Characterization of miRNAs in Cultured Atlantic Salmon Head Kidney Monocyte-Like and Macrophage-Like Cells
Abstract
:1. Introduction
2. Results
2.1. Influence of Culture Time on the Morphology, Phagocytic Ability, Reactive Oxygen Species (ROS) Production and Macrophage Markers in Atlantic Salmon Adherent HKLs
2.2. Library Preparation, Deep Sequencing, miRNA Diversity Estimation and Differential Expression Analysis of Small RNA Sequence Data
2.3. qPCR Validation of DESeq2-Identified miRNAs
2.4. In Silico Target Gene Predictions
3. Discussion
3.1. miRNA Diversity and Abundance in Atlantic Salmon Adherent HKLs
3.2. Expression Analysis Identified DE miRNAs Known to Be Involved in Macrophage Function or Differentiation in Other Species and/or Immune Function in Atlantic Salmon
3.3. In Silico Target Prediction Identified Potential Targets Involved in Macrophage Differentiation and Function in Other Species
4. Materials and Methods
4.1. Animals
4.2. Adherent HKL Isolation and Culture
4.3. Morphology Analysis
4.4. Phagocytosis Assay
4.5. Respiratory Burst Assays
4.6. Total RNA Extraction for Sequencing
4.7. Library Preparation and Sequencing
4.8. Data Processing, Differential Expression Analysis and miRNA Diversity Estimation
4.9. qPCR Analysis of miRNA Expression
4.10. In Silico Predictions of Target Genes
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Das, A.; Sinha, M.; Datta, S.; Abas, M.; Chaffee, S.; Sen, C.K.; Roy, S. Monocyte and macrophage plasticity in tissue repair and regeneration. Am. J. Pathol. 2015, 185, 2596–2606. [Google Scholar] [CrossRef] [Green Version]
- Italiani, P.; Boraschi, D. From Monocytes to M1/M2 Macrophages: Phenotypical vs. Functional Differentiation. Front. Immunol. 2014, 5, 514. [Google Scholar] [CrossRef] [Green Version]
- Imperato, M.R.; Cauchy, P.; Obier, N.; Bonifer, C. The RUNX1–PU.1 axis in the control of hematopoiesis. Int. J. Hematol. 2015, 101, 319–329. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mills, C.D. M1 and M2 Macrophages: Oracles of Health and Disease. Crit. Rev. Immunol. 2012, 32, 463–488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, D.; Huang, C.; Lin, Z.; Zhan, S.; Kong, L.; Fang, C.; Li, J. Macrophage polarization and function with emphasis on the evolving roles of coordinated regulation of cellular signaling pathways. Cell. Signal. 2014, 26, 192–197. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.C.; Zou, X.B.; Chai, Y.F.; Yao, Y.M. Macrophage polarization in inflammatory diseases. Int. J. Biol. Sci. 2014, 10, 520–529. [Google Scholar] [CrossRef] [PubMed]
- Katzenback, B.; Katakura, F.; Belosevic, M. Regulation of Teleost Macrophage and Neutrophil Cell Development by Growth Factors and Transcription Factors. 2012, pp. 97–149. Available online: https://www.researchgate.net/publication/235511869_Regulation_of_Teleost_Macrophage_and_Neutrophil_Cell_Development_by_Growth_Factors_and_Transcription_Factors (accessed on 1 November 2012).
