Rice Bran and Vitamin B6 Suppress Pathological Neovascularization in a Murine Model of Age-Related Macular Degeneration as Novel HIF Inhibitors
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal
2.2. Cell Culture
2.3. Food Ingredient Preparation and Luciferase Assay
2.4. MTT Assay
2.5. Quantitative PCR and Western Blotting
2.6. A Laser-Induced CNV Model and Measurement of CNV Volumes
2.7. A Light-Induced Retinopathy (LIR) Model and Measurement of Retinal Function by Electroretinography (ERG)
2.8. Statistical Analysis
3. Results
3.1. Rice Bran or Vitamin B6 Shows Inhibitory Effects on HIF Activation in ARPE-19 Cells under a CoCl2-Induced Hypoxic Condition
3.2. Rice Bran or Vitamin B6 Has Suppressive Effects on HIF Stabilization in ARPE-19 Cells under a CoCl2-Induced Hypoxic Condition
3.3. Rice Bran or Vitamin B6 Inhibits the HIF/VEGF Axis in ARPE-19 Cells under a CoCl2-Induced Hypoxic Condition
3.4. Rice Bran or Vitamin B6 Administration Suppresses Retinal Neovascularization in a Murine Model of CNV
3.5. Rice Bran or Vitamin B6 Administration Did Not Directly Affect Neuronal Dysfunction in a Murine Model of LIR
4. Discussion
5. Conclusions
6. Patents
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
| Number | Name | Fold Change |
|---|---|---|
| 1 | Hydroxycitric acid | 0.24 |
| 2 | Garcinia fruit extract | 0.30 |
| (hydroxycitric acid ≥ 50%, calcium ≥ 18%) | ||
| 3 | Garcinia fruit extract, water soluble | 0.40 |
| (hydroxycitric acid ≥ 60%) | ||
| 4 | Ginkgo biloba extract A | 0.46 |
| (flavonoid ≥ 24%, terpene lactones ≥ 6%) | ||
| 5 | Panax ginseng | 0.48 |
| 6 | Lactoferrin from milk | 0.49 |
| 7 | Rice bran, defatted | 0.51 |
| 8 | Lactoferrin | 0.57 |
| 9 | Vitamin B6 (pyridoxine hydrochloride) | 0.58 |
| 10 | Thiamine mononitrate | 0.63 |
| 11 | Tilia cordata flower extract A | 0.64 |
| 12 | Garcinia peel extract | 0.64 |
| (hydroxy citric acid ≥ 60%) | ||
| 13 | Enterococcus faecalis B | 0.65 |
| 14 | Summer pumpkin seed extract | 0.66 |
| (fatty acid ≥ 85%, total sterol ≥ 0.3%) | ||
| 15 | Grape pomace extract A | 0.68 |
| (oleanolic acid ≥ 2.0%) | ||
| 16 | Maqui berry fruit extract | 0.68 |
| (anthocyanins ≥ 35%, delphinidins ≥ 20%) | ||
| 17 | Dextrin | 0.69 |
| 18 | Strawberry seed extract | 0.71 |
| (polyphenol ≥ 2.0%, tiliroside ≥ 0.5%) | ||
| 19 | Ginsenoside Rf | 0.73 |
| 20 | Petasites japonicus extract | 0.74 |
| 21 | Vitamin A palmitate | 0.74 |
| 22 | Tomato extract A | 0.75 |
| (lycopene ≥ 15%, tocopherol ≥ 1.5%, | ||
| phytoene phytofluene ≥ 1.0%, β-carotene ≥ 0.2%) | ||
| 23 | Panax notoginseng root extract | 0.76 |
| 24 | Sasa veitchii leaf extract | 0.77 |
| 25 | Cockscomb extract | 0.80 |
| (hyaluronic acid ≥ 5%, hydroxyproline ≥ 8%) | ||
| 26 | Red dragon fruit extract | 0.80 |
| (betacyanin ≥ 0.05%) | ||
| 27 | Tilia cordata flower extract B | 0.85 |
| 28 | Seaberry fruit extract | 0.85 |
| (triterpenes ≥ 0.2%, isorhamnetin rhamnoside ≥ 0.2%) | ||
| 29 | Cyanocobalamin | 0.88 |
| 30 | Hovenia dulcis extract | 0.90 |
| 31 | Polyphenol | 0.91 |
| 32 | Siraitia grosvenorii extract | 0.91 |
| 33 | Peptide formulation derived from dairy protein | 0.92 |
| 34 | Phosphoryl oligosaccharides of calcium | 0.94 |
| 35 | Tilia cordata flower extract C | 0.95 |
| 36 | L-Carnitine | 0.96 |
| 37 | Myrciaria dubia fruit extract | 0.97 |
| (citric acid ≥ 1%) | ||
| 38 | Monostroma nitidum extract | 0.97 |
| 39 | Aspalathus linearis extract B | 1.00 |
