Stretch-Induced Activation of Pannexin 1 Channels Can Be Prevented by PKA-Dependent Phosphorylation
Abstract
1. Introduction
2. Results
2.1. Dye Uptake Mediated by Pannexin 1 Channels is Inhibited by Adenosine and cAMP Analogs
2.2. PKA Is Involved in the Inhibition Induced by Db-cAMP on Mechanical Stretch-Induced Activation of Panx1 Channels
2.3. Channels Formed by Panx1 Mutated in T302 or S328 by Alanine Are Not Activated by Mechanical Stretch
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cell Lines
4.3. Plasmids
4.4. Mechanical-Stretch Induced Activation of Panx1 Channels
4.5. Evaluation of Pannexin 1 Channel Activity
4.6. Transfections
4.7. Bioinformatics Search of Putative Phosphorylation Sites in Panx1 by PKA
4.8. Point Mutations
4.9. RT-PCR
4.10. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| DAPI | 4′,6-Diamidino-2-fenilindol |
| Panx1 | Pannexin 1 |
| cAMP | Cyclic Adenosine monophosphate |
| PKA | Protein kinase A |
| PKC | Protein kinase C |
| PKG | Protein kinase G |
| ATP | Adenosine triphosphate |
References
- Panchin, Y.; Kelmanson, I.; Matz, M.; Lukyanov, K.; Usman, N.; Lukyanov, S. A ubiquitous family of putative gap junction molecules. Curr. Biol. 2000, 10, R473–R474. [Google Scholar] [CrossRef] [Scilit]
- Baranova, A.; Ivanov, D.; Petrash, N.; Pestova, A.; Skoblov, M.; Kelmanson, I.; Shagin, D.; Nazarenko, S.; Geraymovych, E.; Litvin, O.; et al. The mammalian pannexin family is homologous to the invertebrate innexin gap junction proteins. Genomics 2004, 83, 706–716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Phelan, P. Innexins: Members of an evolutionarily conserved family of gap-junction proteins. Biochim. Biophys. Acta 2005, 1711, 225–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Michalski, K.; Syrjanen, J.L.; Henze, E.; Kumpf, J.; Furukawa, H.; Kawate, T. The Cryo-EM structure of pannexin 1 reveals unique motifs for ion selection and inhibition. eLife 2020, 9, e54670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giaume, C.; Leybaert, L.; Naus, C.C.; Sáez, J.C. Connexin and pannexin hemichannels in brain glial cells: Properties, pharmacology, and roles. Front. Pharmacol. 2013, 4, 88. [Google Scholar] [CrossRef] [Scilit]
- Bao, L.; Locovei, S.; Dahl, G. Pannexin membrane channels are mechanosensitive conduits for ATP. FEBS Lett. 2004, 572, 65–68. [Google Scholar] [CrossRef] [Scilit]
- Ma, W.; Compan, V.; Zheng, W.; Martin, E.; North, R.A.; Verkhratsky, A.; Surprenant, A. Pannexin 1 forms an anion-selective channel. Pflugers Arch. 2012, 463, 585–592. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Ambrosi, C.; Qiu, F.; Jackson, D.G.; Sosinsky, G.; Dahl, G. The membrane protein Pannexin1 forms two open-channel conformations depending on the mode of activation. Sci. Signal. 2014, 7, ra69. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Jackson, D.G.; Dahl, G. Cationic control of Panx1 channel function. Am. J. Physiol. Cell Physiol. 2018, 315, C279–C289. [Google Scholar] [CrossRef] [Scilit]
- Chandrasekhar, A.; Bera, A.K. Hemichannels: Permeants and their effect on development, physiology and death. Cell Biochem. Funct. 2012, 30, 89–100. [Google Scholar] [CrossRef] [Scilit]
- Woehrle, T.; Yip, L.; Elkhal, A.; Sumi, Y.; Chen, Y.; Yao, Y.; Insel, P.A.; Junger, W.G. Pannexin-1 hemichannel-mediated ATP release together with P2X1 and P2X4 receptors regulate T-cell activation at the immune synapse. Blood 2010, 116, 3475–3484. [Google Scholar] [CrossRef] [Scilit]