- Katzenback, B.A.; Katakura, F.; Belosevic, M. Goldfish (Carassius auratus L.) as a model system to study the growth factors, receptors and transcription factors that govern myelopoiesis in fish. Dev. Comp. Immunol. 2016, 58, 68–85. [Google Scholar] [CrossRef] [PubMed]
- Hodgkinson, J.W.; Grayfer, L.; Belosevic, M. Biology of Bony Fish Macrophages. Biology 2015, 4, 881–906. [Google Scholar] [CrossRef] [PubMed]
- Grayfer, L.; Kerimoglu, B.; Yaparla, A.; Hodgkinson, J.W.; Xie, J.; Belosevic, M. Mechanisms of Fish Macrophage Antimicrobial Immunity. Front. Immunol. 2018, 9, 1105. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Hannon, G.J. MicroRNAs: Small RNAs with a big role in gene regulation. Nat. Rev. 2004, 5, 522–531. [Google Scholar] [CrossRef]
- Chekulaeva, M.; Filipowicz, W. Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells. Curr. Opin. Cell Biol. 2009, 21, 452–460. [Google Scholar] [CrossRef] [PubMed]
- Bushati, N.; Cohen, S.M. microRNA Functions. Annu. Rev. Cell Dev. Biol. 2007, 23, 175–205. [Google Scholar] [CrossRef] [PubMed]
- Stefani, G.; Slack, F.J. Small non-coding RNAs in animal development. Nat. Rev. cell Biol. 2008, 9, 219–230. [Google Scholar] [CrossRef] [PubMed]
- Tufekci, K.U.; Meuwissen, R.L.; Genc, S. The role of microRNAs in biological processes. Methods Mol. Biol. 2014, 1107, 15–31. [Google Scholar] [PubMed]
- Roy, S. miRNA in Macrophage Development and Function. Antioxid. Redox Signal. 2016, 25, 795–804. [Google Scholar] [CrossRef] [Green Version]
- Essandoh, K.; Li, Y.; Huo, J.; Fan, G.C. MiRNA-Mediated Macrophage Polarization and its Potential Role in the Regulation of Inflammatory Response. Shock 2016, 46, 122–131. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, M.; Zhong, M.; Suo, Q.; Lv, K. Expression profiles of miRNAs in polarized macrophages. Int. J. Mol. Med. 2013, 31, 797–802. [Google Scholar] [CrossRef] [Green Version]
- Fontana, L.; Pelosi, E.; Greco, P.; Racanicchi, S.; Testa, U.; Liuzzi, F.; Croce, C.M.; Brunetti, E.; Grignani, F.; Peschle, C. MicroRNAs 17-5p-20a-106a control monocytopoiesis through AML1 targeting and M-CSF receptor upregulation. Nat. Cell Biol. 2007, 9, 775–787. [Google Scholar] [CrossRef]
- Andreassen, R.; Høyheim, B. miRNAs associated with immune response in teleost fish. Dev. Comp. Immunol. Impact High Throughput Seq. Comp. Immunogenomics 2017, 75, 77–85. [Google Scholar] [CrossRef]
- Chu, Q.; Yan, X.; Liu, L.; Xu, T. The Inducible microRNA-21 Negatively Modulates the Inflammatory Response in Teleost Fish via Targeting IRAK4. Front. Immunol. 2019, 10, 1623. [Google Scholar] [CrossRef] [Green Version]
- Nie, L.; Cai, S.Y.; Sun, J.; Chen, J. MicroRNA-155 promotes pro-inflammatory functions and augments apoptosis of monocytes/macrophages during Vibrio anguillarum infection in ayu, Plecoglossus altivelis. Fish Shellfish Immunol. 2019, 86, 70–81. [Google Scholar] [CrossRef] [PubMed]
- Eslamloo, K.; Inkpen, S.M.; Rise, M.L.; Andreassen, R. Discovery of microRNAs associated with the antiviral immune response of Atlantic cod macrophages. Mol. Immunol. 2018, 93, 152–161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ni, S.; Yan, Y.; Cui, H.; Yu, Y.; Huang, Y.; Qin, Q. Fish miR-146a promotes Singapore grouper iridovirus infection by regulating cell apoptosis and NF-kappaB activation. J. Gen. Virol. 2017, 98, 1489–1499. [Google Scholar] [CrossRef] [PubMed]
- Bi, D.; Cui, J.; Chu, Q.; Xu, T. MicroRNA-21 contributes to suppress cytokines production by targeting TLR28 in teleost fish. Mol. Immunol. 2017, 83, 107–114. [Google Scholar] [CrossRef] [PubMed]