| 40 | Parsley extract | 1.02 |
| 41 | Honey | 1.03 |
| 42 | Panax ginseng root extract H | 1.03 |
| 43 | Niacinamide | 1.04 |
| 44 | Maca extract | 1.04 |
| (benzyl glucosinolate ≥ 2.4%) | ||
| 45 | Broccoli sprout extract B | 1.05 |
| (glucoraphanin ≥ 3%) | ||
| 46 | Peptide formulation derived from milk protein A | 1.05 |
| 47 | Hydrolyzed rice bran extract | 1.05 |
| (peptide ≥ 60%) | ||
| 48 | Polysaccharide from yeast | 1.06 |
| 49 | Branched chain amino acids | 1.06 |
| 50 | Chlorogenic acid | 1.06 |
| 51 | Ginsenoside Rb1 | 1.07 |
| 52 | Panax ginseng root extract C | 1.08 |
| 53 | Chamomile flower extract | 1.09 |
| 54 | Salmon milt extract | 1.09 |
| 55 | Kidney beans extract B | 1.10 |
| 56 | Acerola fruit extract A | 1.12 |
| (vitamin C ≥ 30%) | ||
| 57 | Acerola fruit extract B | 1.12 |
| (vitamin C ≥ 20%) | ||
| 58 | Ginkgo biloba extract B | 1.14 |
| 59 | Eleutherococcus senticosus extract | 1.14 |
| (saponin ≥ 2%) | ||
| 60 | Vitamin K2 | 1.16 |
| 61 | Astragalus complanatus extract | 1.17 |
| (flavonoid ≥ 5%) | ||
| 62 | Peptide formulation derived from casein A | 1.20 |
| 63 | Selenium | 1.22 |
| 64 | Rosa canina fruit extract | 1.23 |
| 65 | Perilla leaf extract B | 1.26 |
| 66 | Mugwort leaf extract | 1.26 |
| 67 | Milk protein | 1.27 |
| 68 | Evening primrose oil | 1.27 |
| (cis-gamma-linolenic acid and linoleic acid 76%) | ||
| 69 | Glucosyl hesperidin A (hesperidin ≥ 70%) | 1.27 |
| 70 | Japanese hawthorn fruit extract | 1.28 |
| 71 | Chinese chive extract (S-allyl-l-cysteine ≥ 0.1%) | 1.29 |
| 72 | Enterococcus faecalis A | 1.30 |
| 73 | Coenzyme Q10 | 1.30 |
| 74 | Peptide formulation derived from casein B | 1.32 |
| 75 | β-Carotene | 1.35 |
| 76 | Peptide formulation derived from milk protein B | 1.37 |
| 77 | Moringa leaf extract | 1.38 |
| 78 | Ganoderma lucidum extract | 1.39 |
| 79 | Rice germ extract A (polyamine ≥ 0.2%) | 1.41 |
| 80 | Boswellic acid | 1.41 |
| 81 | Tocopherol | 1.43 |
| 82 | Kiwi fruit seed extract | 1.44 |
| (polyphenol ≥ 2%, quercitrin ≥ 0.05 mg/1 g) | ||
| 83 | Glucosyl hesperidin B | 1.45 |
| 84 | Calcium | 1.46 |
| 85 | Paprika extract B | 1.47 |
| (xanthophyll ≥ 27 mg/g, capsanthin ≥ 15 mg/g, | ||
| β-cryptoxanthin ≥1.5 mg/g) | ||
| 86 | Licorice extract A | 1.47 |
| 87 | Coprinus comatus extract | 1.49 |
| 88 | Alpinia speciosa leaf extract | 1.49 |
| 89 | Pomegranate extract (ellagic acid 80%) | 1.54 |
| 90 | Grifola frondosa mushroom extract | 1.54 |
| 91 | Olive fruit extract B (maslinic acid ≥ 10%) | 1.55 |
| 92 | Pearl barley seed extract | 1.55 |
| 93 | Saffron extract | 1.57 |
| 94 | Perilla frutescens leaf powder | 1.57 |
| 95 | Soybean protein | 1.57 |
| 96 | Cherry blossom flower extract | 1.58 |
| (caffeoyl glucose ≥ 2.0%, quercetin glucoside ≥ 0.05%) | ||
| 97 | Royal jelly (decenoic acid 1.6–1.8%) | 1.71 |
| 98 | Soybean extract | 1.77 |
| 99 | Seaweed mineral | 1.78 |
| 100 | Ginsenoside, compound K | 1.78 |
| 101 | Lactulos | 1.78 |
| 102 | Brewers’ yeast extract | 1.78 |
| 103 | Panax ginseng root extract D | 1.81 |
| 104 | Golden oyster mushroom extract | 1.88 |
| 105 | Barley powder (β-glucan 15%) | 1.88 |
| 106 | Tamarind extract | 1.95 |
| 107 | Isatis tinctoria extract | 2.05 |
| 108 | Indian long pepper fruit extract | 2.12 |
| 109 | Gardenia fruit extract B | 2.15 |
| 110 | Amla fruit extract (gallotannnin ≥ 15%) | 2.17 |
| 111 | Arctium lappa ferment extract | 2.19 |
| 112 | Arctium lappa root extract | 2.24 |
