; Deroles, S.C.; Manson, D.G.; Lewis, D.H.; Bloor, S.J.; Bradley, J.M. Enhancing anthocyanin production by altering competition for substrate between flavonol synthase and dihydroflavonol 4-reductase. Euphytica 2003, 131, 259–268. [Google Scholar] [CrossRef]
- Yuan, Y.W.; Rebocho, A.B.; Sagawa, J.M.; Stanley, L.E.; Bradshaw, H.D. Competition between anthocyanin and flavonol biosynthesis produces spatial pattern variation of floral pigments between Mimulus species. Proc. Natl. Acad. Sci. USA. 2016, 113, 2448–2453. [Google Scholar] [CrossRef]
- Lim, S.H.; You, M.K.; Kim, D.H.; Kim, J.K.; Lee, J.Y.; Ha, S.H. RNAi-mediated suppression of dihydroflavonol 4-reductase in tobacco allows fine-tuning of flower color and flux through the flavonoid biosynthetic pathway. Plant Physiol. Biochem. 2016, 109, 482–490. [Google Scholar] [CrossRef]
- Luo, P.; Ning, G.; Wang, Z.; Shen, Y.; Jin, H.; Li, P.; Huang, S.; Zhao, J.; Bao, M. Disequilibrium of flavonol synthase and dihydroflavonol-4-reductase expression associated tightly to white vs. red color flower formation in plants. Front. Plant Sci. 2016, 6, 1257. [Google Scholar] [CrossRef]
- Borevitz, J.O.; Xia, Y.; Blount, J.; Dixon, R.A.; Lamb, C. Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 2000, 12, 2383–2394. [Google Scholar] [CrossRef]
- Zimmermann, I.M.; Heim, M.A.; Weisshaar, B.; Uhrig, J.F. Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins. Plant J. 2004, 40, 22–34. [Google Scholar] [CrossRef]
- Ramsay, N.A.; Glover, B.J. MYB–bHLH–WD40 protein complex and the evolution of cellular diversity. Trends Plant Sci. 2005, 10, 63–70. [Google Scholar] [CrossRef]
- Stracke, R.; Ishihara, H.; Huep, G.; Barsch, A.; Mehrtens, F.; Niehaus, K.; Weisshaar, B. Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling. Plant J. 2007, 50, 660–677. [Google Scholar] [CrossRef]
- Luo, J.; Butelli, E.; Hill, L.; Parr, A.; Niggeweg, R.; Bailey, P.; Weisshaar, B.; Martin, C. AtMYB12 regulates caffeoyl quinic acid and flavonol synthesis in tomato: Expression in fruit results in very high levels of both types of polyphenol. Plant J. 2008, 56, 316–326. [Google Scholar] [CrossRef]
- Falcone Ferreyra, M.L.; Rius, S.; Emiliani, J.; Pourcel, L.; Feller, A.; Morohashi, K.; Casati, P.; Grotewold, E. Cloning and characterization of a UV-B-inducible maize flavonol synthase. Plant J. 2010, 62, 77–91. [Google Scholar] [CrossRef]
- Jiang, R.; Tian, J.; Song, T.; Zhang, J.; Yao, Y. The Malus crabapple transcription factor McMYB10 regulates anthocyanin biosynthesis during petal coloration. Sci. Hort. 2014, 166, 42–49. [Google Scholar] [CrossRef]
- Lee, S.H.; Cho, H.T. PINOID positively regulates auxin efflux in arabidopsis root hair cells and tobacco cells. Plant Cell 2006, 18, 1604–1616. [Google Scholar] [CrossRef] [PubMed]
- Kuhn, B.M.; Nodzyński, T.; Errafi, S.; Bucher, R.; Gupta, S.; Aryal, B.; Dobrev, P.; Bigler, L.; Geisler, M.; Zažímalová, E.; et al. Flavonol-induced changes in PIN2 polarity and auxin transport in the Arabidopsis thaliana rol1-2 mutant require phosphatase activity. Sci. Rep. 2017, 7, 41906. [Google Scholar] [CrossRef]
- Tsukagoshi, H.; Busch, W.; Benfey, P.N. Transcriptional regulation of ROS controls transition from proliferation to differentiation in the root. Cell 2010, 143, 606–616. [Google Scholar] [CrossRef] [PubMed]