- Nikolic, L.; Nobili, P.; Shen, W.; Audinat, E. Role of astrocyte purinergic signaling in epilepsy. Glia 2019. [Google Scholar] [CrossRef] [Scilit]
- Bernier, L.P. Purinergic regulation of inflammasome activation after central nervous system injury. J. Gen. Physiol. 2012, 140, 571–575. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pelegrin, P.; Surprenant, A. Pannexin-1 mediates large pore formation and interleukin-1beta release by the ATP-gated P2X7 receptor. EMBO J. 2006, 25, 5071–5082. [Google Scholar] [CrossRef] [Scilit]
- Silverman, W.R.; de Rivero Vaccari, J.P.; Locovei, S.; Qiu, F.; Carlsson, S.K.; Scemes, E.; Keane, R.W.; Dahl, G. The pannexin 1 channel activates the inflammasome in neurons and astrocytes. J. Biol. Chem. 2009, 284, 18143–18151. [Google Scholar] [CrossRef] [Scilit]
- Cheung, W.Y.; Fritton, J.C.; Morgan, S.A.; Seref-Ferlengez, Z.; Basta-Pljakic, J.; Thi, M.M.; Suadicani, S.O.; Spray, D.C.; Majeska, R.J.; Schaffler, M.B. Pannexin-1 and P2X7-Receptor Are Required for Apoptotic Osteocytes in Fatigued Bone to Trigger RANKL Production in Neighboring Bystander Osteocytes. J. Bone Miner. Res. 2016, 31, 890–899. [Google Scholar] [CrossRef] [Scilit]
- Gulbransen, B.D.; Bashashati, M.; Hirota, S.A.; Gui, X.; Roberts, J.A.; MacDonald, J.A.; Muruve, D.A.; McKay, D.M.; Beck, P.L.; Mawe, G.M.; et al. Activation of neuronal P2X7 receptor-pannexin-1 mediates death of enteric neurons during colitis. Nat. Med. 2012, 18, 600–604. [Google Scholar] [CrossRef] [Scilit]
- Locovei, S.; Scemes, E.; Qiu, F.; Spray, D.C.; Dahl, G. Pannexin1 is part of the pore forming unit of the P2X(7) receptor death complex. FEBS Lett. 2007, 581, 483–488. [Google Scholar] [CrossRef] [Scilit]
- Domercq, M.; Perez-Samartin, A.; Aparicio, D.; Alberdi, E.; Pampliega, O.; Matute, C. P2X7 receptors mediate ischemic damage to oligodendrocytes. Glia 2010, 58, 730–740. [Google Scholar] [CrossRef] [Scilit]
- Elliott, M.R.; Chekeni, F.B.; Trampont, P.C.; Lazarowski, E.R.; Kadl, A.; Walk, S.F.; Park, D.; Woodson, R.I.; Ostankovich, M.; Sharma, P.; et al. Nucleotides released by apoptotic cells act as a find-me signal to promote phagocytic clearance. Nature 2009, 461, 282–286. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Tomić, M.; Stojilkovic, S.S. Characterization of novel Pannexin 1 isoforms from rat pituitary cells and their association with ATP-gated P2X channels. Gen. Comp. Endocrinol. 2011, 174, 202–210. [Google Scholar] [CrossRef] [Scilit]
- Riteau, N.; Gasse, P.; Fauconnier, L.; Gombault, A.; Couegnat, M.; Fick, L.; Kanellopoulos, J.; Quesniaux, V.F.; Marchand-Adam, S.; Crestani, B.; et al. Extracellular ATP is a danger signal activating P2X7 receptor in lung inflammation and fibrosis. Am. J. Respir. Crit. Care Med. 2010, 182, 774–783. [Google Scholar] [CrossRef] [Scilit]
- Schenk, U.; Westendorf, A.M.; Radaelli, E.; Casati, A.; Ferro, M.; Fumagalli, M.; Verderio, C.; Buer, J.; Scanziani, E.; Grassi, F. Purinergic control of T cell activation by ATP released through pannexin-1 hemichannels. Sci. Signal. 2008, 1, ra6. [Google Scholar] [CrossRef] [Scilit]
- Sridharan, M.; Adderley, S.P.; Bowles, E.A.; Egan, T.M.; Stephenson, A.H.; Ellsworth, M.L.; Sprague, R.S. Pannexin 1 is the conduit for low oxygen tension-induced ATP release from human erythrocytes. Am. J. Physiol. Heart Circ. Physiol. 2010, 299, H1146–H152. [Google Scholar] [CrossRef] [Scilit]