| 113 | Broccoli sprout extract A (sulforaphane ≥ 2%) | 2.24 |
| 114 | Euphrasia rostkoviana extract | 2.27 |
| 115 | Phellinus linteus extract | 2.27 |
| 116 | Chinese wolfberry fruit extract | 2.30 |
| 117 | Rosemary leaf extract | 2.31 |
| 118 | Black rice seed extract | 2.31 |
| (polyphenol ≥ 15%, anthocyanidin ≥ 5%) | ||
| 119 | Plant oil | 2.34 |
| 120 | Zingiber purpureum extract | 2.39 |
| 121 | Sweet clover extract | 2.40 |
| 122 | Grape bud extract | 2.41 |
| (resveratrol ≥ 20%, trans-resveratorol ≥ 5%, ε-viniferin ≥ 5%) | ||
| 123 | Cocoa seed extract | 2.43 |
| (theobromine ≥ 10%, polyphenol ≥ 20%) | ||
| 124 | Bilberry fruit extract A | 2.44 |
| (anthocyanosides ≥ 85%) | ||
| 125 | Linseed extract | 2.80 |
| (secoisolariciresinol diglucoside ≥ 40%) | ||
| 126 | Calcium ascorbate | 3.02 |
| 127 | Mulberry leaf extract (1-deoxynojirimycin ≥ 1%) | 3.10 |
| 128 | Siberian ginseng root extract | 3.11 |
| (eleutherosides B+E ≥ 0.9%) | ||
| 129 | Ginger extract B | 3.30 |
| 130 | Siberian larch extract (dihydroquercetin ≥ 88%) | 3.40 |
| 131 | Coconut oil | 3.43 |
| 132 | Marigold flower extract A (lutein ≥ 20%, zeaxanthin 1–2%) | 3.48 |
| 133 | Lemon verbena extract (acteoside and isoacteoside ≥ 9–11%) | 3.71 |
| 134 | Cyanidin 3-glucoside | 3.76 |
| 135 | Sichuan pepper peel extract | 3.84 |
| 136 | Pyrroloquinoline quinone | 3.87 |
| 137 | Olive leaf extract A (oleanolic acid ≥ 55%) | 4.05 |
| 138 | Gymnema sylvestre extract B (gymnemic acid ≥ 25%) | 4.09 |
| 139 | Psidium guajava leaf extract (tannin ≥ 18%) | 4.11 |
| 140 | Geranylgeraniol | 4.24 |
| 141 | Lemon balm leaf extract | 4.46 |
| 142 | Olive leaf extract B | 4.48 |
| 143 | Riboflavin | 4.57 |
| 144 | Kaempferia parviflora extract | 4.65 |
| (5,7-dimethoxyflavone ≥ 4%, polymethoxyflavonoid ≥ 15%) | ||
| 145 | Curcuma extract B | 4.69 |
| (curcuminoid 19–22%, curcumin ≥ 13%) | ||
| 146 | Coffee seed extract | 4.97 |
| (chlorogenic acid ≥ 24.0%) | ||
| 147 | Oleanolic acid | 5.00 |
| 148 | Cranberry extract C (proanthocyanidins ≥ 50%) | 5.20 |
| 149 | Panax ginseng root extract E (compound K ≥ 5 mg/g) | 5.21 |
| 150 | Ginger extract A | 5.25 |
| (gingerols ≥ 15%, 6,8,10-gingerols ≥ 12%, shogaol ≥ 3%) | ||
| 151 | Japanese horseradish extract | 5.29 |
| 152 | Curcuma extract A | 5.37 |
| (curcuminoid complex ≥ 95%, curcumin ≥ 65%) | ||
| 153 | Melinjo seed extract (resveratrol ≥ 20%) | 5.40 |
| 154 | Grape marc extract | 5.42 |
| (polyphenol ≥ 92%, proanthocyanidin ≥ 15%, | ||
| anthocyanin ≥ 2%, t-resveratrol ≥ 2500 ppm) | ||
| 155 | Ginsenoside C-K (compound K ≥ 98%) | 5.51 |
| 156 | Ginkgo biloba extract C | 5.53 |
| 157 | Ginsenoside Rg3 | 5.64 |
| 158 | Laurel leaf extract (deacetyl laurenobiolide ≥ 1%) | 5.88 |
| 159 | Aspalathus linearis extract A (aspalathin ≥ 20%) | 5.88 |
| 160 | Bacopa monniera extract | 5.95 |
| 161 | Perilla seed extract | 6.24 |
| 162 | Panax ginseng root extract K | 6.30 |
| 163 | Gymnema sylvestre extract A | 6.31 |
| 164 | Cat’s claw extract | 6.37 |
| 165 | Panax ginseng root extract F | 6.45 |
| 166 | Black chokeberry fruit extract | 6.49 |
| 167 | American panax quinquefolius root extract A | 6.91 |
| 168 | Coleus forskohlii extract | 6.96 |
| 169 | Panax ginseng root extract L | 7.12 |
| 170 | Mangosteen peel extract (maclurin glycosides ≥ 0.03%) | 7.22 |
| 171 | Docosahexaenoic acid | 7.22 |
| 172 | Mallotus japonicus peel extract (bergenin ≥ 12%) | 7.61 |
| 173 | Fucoxanthin B | 7.77 |