- Silva-Navas, J.; Moreno-Risueno, M.A.; Manzano, C.; Téllez-Robledo, B.; Navarro-Neila, S.; Carrasco, V.; Pollmann, S.; Gallego, F.J.; Del Pozo, J.C. Flavonols mediate root phototropism and growth through regulation of proliferation-to-differentiation transition. Plant Cell 2016, 28, 1372–1387. [Google Scholar] [CrossRef] [PubMed]
- Tan, H.; Man, C.; Xie, Y.; Yan, J.; Chu, J.; Huang, J. A crucial role of GA-regulated flavonol biosynthesis in root growth of Arabidopsis. Mol. Plant 2019, 12, 521–537. [Google Scholar] [CrossRef] [PubMed]
- Maloney, G.S.; DiNapoli, K.T.; Muday, G.K. The anthocyanin reduced tomato mutant demonstrates the role of flavonols in tomato lateral root and root hair development. Plant Physiol. 2014, 166, 614–631. [Google Scholar] [CrossRef] [PubMed]
- Ringli, C.; Bigler, L.; Kuhn, B.M.; Leiber, R.M.; Diet, A.; Santelia, D.; Frey, B.; Pollmann, S.; Klein, M. The modified flavonol glycosylation profile in the Arabidopsis rol1 mutants results in alterations in plant growth and cell shape formation. Plant Cell 2008, 20, 1470–1481. [Google Scholar] [CrossRef]
- Yin, R.; Han, K.; Heller, W.; Albert, A.; Dobrev, P.I.; Zažímalová, E.; Schäffner, A.R. Kaempferol 3-O-rhamnoside-7-O-rhamnoside is an endogenous flavonol inhibitor of polar auxin transport in Arabidopsis shoots. New Phytol. 2014, 201, 466–475. [Google Scholar] [CrossRef]
- Grunewald, W.; De Smet, I.; Lewis, D.R.; Löfke, C.; Jansen, L.; Goeminne, G.; Vanden Bossche, R.; Karimi, M.; De Rybel, B.; Vanholme, B.; et al. Transcription factor WRKY23 assists auxin distribution patterns during Arabidopsis root development through local control on flavonol biosynthesis. Proc. Natl. Acad. Sci. USA. 2012, 31, 109. [Google Scholar] [CrossRef]
- Zhang, Y.; De Stefano, R.; Robine, M.; Butelli, E.; Bulling, K.; Hill, L.; Rejzek, M.; Martin, C.; Schoonbeek, H.J. Different reactive oxygen species scavenging properties of flavonoids determine their abilities to extend the shelf life of tomato. Plant Physiol. 2015, 169, 1568–1583. [Google Scholar] [CrossRef][Green Version]
- Pelletier, M.K.; Murrell, J.R.; Shirley, B.W. Characterization of flavonol synthase and leucoanthocyanidin dioxygenase genes in Arabidopsis. Further evidence for differential regulation of “early” and “late” genes. Plant Physiol. 1997, 113, 1437–1445. [Google Scholar] [CrossRef] [PubMed]
- Lin, G.Z.; Lian, Y.J.; Ryu, J.H.; Sung, M.K.; Park, J.S.; Park, H.J.; Park, B.K.; Shin, J.S.; Lee, M.S.; Cheon, C.I. Expression and purification of His-tagged flavonol synthase of Camellia sinensis from Escherichia coli. Protein Expr Purif. 2007, 55, 287–292. [Google Scholar] [CrossRef] [PubMed]
- Wellmann, F.; Lukacin, R.; Moriguchi, T.; Britsch, L.; Schiltz, E.; Matern, U. Functional expression and mutational analysis of flavonol synthase from Citrus unshiu. Eur. J. Biochem. 2002, 269, 4134–4142. [Google Scholar] [CrossRef]
- Li, C.; Bai, Y.; Li, S.; Chen, H.; Han, X.; Zhao, H.; Shao, J.; Park, S.U.; Wu, Q. Cloning, characterization, and activity analysis of a flavonol synthase gene FtFLS1 and its association with flavonoid content in tartary buckwheat. J. Agric. Food Chem. 2012, 60, 5161–5168. [Google Scholar] [CrossRef]
- Xu, F.; Li, L.; Zhang, W.; Cheng, H.; Sun, N.; Cheng, S.; Wang, Y. Isolation, characterization, and function analysis of a flavonol synthase gene from Ginkgo biloba. Mol. Biol. Rep. 2012, 39, 2285–2296. [Google Scholar] [CrossRef] [PubMed]