- Joerink, M.; Ribeiro, C.M.S.; Stet, R.J.M.; Hermsen, T.; Savelkoul, H.F.J.; Wiegertjes, G.F. Head Kidney-Derived Macrophages of Common Carp (Cyprinus carpio L.) Show Plasticity and Functional Polarization upon Differential Stimulation. J. Immunol. 2006, 177, 61–69. [Google Scholar] [CrossRef] [Green Version]
- Belosevic, M.; Hanington, P.C.; Barreda, D.R. Development of goldfish macrophages in vitro. Fish Shellfish Immunol. 2006, 20, 152–171. [Google Scholar] [CrossRef]
- Neumann, N.F.; Barreda, D.; Belosevic, M. Production of a macrophage growth factor(s) by a goldfish macrophage cell line and macrophages derived from goldfish kidney leukocytes. Dev. Comp. Immunol. 1998, 22, 417–432. [Google Scholar] [CrossRef]
- Smith, N.C.; Christian, S.L.; Taylor, R.G.; Santander, J.; Rise, M.L. Immune modulatory properties of 6-gingerol and resveratrol in Atlantic salmon macrophages. Mol. Immunol. 2018, 95, 10–19. [Google Scholar] [CrossRef]
- Eslamloo, K.; Xue, X.; Hall, J.R.; Smith, N.C.; Caballero-Solares, A.; Parrish, C.C.; Taylor, R.G.; Rise, M.L. Transcriptome profiling of antiviral immune and dietary fatty acid dependent responses of Atlantic salmon macrophage-like cells. BMC Genom. 2017, 18, 706. [Google Scholar] [CrossRef]
- Petit, J.; Embregts, C.W.E.; Forlenza, M.; Wiegertjes, G.F. Evidence of Trained Immunity in a Fish: Conserved Features in Carp Macrophages. J. Immunol. 2019, 203, 216–224. [Google Scholar] [CrossRef] [Green Version]
- Soto-Dávila, M.; Valderrama, K.; Inkpen, S.M.; Hall, J.R.; Rise, M.L.; Santander, J. Effects of Vitamin D(2) (Ergocalciferol) and D(3) (Cholecalciferol) on Atlantic Salmon (Salmo salar) Primary Macrophage Immune Response to Aeromonas salmonicida subsp. salmonicida Infection. Front. Immunol. 2020, 10, 3011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allavena, P.; Piemonti, L.; Longoni, D.; Bernasconi, S.; Stoppacciaro, A.; Ruco, L.; Mantovani, A. IL-10 prevents the differentiation of monocytes to dendritic cells but promotes their maturation to macrophages. Eur. J. Immunol. 1998, 28, 359–369. [Google Scholar] [CrossRef]
- Mukhopadhyay, S.; Chen, Y.; Sankala, M.; Peiser, L.; Pikkarainen, T.; Kraal, G.; Tryggvason, K.; Gordon, S. MARCO, an innate activation marker of macrophages, is a class A scavenger receptor for Neisseria meningitidis. Eur. J. Immunol. 2006, 36, 940–949. [Google Scholar] [CrossRef] [PubMed]
- Buxadé, M.; Huerga Encabo, H.; Riera-Borrull, M.; Quintana-Gallardo, L.; López-Cotarelo, P.; Tellechea, M.; Martínez-Martínez, S.; Redondo, J.M.; Martín-Caballero, J.; Flores, J.M.; et al. Macrophage-specific MHCII expression is regulated by a remote Ciita enhancer controlled by NFAT5. J. Exp. Med. 2018, 215, 2901–2918. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, L.; Nie, L.; Cai, S.-Y.; Chen, J.; Chen, J. Role of a macrophage receptor with collagenous structure (MARCO) in regulating monocyte/macrophage functions in ayu, Plecoglossus altivelis. Fish Shellfish Immunol. 2018, 74. [Google Scholar] [CrossRef] [PubMed]
- Yao, Y.; Xu, X.-H.; Jin, L. Macrophage Polarization in Physiological and Pathological Pregnancy. Front. Immunol. 2019, 10, 792. [Google Scholar] [CrossRef]
- Chávez-Galán, L.; Olleros, M.L.; Vesin, D.; Garcia, I. Much More than M1 and M2 Macrophages, There are also CD169(+) and TCR(+) Macrophages. Front. Immunol. 2015, 6, 263. [Google Scholar]