| 174 | Grape seed extract (polyphenol ≥ 95%, proanthocyanidin ≥ 40%) | 7.83 |
| 175 | Evening primrose seed extract | 7.94 |
| 176 | Citrus extract | 7.96 |
| 177 | Olive fruit extract A | 7.96 |
| 178 | Andrographis paniculata extract | 8.14 |
| 179 | Cranberry extract B | 8.43 |
| 180 | Banaba leaf extract | 8.67 |
| 181 | Peanut seed coat extract | 8.97 |
| 182 | Glucosylceramide | 9.16 |
| 183 | Pomegranate fruit extract | 9.86 |
| 184 | Artichoke leaf extract | 10.09 |
| 185 | Eicosapentaenoic acid | 10.23 |
| 186 | Propolis extract A | 10.44 |
| 187 | Black soybean extract | 10.64 |
| 188 | Licorice extract B (glycyrrhizinic acid ≥ 20%) | 10.71 |
| 189 | Propolis extract B | 10.82 |
| 190 | Bilberry fruit extract B | 11.44 |
| (anthocyanidin ≥ 25%, anthocyanin ≥ 36%) | ||
| 191 | Paprika extract A | 11.71 |
| (xanthophyll ≥ 9 mg/g, capsanthin ≥ 5 mg/g, | ||
| β-cryptoxanthin ≥ 0.5 mg/g) | ||
| 192 | Quercus salicina leaf extract (tannins ≥ 18%) | 12.00 |
| 193 | Hesperetin | 12.33 |
| 194 | Pterocarpus marsupium extract | 12.65 |
| (pterostibene ≥ 5%) | ||
| 195 | Tomato extract B (lycopene ≥ 10%) | 13.15 |
| 196 | Cranberry extract D (proanthocyanidins 27–33%) | 13.37 |
| 197 | Fucoxanthin A | 13.94 |
| 198 | Grape stem extract | 14.74 |
| (resveratrol ≥ 3.5%, oligo-stilbenes ≥ 1%, ε-viniferin ≥ 0.8%) | ||
| 199 | Salacia reticulata extract (mangiferin ≥ 1%, triterpenoids ≥ 20%) | 15.58 |
| 200 | Apocynum venetum extract (hyperoside and isoquercitin ≥ 4%) | 19.67 |
| 201 | Green tea extract | 20.65 |
| 202 | Gardenia fruit extract A (crocetin ≥ 75%) | 27.55 |
Appendix B
| Number | Name | Fold Change + SD | p-Value |
|---|---|---|---|
| 1 | Garcinia fruit extract | 0.38 ± 0.12 | 0.003 ** |
| 2 | Hydroxycitric acid | 0.44 ± 0.20 | 0.035 * |
| 3 | Rice bran, defatted | 0.58 ± 0.05 | 0.001 ** |
| 4 | Lactoferrin | 0.61 ± 0.08 | 0.002 ** |
| 5 | Panax ginseng | 0.71 ± 0.04 | 0.040 * |
| 6 | Vitamin B6 | 0.74 ± 0.02 | 0.003 ** |
| 7 | Ginkgo biloba extract A | 0.99 ± 0.14 | 0.952 |
| 8 | Thiamine mononitrate | 1.26 ± 0.16 | 0.050 |
Appendix C

Appendix D
| Components of vitamin B (in 100 g of rice bran) | B1 (thiamine): 3.12 mg |
| B2 (riboflavin): 0.21 mg | |
| B3 (niacinamide): 34.6 mg | |
| B5 (pantothenic acid): 4.43 mg | |
| B6 (pyridoxine hydrochloride): 3.27 mg | |
| B7 (biotin): 0.04 mg | |
| B9 (folic acid): 0.18 mg |
Appendix E

Appendix F

Appendix G

Appendix H

Appendix I

References
- Ding, J.; Wong, T.Y. Current Epidemiology of Diabetic Retinopathy and Diabetic Macular Edema. Curr. Diabetes Rep. 2012, 12, 346–354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Resnikoff, S.; Pascolini, D.; Etya’ale, D.; Kocur, I.; Pararajasegaram, R.; Pokharel, G.P.; Mariotti, S.P. Global data on visual impairment in the year 2002. Bull. World Health Organ. 2004, 82, 844–851. [Google Scholar] [PubMed]
- Hyman, L.G.; Lilienfeld, A.M.; Ferris, F.L., 3rd; Fine, S.L. Senile macular degeneration: A case-control study. Am. J. Epidemiol. 1983, 118, 213–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fogli, S.; Del Re, M.; Rofi, E.; Posarelli, C.; Figus, M.; Danesi, R. Clinical pharmacology of intravitreal anti-VEGF drugs. Eye 2018, 32, 1010–1020. [Google Scholar] [CrossRef] [Scilit]
- Ozaki, H.; Seo, M.S.; Ozaki, K.; Yamada, H.; Yamada, E.; Okamoto, N.; Hofmann, F.; Wood, J.M.; Campochiaro, P.A. Blockade of vascular endothelial cell growth factor receptor signaling is sufficient to completely prevent retinal neovascularization. Am. J. Pathol. 2000, 156, 697–707. [Google Scholar] [CrossRef] [Scilit]