- Holton, T.A.; Brugliera, F.; Tanaka, Y. Cloning and expression of flavonol synthase from Petunia hybrida. Plant J. 1993, 4, 1003–1010. [Google Scholar] [CrossRef] [PubMed]
- Fujita, A.; Goto-Yamamoto, N.; Aramaki, I.; Hashizume, K. Organ-specific transcription of putative flavonol synthase genes of grapevine and effects of plant hormones and shading on flavonol biosynthesis in grape berry skins. Biosci. Biotechnol. Biochem. 2006, 70, 632–638. [Google Scholar] [CrossRef]
- Park, S.; Kim, D.H.; Lee, J.Y.; Ha, S.H.; Lim, S.H. Comparative analysis of two flavonol synthases from different-colored onions provides insight into flavonoid biosynthesis. J. Agric. Food Chem. 2017, 65, 5287–5298. [Google Scholar] [CrossRef]
- Park, S.; Kim, D.H.; Park, B.R.; Lee, J.Y.; Lim, S.H. Molecular and Functional Characterization of Oryza sativa Flavonol Synthase (OsFLS), a Bifunctional Dioxygenase. J. Agric. Food Chem. 2019, 67, 7399–7409. [Google Scholar] [CrossRef]
- Owens, D.K.; Crosby, K.C.; Runac, J.; Howard, B.A.; Winkel, B.S. Biochemical and genetic characterization of Arabidopsis flavanone 3beta-hydroxylase. Plant Physiol. Biochem. 2008, 46, 833–843. [Google Scholar] [CrossRef]
- Peer, W.A.; Brown, D.E.; Tague, B.W.; Muday, G.K.; Taiz, L.; Murphy, A.S. Flavonoid accumulation patterns of transparent testa mutants of Arabidopsis. Plant Physiol. 2001, 126, 536–548. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Zhao, Q. Membrane-bound metabolons. Nat. Plants. 2018, 4, 245–246. [Google Scholar] [CrossRef] [PubMed]
- Winkel, B.S.J. Metabolic channeling in plants. Annu. Rev. Plant Biol. 2004, 55, 85–107. [Google Scholar] [CrossRef] [PubMed]
- Vu, T.T.; Jeong, C.Y.; Nguyen, H.N.; Lee, D.; Lee, S.A.; Kim, J.H.; Hong, S.W.; Lee, H. Characterization of Brassica napus flavonol synthase involved in flavonol biosynthesis in Brassica napus L. J. Agric. Food Chem. 2015, 63, 7819–7829. [Google Scholar] [CrossRef] [PubMed]
- Nakatsuka, T.; Abe, Y.; Kakizaki, Y.; Yamamura, S.; Nishihara, M. Production of red-flowered plants by genetic engineering of multiple flavonoid biosynthetic genes. Plant Cell Rep. 2007, 26, 1951–1959. [Google Scholar] [CrossRef]
- Kim, D.H.; Park, S.; Lee, J.Y.; Ha, S.H.; Lim, S.H. Enhancing flower color through simultaneous expression of the B-peru and mPAP1 transcription factors under control of a flower-specific promoter. Int. J. Mol. Sci. 2018, 19, 309. [Google Scholar] [CrossRef] [PubMed]
- Mahajan, M.; Ahuja, P.S.; Yadav, S.K. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set. PLoS ONE 2011, 6, e28315. [Google Scholar] [CrossRef]
- Chen, S.; Wu, F.; Li, Y.; Qian, Y.; Pan, X.; Li, F.; Wang, Y.; Wu, Z.; Fu, C.; Lin, H.; et al. NtMYB4 and NtCHS1 are critical factors in the regulation of flavonoid biosynthesis and are involved in salinity responsiveness. Front. Plant Sci. 2019, 10, 178. [Google Scholar] [CrossRef]
- Brown, D.E.; Rashotte, A.M.; Murphy, A.S.; Normanly, J.; Tague, B.W.; Peer, W.A.; Taiz, L.; Muday, G.K. Flavonoids act as negative regulators of auxin transport in vivo in arabidopsis. Plant Physiol. 2001, 126, 524–535. [Google Scholar] [CrossRef]