- Riquelme, M.A.; Cea, L.A.; Vega, J.L.; Boric, M.P.; Monyer, H.; Bennett, M.V.; Frank, M.; Willecke, K.; Sáez, J.C. The ATP required for potentiation of skeletal muscle contraction is released via pannexin hemichannels. Neuropharmacology 2013, 75, 594–603. [Google Scholar] [CrossRef] [Scilit]
- Thompson, R.J.; Zhou, N.; MacVicar, B.A. Ischemia opens neuronal gap junction hemichannels. Science 2006, 312, 924–927. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Dahl, G. Pannexin1: A multifunction and multiconductance and/or permeability membrane channel. Am. J. Physiol. Cell Physiol. 2018, 315, C290–C299. [Google Scholar] [CrossRef] [Scilit]
- Locovei, S.; Bao, L.; Dahl, G. Pannexin 1 in erythrocytes: Function without a gap. Proc. Natl. Acad. Sci. USA 2006, 103, 7655–7659. [Google Scholar] [CrossRef] [Scilit]
- Reigada, D.; Lu, W.; Zhang, M.; Mitchell, C.H. Elevated pressure triggers a physiological release of ATP from the retina: Possible role for pannexin hemichannels. Neuroscience 2008, 157, 396–404. [Google Scholar] [CrossRef] [Scilit]
- Reyes, J.P.; Hernández-Carballo, C.Y.; Pérez-Flores, G.; Pérez-Cornejo, P.; Arreola, J. Lack of coupling between membrane stretching and pannexin-1 hemichannels. Biochem. Biophys. Res. Commun. 2009, 380, 50–53. [Google Scholar] [CrossRef] [Scilit]
- Seminario-Vidal, L.; Okada, S.F.; Sesma, J.I.; Kreda, S.M.; van Heusden, C.A.; Zhu, Y.; Jones, L.C.; O’Neal, W.K.; Penuela, S.; Laird, D.W.; et al. Rho signaling regulates pannexin 1-mediated ATP release from airway epithelia. J. Biol. Chem. 2011, 286, 26277–26286. [Google Scholar] [CrossRef] [Scilit]
- Lohman, A.W.; Weaver, J.L.; Billaud, M.; Sandilos, J.K.; Griffiths, R.; Straub, A.C.; Penuela, S.; Leitinger, N.; Laird, D.W.; Bayliss, D.A.; et al. S-nitrosylation inhibits pannexin 1 channel function. J. Biol. Chem. 2012, 287, 39602–39612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lohman, A.W.; Leskov, I.L.; Butcher, J.T.; Johnstone, S.R.; Stokes, T.A.; Begandt, D.; DeLalio, L.J.; Best, A.K.; Penuela, S.; Leitinger, N.; et al. Pannexin 1 channels regulate leukocyte emigration through the venous endothelium during acute inflammation. Nat. Commun. 2015, 6, 7965. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weilinger, N.L.; Tang, P.L.; Thompson, R.J. Anoxia-induced NMDA receptor activation opens pannexin channels via Src family kinases. J. Neurosci. 2012, 32, 12579–12588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poornima, V.; Vallabhaneni, S.; Mukhopadhyay, M.; Bera, A.K. Nitric oxide inhibits the pannexin 1 channel through a cGMP-PKG dependent pathway. Nitric Oxide 2015, 47, 77–84. [Google Scholar] [CrossRef] [Scilit]
- Sassone-Corsi, P. The cyclic AMP pathways. Cold Spring Harb. Perspect. Biol. 2012, 4, a011148. [Google Scholar] [CrossRef] [Scilit]
- Choi, E.J.; Palacios-Prado, N.; Sáez, J.C.; Lee, J. Identification of Cx45 as a major component of gap junctions in HeLa cells. Biomolecules 2020, 10, E1389. [Google Scholar] [CrossRef] [Scilit]
- Haskó, G.; Linden, J.; Cronstein, B.; Pacher, P. Adenosine receptors: Therapeutic aspects for inflammatory and immune diseases. Nat. Rev. Drug Discov. 2008, 7, 759–770. [Google Scholar] [CrossRef] [Scilit]
- Dalton, G.D.; Dewey, W.L. Protein kinase inhibitor peptide (PKI): A family of endogenous neuropeptides that modulate neuronal cAMP-dependent protein kinase function. Neuropeptides 2006, 40, 23–34. [Google Scholar] [CrossRef] [Scilit]
- Bhalla-Gehi, R.; Penuela, S.; Churko, J.M.; Shao, Q.; Laird, D.W. Pannexin1 and pannexin3 delivery, cell surface dynamics, and cytoskeletal interactions. J. Biol. Chem. 2010, 285, 9147–9160. [Google Scholar] [CrossRef] [Scilit]