- Cabral, T.; Mello, L.G.M.; Lima, L.H.; Polido, J.; Regatieri, C.V.; Belfort, R.; Mahajan, V.B. Retinal and choroidal angiogenesis: A review of new targets. Int. J. Retin. Vitr. 2017, 3, 31. [Google Scholar] [CrossRef] [Scilit]
- Yang, S.; Zhao, J.; Sun, X. Resistance to anti-VEGF therapy in neovascular age-related macular degeneration: A comprehensive review. Drug Des. Devel. Ther. 2016, 10, 1857–1867. [Google Scholar] [CrossRef] [Scilit]
- Kaelin, W.G.; Ratcliffe, P.J. Oxygen Sensing by Metazoans: The Central Role of the HIF Hydroxylase Pathway. Mol. Cell 2008, 30, 393–402. [Google Scholar] [CrossRef] [Scilit]
- Mole, D.R.; Blancher, C.; Copley, R.R.; Pollard, P.J.; Gleadle, J.M.; Ragoussis, J.; Ratcliffe, P.J. Genome-wide association of hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha DNA binding with expression profiling of hypoxia-inducible transcripts. J. Biol. Chem. 2009, 284, 16767–16775. [Google Scholar] [CrossRef] [Scilit]
- Majmundar, A.J.; Wong, W.J.; Simon, M.C. Hypoxia-Inducible Factors and the Response to Hypoxic Stress. Mol. Cell 2010, 40, 294–309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krock, B.L.; Skuli, N.; Simon, M.C. Hypoxia-induced angiogenesis: Good and evil. Genes Cancer 2011, 2, 1117–1133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohno, H.; Shirato, K.; Sakurai, T.; Ogasawara, J.; Sumitani, Y.; Sato, S.; Imaizumi, K.; Ishida, H.; Kizaki, T. Effect of exercise on HIF-1 and VEGF signaling. J. Phys. Fit. Sports Med. 2012, 1, 5–16. [Google Scholar] [CrossRef] [Scilit]
- Inoue, Y.; Yanagi, Y.; Matsuura, K.; Takahashi, H.; Tamaki, Y.; Araie, M. Expression of hypoxia-inducible factor 1alpha and 2alpha in choroidal neovascular membranes associated with age-related macular degeneration. Br. J. Ophthalmol. 2007, 91, 1720–1721. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheridan, C.M.; Pate, S.; Hiscott, P.; Wong, D.; Pattwell, D.M.; Kent, D. Expression of hypoxia-inducible factor−1α and −2α in human choroidal neovascular membranes. Graefe’s Arch. Clin. Exp. Ophthalmol. 2009, 247, 1361–1367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibuki, M.; Shoda, C.; Miwa, Y.; Ishida, A.; Tsubota, K.; Kurihara, T. Lactoferrin Has a Therapeutic Effect via HIF Inhibition in a Murine Model of Choroidal Neovascularization. Front. Pharmacol. 2020, 11, 174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibuki, M.; Shoda, C.; Miwa, Y.; Ishida, A.; Tsubota, K.; Kurihara, T. Therapeutic Effect of Garcinia cambogia Extract and Hydroxycitric Acid Inhibiting Hypoxia-Inducible Factor in a Murine Model of Age-Related Macular Degeneration. Int. J. Mol. Sci. 2019, 20, 5049. [Google Scholar] [CrossRef] [Scilit]
- Shoda, C.; Miwa, Y.; Nimura, K.; Okamoto, K.; Yamagami, S.; Tsubota, K.; Kurihara, T. Hypoxia-Inducible Factor Inhibitors Derived from Marine Products Suppress a Murine Model of Neovascular Retinopathy. Nutrients 2020, 12, 1055. [Google Scholar] [CrossRef] [Scilit]
- Miwa, Y.; Hoshino, Y.; Shoda, C.; Jiang, X.; Tsubota, K.; Kurihara, T. Pharmacological HIF inhibition prevents retinal neovascularization with improved visual function in a murine oxygen-induced retinopathy model. Neurochem. Int. 2019, 128, 21–31. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.; Miwa, Y.; Wu, J.; Shoda, C.; Jeong, H.; Kawagishi, H.; Tsubota, K.; Kurihara, T. A Fairy Chemical Suppresses Retinal Angiogenesis as a HIF Inhibitor. Biomolecules 2020, 10, 1405. [Google Scholar] [CrossRef] [Scilit]