- Peer, W.A.; Bandyopadhyay, A.; Blakeslee, J.J.; Makam, S.N.; Chen, R.J.; Masson, P.H.; Murphy, A.S. Variation in expression and protein localization of the PIN family of auxin efflux facilitator proteins in flavonoid mutants with altered auxin transport in Arabidopsis thaliana. Plant Cell 2004, 16, 1898–1911. [Google Scholar] [CrossRef]
- Foreman, J.; Demidchik, V.; Bothwell, J.H.; Mylona, P.; Miedema, H.; Torres, M.A.; Linstead, P.; Costa, S.; Brownlee, C.; Jones, J.D.; et al. Reactive oxygen species produced by NADPH oxidase regulate plant cell growth. Nature 2003, 422, 442–446. [Google Scholar] [CrossRef] [PubMed]
- Dubin, M.J.; Bowler, C.; Benvenuto, G. A modified Gateway cloning strategy for overexpressing tagged proteins in plants. Plant Methods 2008, 22, 4:3. [Google Scholar] [CrossRef]
- Karimi, M.; Inzé, D.; Depicker, A. GATEWAY™ vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci. 2002, 7, 193–195. [Google Scholar] [CrossRef]
- Park, S.; Choi, M.J.; Lee, J.Y.; Kim, J.K.; Ha, S.H.; Lim, S.H. Molecular and Biochemical Analysis of Two Rice flavonoid 3ʹ-hydroxylase to evaluate their roles in flavonoid biosynthesis in rice grain. Int. J. Mol. Sci. 2016, 17, 1549. [Google Scholar] [CrossRef]
- Santelia, D.; Henrichs, S.; Vincenzetti, V.; Sauer, M.; Bigler, L.; Klein, M.; Bailly, A.; Lee, Y.; Friml, J.; Geisler, M.; et al. Flavonoids redirect PIN-mediated polar auxin fluxes during root gravitropic responses. J. Biol. Chem. 2008, 283, 31218–31226. [Google Scholar] [CrossRef] [PubMed]
Target | Forward (5′→3′) | Reverse (5′→3′) | Usage |
---|---|---|---|
AcFLS | AAAAAAGCAGGCTTTATGGAAGTAGAGAGA | TGAATTGGTTCCTTTCCCTGAGGAAGTTTATT | Cloning |
AcFLS | ACACTGACATGTCCAGCCTCACC | TTACCGTTGTTCTGTGTAGCACGC | qPCR |
NtPAL | ATTGAGGTCATCCGTTCTGC | ACCGTGTAACGCCTTGTTTC | qPCR |
Nt4CL | TCATTGACGAGGATGACGAG | TGGGATGGTTGAGAAGAAGG | qPCR |
NtCHS | TTGTTCGAGCTTGTCTCTGC | AGCCCAGGAACATCTTTGAG | qPCR |
NtCHI | GTCAGGCCATTGAAAAGCTC | CTAATCGTCAATGCCCCAAC | qPCR |
NtF3H | CAAGGCATGTGTGGATATGG | TGTGTCGTTTCAGTCCAAGG | qPCR |
NtF3′H | AGGCTCAACACTTCTCGT | CATCAACTTTGGGCTTCT | qPCR |
NtFLS | TTTGGCACTTGGTGTTGTGG | ACTTGACATCATACCAATGG | qPCR |
NtDFR | AACCAACAGTCAGGGGAATG | TTGGACATCGACAGTTCCAG | qPCR |
NtANS | TGGCGTTGAAGCTCATACTG | GGAATTAGGCACACACTTTGC | qPCR |
NtGAPDH | GGTGTCCACAGACTTCGTGG | GACTCCTCACAGCAGCACCA | qPCR |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, S.; Kim, D.-H.; Yang, J.-H.; Lee, J.-Y.; Lim, S.-H. Increased Flavonol Levels in Tobacco Expressing AcFLS Affect Flower Color and Root Growth. Int. J. Mol. Sci. 2020, 21, 1011. https://doi.org/10.3390/ijms21031011
Park S, Kim D-H, Yang J-H, Lee J-Y, Lim S-H. Increased Flavonol Levels in Tobacco Expressing AcFLS Affect Flower Color and Root Growth. International Journal of Molecular Sciences. 2020; 21(3):1011. https://doi.org/10.3390/ijms21031011
Chicago/Turabian StylePark, Sangkyu, Da-Hye Kim, Ju-Hee Yang, Jong-Yeol Lee, and Sun-Hyung Lim. 2020. "Increased Flavonol Levels in Tobacco Expressing AcFLS Affect Flower Color and Root Growth" International Journal of Molecular Sciences 21, no. 3: 1011. https://doi.org/10.3390/ijms21031011
APA StylePark, S., Kim, D.-H., Yang, J.-H., Lee, J.-Y., & Lim, S.-H. (2020). Increased Flavonol Levels in Tobacco Expressing AcFLS Affect Flower Color and Root Growth. International Journal of Molecular Sciences, 21(3), 1011. https://doi.org/10.3390/ijms21031011