- Hervé, J.C.; Sarrouilhe, D. Protein phosphatase modulation of the intercellular junctional communication: Importance in cardiac myocytes. Prog. Biophys. Mol. Biol. 2006, 90, 225–248. [Google Scholar] [CrossRef] [Scilit]
- Billaud, M.; Lohman, A.W.; Straub, A.C.; Looft-Wilson, R.; Johnstone, S.R.; Araj, C.A.; Best, A.K.; Chekeni, F.B.; Ravichandran, K.S.; Penuela, S.; et al. Pannexin1 regulates α1-adrenergic receptor- mediated vasoconstriction. Circ. Res. 2011, 109, 80–85. [Google Scholar] [CrossRef] [Scilit]
- Gödecke, S.; Roderigo, C.; Rose, C.R.; Rauch, B.H.; Gödecke, A.; Schrader, J. Thrombin-induced ATP release from human umbilical vein endothelial cells. Am. J. Physiol. Cell Physiol. 2012, 302, C915–C923. [Google Scholar] [CrossRef] [Scilit]
- Locovei, S.; Wang, J.; Dahl, G. Activa. Thrombin-induced ATP release from human umbilical vein endothelial cells tion of pannexin 1 channels by ATP through P2Y receptors and by cytoplasmic calcium. FEBS Lett. 2006, 580, 239–244. [Google Scholar] [CrossRef] [Scilit]
- Beaulieu, J.M.; Gainetdinov, R.R. The physiology, signaling, and pharmacology of dopamine receptors. Pharmacol. Rev. 2011, 63, 182–217. [Google Scholar] [CrossRef] [Scilit]
- Schmidt, K.T.; Weinshenker, D. Adrenaline rush: The role of adrenergic receptors in stimulant-induced behaviors. Mol. Pharmacol. 2014, 85, 640–650. [Google Scholar] [CrossRef] [Scilit]
- Francken, B.J.; Jurzak, M.; Vanhauwe, J.F.; Luyten, W.H.; Leysen, J.E. The human 5-ht5A receptor couples to Gi/Go proteins and inhibits adenylate cyclase in HEK 293 cells. Eur. J. Pharmacol. 1998, 361, 299–309. [Google Scholar] [CrossRef] [Scilit]
- Ayano, G. Dopamine: Receptors, Functions, Synthesis, Pathways, Locations and Mental Disorders: Review of Literatures. J. Ment. Disord. Treat. 2016, 2, 2. [Google Scholar] [CrossRef]
- Rodriguez-Pena, M.S.; Timmerman, H.; Leurs, R. Modulation of histamine H(2) receptor signalling by G-protein-coupled receptor kinase 2 and 3. Br. J. Pharmacol. 2000, 131, 1707–1715. [Google Scholar] [CrossRef] [Scilit]
- Lappas, C.M.; Rieger, J.M.; Linden, J. A2A adenosine receptor induction inhibits IFN-gamma production in murine CD4+ T cells. J. Immunol. 2005, 174, 1073–1080. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.J.; Maruyama, Y.; Dvoryanchikov, G.; Pereira, E.; Chaudhari, N.; Roper, S.D. The role of pannexin 1 hemichannels in ATP release and cell-cell communication in mouse taste buds. Proc. Natl. Acad. Sci. USA 2007, 104, 6436–6441. [Google Scholar] [CrossRef] [Scilit]
- Engel, T.; Alves, M.; Sheedy, C.; Henshall, D.C. ATPergic signalling during seizures and epilepsy. Neuropharmacology 2016, 104, 140–153. [Google Scholar] [CrossRef] [Scilit]
- Bergfeld, G.R.; Forrester, T. Release of ATP from human erythrocytes in response to a brief period of hypoxia and hypercapnia. Cardiovasc. Res. 1992, 26, 40–47. [Google Scholar] [CrossRef] [Scilit]
- Qiu, F.; Dahl, G. A permeant regulating its permeation pore: Inhibition of pannexin 1 channels by ATP. Am. J. Physiol. Cell Physiol. 2009, 296, C250–C255. [Google Scholar] [CrossRef] [Scilit]
- Allard, B.; Longhi, M.S.; Robson, S.C.; Stagg, J. The ectonucleotidases CD39 and CD73: Novel checkpoint inhibitor targets. Immunol. Rev. 2017, 276, 121–144. [Google Scholar] [CrossRef] [Scilit]