- Kunimi, H.; Miwa, Y.; Inoue, H.; Tsubota, K.; Kurihara, T. A Novel HIF Inhibitor Halofuginone Prevents Neurodegeneration in a Murine Model of Retinal Ischemia-Reperfusion. Int. J. Mol. Sci. 2019, 20, 3171. [Google Scholar] [CrossRef] [Scilit]
- Chew, E.Y. Nutrition effects on ocular diseases in the aging eye. Investig. Ophthalmol. Vis. Sci. 2013, 54, ORSF42–ORSF47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gómez-Pinilla, F. Brain foods: The effects of nutrients on brain function. Nat. Rev. Neurosci. 2008, 9, 568–578. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lawrenson, J.G.; Downie, L.E. Nutrition and Eye Health. Nutrients 2019, 11, 2123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McCann, J.C.; Ames, B.N. Is docosahexaenoic acid, an n-3 long-chain polyunsaturated fatty acid, required for development of normal brain function? An overview of evidence from cognitive and behavioral tests in humans and animals. Am. J. Clin. Nutr. 2005, 82, 281–295. [Google Scholar] [CrossRef]
- Hanyuda, A.; Rosner, B.A.; Wiggs, J.L.; Willett, W.C.; Tsubota, K.; Pasquale, L.R.; Kang, J.H. Low-carbohydrate-diet scores and the risk of primary open-angle glaucoma: Data from three US cohorts. Eye 2020, 34, 1465–1475. [Google Scholar] [CrossRef] [Scilit]
- Kurihara, T.; Omoto, M.; Noda, K.; Ebinuma, M.; Kubota, S.; Koizumi, H.; Yoshida, S.; Ozawa, Y.; Shimmura, S.; Ishida, S.; et al. Retinal phototoxicity in a novel murine model of intraocular lens implantation. Mol. Vis. 2009, 15, 2751–2761. [Google Scholar]
- Malek, G.; Busik, J.; Grant, M.B.; Choudhary, M. Models of retinal diseases and their applicability in drug discovery. Expert Opin. Drug Discov. 2018, 13, 359–377. [Google Scholar] [CrossRef] [Scilit]
- Sayyad, Z.; Sirohi, K.; Radha, V.; Swarup, G. 661W is a retinal ganglion precursor-like cell line in which glaucoma-associated optineurin mutants induce cell death selectively. Sci. Rep. 2017, 7, 16855. [Google Scholar] [CrossRef] [Scilit]
- Hellinen, L.; Hagström, M.; Knuutila, H.; Ruponen, M.; Urtti, A.; Reinisalo, M. Characterization of artificially re-pigmented ARPE-19 retinal pigment epithelial cell model. Sci. Rep. 2019, 9, 13761. [Google Scholar] [CrossRef] [Scilit]
- Spilsbury, K.; Garrett, K.L.; Shen, W.Y.; Constable, I.J.; Rakoczy, P.E. Overexpression of vascular endothelial growth factor (VEGF) in the retinal pigment epithelium leads to the development of choroidal neovascularization. Am. J. Pathol. 2000, 157, 135–144. [Google Scholar] [CrossRef] [Scilit]
- Blaauwgeers, H.G.; Holtkamp, G.M.; Rutten, H.; Witmer, A.N.; Koolwijk, P.; Partanen, T.A.; Alitalo, K.; Kroon, M.E.; Kijlstra, A.; van Hinsbergh, V.W.; et al. Polarized vascular endothelial growth factor secretion by human retinal pigment epithelium and localization of vascular endothelial growth factor receptors on the inner choriocapillaris. Evidence for a trophic paracrine relation. Am. J. Pathol. 1999, 155, 421–428. [Google Scholar] [CrossRef] [Scilit]
- Ablonczy, Z.; Dahrouj, M.; Marneros, A.G. Progressive dysfunction of the retinal pigment epithelium and retina due to increased VEGF-A levels. FASEB J. 2014, 28, 2369–2379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forooghian, F.; Razavi, R.; Timms, L. Hypoxia-inducible factor expression in human RPE cells. Br. J. Ophthalmol. 2007, 91, 1406–1410. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takei, A.; Ekström, M.; Mammadzada, P.; Aronsson, M.; Yu, M.; Kvanta, A.; André, H. Gene Transfer of Prolyl Hydroxylase Domain 2 Inhibits Hypoxia-inducible Angiogenesis in a Model of Choroidal Neovascularization. Sci. Rep. 2017, 7, 42546. [Google Scholar] [CrossRef] [Scilit]
- Bahrami, B.; Shen, W.; Zhu, L.; Zhang, T.; Chang, A.; Gillies, M.C. Effects of VEGF inhibitors on human retinal pigment epithelium under high glucose and hypoxia. Clin. Exp. Ophthalmol. 2019, 47, 1074–1081. [Google Scholar] [CrossRef] [Scilit]
- Chu, C.-Y.; Jin, Y.-T.; Zhang, W.; Yu, J.; Yang, H.-P.; Wang, H.-Y.; Zhang, Z.-J.; Liu, X.-P.; Zou, Q. CA IX is upregulated in CoCl2-induced hypoxia and associated with cell invasive potential and a poor prognosis of breast cancer. Int. J. Oncol. 2016, 48, 271–280. [Google Scholar] [CrossRef] [Scilit]
- Okamoto, T.; Kawashima, H.; Osada, H.; Toda, E.; Homma, K.; Nagai, N.; Imai, Y.; Tsubota, K.; Ozawa, Y. Dietary Spirulina Supplementation Protects Visual Function From Photostress by Suppressing Retinal Neurodegeneration in Mice. Transl. Vis. Sci. Technol. 2019, 8, 20. [Google Scholar] [CrossRef] [Scilit]
- Sasaki, M.; Yuki, K.; Kurihara, T.; Miyake, S.; Noda, K.; Kobayashi, S.; Ishida, S.; Tsubota, K.; Ozawa, Y. Biological role of lutein in the light-induced retinal degeneration. J. Nutr. Biochem. 2012, 23, 423–429. [Google Scholar] [CrossRef] [Scilit]
- Gul, K.; Yousuf, B.; Singh, A.K.; Singh, P.; Wani, A.A. Rice bran: Nutritional values and its emerging potential for development of functional food—A review. Bioact. Carbohydr. Diet. Fibre 2015, 6, 24–30. [Google Scholar] [CrossRef] [Scilit]
- Park, H.Y.; Lee, K.W.; Choi, H.D. Rice bran constituents: Immunomodulatory and therapeutic activities. Food Funct. 2017, 8, 935–943. [Google Scholar] [CrossRef] [Scilit]
- Kurihara, T.; Westenskow, P.D.; Bravo, S.; Aguilar, E.; Friedlander, M. Targeted deletion of Vegfa in adult mice induces vision loss. J. Clin. Investig. 2012, 122, 4213–4217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhutto, I.; Lutty, G. Understanding age-related macular degeneration (AMD): Relationships between the photoreceptor/retinal pigment epithelium/Bruch’s membrane/choriocapillaris complex. Mol. Asp. Med. 2012, 33, 295–317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lehmann, G.L.; Benedicto, I.; Philp, N.J.; Rodriguez-Boulan, E. Plasma membrane protein polarity and trafficking in RPE cells: Past, present and future. Exp. Eye Res. 2014, 126, 5–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ford, K.M.; Saint-Geniez, M.; Walshe, T.; Zahr, A.; D’Amore, P.A. Expression and role of VEGF in the adult retinal pigment epithelium. Investig. Ophthalmol. Vis. Sci. 2011, 52, 9478–9487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sparrow, J.R.; Ueda, K.; Zhou, J. Complement dysregulation in AMD: RPE-Bruch’s membrane-choroid. Mol. Asp. Med. 2012, 33, 436–445. [Google Scholar] [CrossRef] [Scilit]
- Noël, A.; Jost, M.; Lambert, V.; Lecomte, J.; Rakic, J.-M. Anti-angiogenic therapy of exudative age-related macular degeneration: Current progress and emerging concepts. Trends Mol. Med. 2007, 13, 345–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Espinosa-Heidmann, D.G.; Reinoso, M.A.; Pina, Y.; Csaky, K.G.; Caicedo, A.; Cousins, S.W. Quantitative enumeration of vascular smooth muscle cells and endothelial cells derived from bone marrow precursors in experimental choroidal neovascularization. Exp. Eye Res. 2005, 80, 369–378. [Google Scholar] [CrossRef] [Scilit]