- Bruzzone, R.; Barbe, M.T.; Jakob, N.J.; Monyer, H. Pharmacological properties of homomeric and heteromeric pannexin hemichannels expressed in Xenopus oocytes. J. Neurochem. 2005, 92, 1033–1043. [Google Scholar] [CrossRef] [Scilit]
- Johnson, R.G.; Le, H.C.; Evenson, K.; Loberg, S.W.; Myslajek, T.M.; Prabhu, A.; Manley, A.M.; O’Shea, C.; Grunenwald, H.; Haddican, M.; et al. Connexin Hemichannels: Methods for Dye Uptake and Leakage. J. Membr. Biol. 2016, 249, 713–741. [Google Scholar] [CrossRef] [Scilit]
- Omasits, U.; Ahrens, C.H.; Müller, S.; Wollscheid, B. Protter: Interactive protein feature visualization and integration with experimental proteomic data. Bioinformatics 2014, 30, 884–886. [Google Scholar] [CrossRef] [Scilit]
- Case, D.A.; Cerutti, D.S.; Cheatham, T.E., III; Darden, T.A.; Duke, R.E.; Giese, T.J.; Gohlke, H.; Goetz, A.W.; Greene, D.; Homeyer, N.; et al. DMY H. and PAK. In Amber 2017; University of California: San Francisco, CA, USA, 2017; citeulike-article-id:2734527. [Google Scholar]
- Humphrey, W.; Dalke, A.; Schulten, K. VMD—Visual Molecular Dynamics. J. Molec. Graph. 1996, 14, 33–38. [Google Scholar] [CrossRef] [Scilit]






| Mutation | DNA Segment | Protein Segment |
|---|---|---|
| rPanx1 rPanx1 T21A | GAGCCCACCGAGCCC GAGCCCGCCGAGCCC | FLLKEPTEPKFKG FLLKEPAEPKFKG |
| rPanx1 rPanx1 S205A | AAGAATCCAGTCAC AAGAAGCCAGTCAC | LKTKKNSSHLIMK LKTKKNASHLIMK |
| rPanx1 rPanx1 T302A | CAGAAGACGGACGTC CAGAAGGCCGACGTC | VPFRQKTDVLKVY VPFRQKADVLKVY |
| rPanx1 rPanx1 T302D | CAGAAGACGGACGTC CAGAAGGACGACGTC | VPFRQKTDVLKVY VPFRQKDDVLKVY |
| rPanx1 rPanx1 S328A | GACTTGAGCCTCTAC GACTTGGCCCTCTAC | EGYNDLSLYNLFL EGYNDLALYNLFL |
| rPanx1 rPanx1 S328D | GACTTGAGCCTCTAC GACTTGGACCTCTAC | EGYNDLSLYNLFL EGYNDLDLYNLFL |
| Mutation | Primers |
|---|---|
| T21A | Forward GGAGCCCGCCGAGCCCA Reverse TTCAGCAAGAAGTCCGAGAACAC |
| S205A | Forward CGAAGAAGAACGCCAGTCACCTAAT Reverse TCTTCAAGTACTGCTCCACGATC |
| T302A | Forward GGCAGAAGGCCGACGTCCT Reverse GGAACGGGACGAAGAGCGT |
| T302D | Forward GGCAGAAGGACGACGTCCT Reverse GGAACGGGACGAAGAGCGT |
| S328A | Forward CAACGACTTGGCCCTCTACAACC Reverse TAGCCTTCAGACTTGAAATGTAGAACATC |
| S328D | Forward CAACGACTTGGACCTCTACAACC Reverse TAGCCTTCAGACTTGAAATGTAGAACATC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
López, X.; Escamilla, R.; Fernández, P.; Duarte, Y.; González-Nilo, F.; Palacios-Prado, N.; Martinez, A.D.; Sáez, J.C. Stretch-Induced Activation of Pannexin 1 Channels Can Be Prevented by PKA-Dependent Phosphorylation. Int. J. Mol. Sci. 2020, 21, 9180. https://doi.org/10.3390/ijms21239180
López X, Escamilla R, Fernández P, Duarte Y, González-Nilo F, Palacios-Prado N, Martinez AD, Sáez JC. Stretch-Induced Activation of Pannexin 1 Channels Can Be Prevented by PKA-Dependent Phosphorylation. International Journal of Molecular Sciences. 2020; 21(23):9180. https://doi.org/10.3390/ijms21239180
Chicago/Turabian StyleLópez, Ximena, Rosalba Escamilla, Paola Fernández, Yorley Duarte, Fernando González-Nilo, Nicolás Palacios-Prado, Agustín D. Martinez, and Juan C. Sáez. 2020. "Stretch-Induced Activation of Pannexin 1 Channels Can Be Prevented by PKA-Dependent Phosphorylation" International Journal of Molecular Sciences 21, no. 23: 9180. https://doi.org/10.3390/ijms21239180
APA StyleLópez, X., Escamilla, R., Fernández, P., Duarte, Y., González-Nilo, F., Palacios-Prado, N., Martinez, A. D., & Sáez, J. C. (2020). Stretch-Induced Activation of Pannexin 1 Channels Can Be Prevented by PKA-Dependent Phosphorylation. International Journal of Molecular Sciences, 21(23), 9180. https://doi.org/10.3390/ijms21239180