- Spaide, R.F. Rationale for combination therapies for choroidal neovascularization. Am. J. Ophthalmol. 2006, 141, 149–156. [Google Scholar] [CrossRef] [Scilit]
- Mansour, S.E.; Browning, D.J.; Wong, K.; Flynn, H.W., Jr.; Bhavsar, A.R. The Evolving Treatment of Diabetic Retinopathy. Clin. Ophthalmol. 2020, 14, 653–678. [Google Scholar] [CrossRef] [Scilit]
- Grunwald, J.E.; Daniel, E.; Huang, J.; Ying, G.-S.; Maguire, M.G.; Toth, C.A.; Jaffe, G.J.; Fine, S.L.; Blodi, B.; Klein, M.L.; et al. Risk of geographic atrophy in the comparison of age-related macular degeneration treatments trials. Ophthalmology 2014, 121, 150–161. [Google Scholar] [CrossRef] [Scilit]
- Saint-Geniez, M.; Maharaj, A.S.R.; Walshe, T.E.; Tucker, B.A.; Sekiyama, E.; Kurihara, T.; Darland, D.C.; Young, M.J.; D’Amore, P.A. Endogenous VEGF Is Required for Visual Function: Evidence for a Survival Role on Müller Cells and Photoreceptors. PLoS ONE 2008, 3, e3554. [Google Scholar] [CrossRef] [Scilit]
- Mohamed, Q.; Gillies, M.C.; Wong, T.Y. Management of Diabetic RetinopathyA Systematic Review. JAMA 2007, 298, 902–916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simó, R.; Hernández, C. Advances in the medical treatment of diabetic retinopathy. Diabetes Care 2009, 32, 1556–1562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giovannitti, J.A.; Trapp, L.D. Adult sedation: Oral, rectal, IM, IV. Anesth. Prog. 1991, 38, 154–171. [Google Scholar]





| Name | Direction | Sequence (5′ → 3′) |
|---|---|---|
| GAPDH | Forward | TCCCTGAGCTGAACGGGAAG |
| Reverse | GGAGGAGTGGGTGTCGCTGT | |
| HIF-1α | Forward | TTCACCTGAGCCTAATAGTCC |
| Reverse | CAAGTCTAAATCTGTGTCCTG | |
| VEGF | Forward | TCTACCTCCACCATGCCAAGT |
| Reverse | GATGATTCTGCCCTCCTCCTT | |
| BNIP3 | Forward | GGACAGAGTAGTTCCAGAGGCAGTTC |
| Reverse | GGTGTGCATTTCCACATCAAACAT | |
| PDK1 | Forward | ACAAGGAGAGCTTCGGGGTGGATC |
| Reverse | CCACGTCGCAGTTTGGATTTATGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ibuki, M.; Lee, D.; Shinojima, A.; Miwa, Y.; Tsubota, K.; Kurihara, T. Rice Bran and Vitamin B6 Suppress Pathological Neovascularization in a Murine Model of Age-Related Macular Degeneration as Novel HIF Inhibitors. Int. J. Mol. Sci. 2020, 21, 8940. https://doi.org/10.3390/ijms21238940
Ibuki M, Lee D, Shinojima A, Miwa Y, Tsubota K, Kurihara T. Rice Bran and Vitamin B6 Suppress Pathological Neovascularization in a Murine Model of Age-Related Macular Degeneration as Novel HIF Inhibitors. International Journal of Molecular Sciences. 2020; 21(23):8940. https://doi.org/10.3390/ijms21238940
Chicago/Turabian StyleIbuki, Mari, Deokho Lee, Ari Shinojima, Yukihiro Miwa, Kazuo Tsubota, and Toshihide Kurihara. 2020. "Rice Bran and Vitamin B6 Suppress Pathological Neovascularization in a Murine Model of Age-Related Macular Degeneration as Novel HIF Inhibitors" International Journal of Molecular Sciences 21, no. 23: 8940. https://doi.org/10.3390/ijms21238940
APA StyleIbuki, M., Lee, D., Shinojima, A., Miwa, Y., Tsubota, K., & Kurihara, T. (2020). Rice Bran and Vitamin B6 Suppress Pathological Neovascularization in a Murine Model of Age-Related Macular Degeneration as Novel HIF Inhibitors. International Journal of Molecular Sciences, 21(23), 8940. https://doi.org/10.3390/ijms21238940