- Woldemariam, N.T.; Agafonov, O.; Høyheim, B.; Houston, R.D.; Taggart, J.B.; Andreassen, R. Expanding the miRNA Repertoire in Atlantic Salmon; Discovery of IsomiRs and miRNAs Highly Expressed in Different Tissues and Developmental Stages. Cells 2019, 8, 42. [Google Scholar] [CrossRef] [Green Version]
- Andreassen, R.; Woldemariam, N.T.; Egeland, I.O.; Agafonov, O.; Sindre, H.; Høyheim, B. Identification of differentially expressed Atlantic salmon miRNAs responding to salmonid alphavirus (SAV) infection. BMC Genomics 2017, 18, 343–349. [Google Scholar] [CrossRef]
- Cobos Jiménez, V.; Willemsen, A.M.; Bradley, E.J.; Baas, F.; van Kampen, A.H.; Kootstra, N.A. Next-generation sequencing of microRNAs in primary human polarized macrophages. Genomics Data 2014, 2, 181–183. [Google Scholar] [CrossRef] [Green Version]
- Neumann, N.F.; Barreda, D.R.; Belosevic, M. Generation and functional analysis of distinct macrophage sub-populations from goldfish (Carassius auratus L.) kidney leukocyte cultures. Fish Shellfish Immunol. 2000, 10, 1–20. [Google Scholar] [CrossRef] [PubMed]
- Tedesco, S.; De Majo, F.; Kim, J.; Trenti, A.; Trevisi, L.; Fadini, G.P.; Bolego, C.; Zandstra, P.W.; Cignarella, A.; Vitiello, L. Convenience versus Biological Significance: Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived Macrophages When Studying in Vitro Polarization? Front. Pharmacol. 2018, 9, 71. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Starr, T.; Bauler, T.J.; Malik-Kale, P.; Steele-Mortimer, O. The phorbol 12-myristate-13-acetate differentiation protocol is critical to the interaction of THP-1 macrophages with Salmonella Typhimurium. PLoS ONE 2018, 13, e0193601. [Google Scholar] [CrossRef] [PubMed]
- Lund, M.E.; To, J.; O’Brien, B.A.; Donnelly, S. The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of THP-1 macrophages to a pro-inflammatory stimulus. J. Immunol. Methods 2016, 430, 64–70. [Google Scholar] [CrossRef]
- Xu, S.J.; Hu, H.T.; Li, H.L.; Chang, S. The Role of miRNAs in Immune Cell Development, Immune Cell Activation, and Tumor Immunity: With a Focus on Macrophages and Natural Killer Cells. Cells 2019, 8, 1140. [Google Scholar] [CrossRef] [Green Version]
- Valenzuela-Miranda, D.; Valenzuela-Munoz, V.; Farlora, R.; Gallardo-Escarate, C. MicroRNA-based transcriptomic responses of Atlantic salmon during infection by the intracellular bacterium Piscirickettsia salmonis. Dev. Comp. Immunol. 2017, 77, 287–296. [Google Scholar] [CrossRef]
- Velu, C.S.; Baktula, A.M.; Grimes, H.L. Gfi1 regulates miR-21 and miR-196b to control myelopoiesis. Blood 2009, 113, 4720–4728. [Google Scholar] [CrossRef] [Green Version]
- Barnett, R.E.; Conklin, D.J.; Ryan, L.; Keskey, R.C.; Ramjee, V.; Sepulveda, E.A.; Srivastava, S.; Bhatnagar, A.; Cheadle, W.G. Anti-inflammatory effects of miR-21 in the macrophage response to peritonitis. J. Leukoc. Biol. 2016, 99, 361–371. [Google Scholar] [CrossRef]
- Wang, Z.; Brandt, S.; Medeiros, A.; Wang, S.; Wu, H.; Dent, A.; Serezani, C.H. MicroRNA 21 is a homeostatic regulator of macrophage polarization and prevents prostaglandin E2-mediated M2 generation. PLoS ONE 2015, 10, e0115855. [Google Scholar] [CrossRef]
- Kurotaki, D.; Osato, N.; Nishiyama, A.; Yamamoto, M.; Ban, T.; Sato, H.; Nakabayashi, J.; Umehara, M.; Miyake, N.; Matsumoto, N.; et al. Essential role of the IRF8-KLF4 transcription factor cascade in murine monocyte differentiation. Blood 2013, 121, 1839–1849. [Google Scholar] [CrossRef]
- Ghani, S.; Riemke, P.; Schonheit, J.; Lenze, D.; Stumm, J.; Hoogenkamp, M.; Lagendijk, A.; Heinz, S.; Bonifer, C.; Bakkers, J.; et al. Macrophage development from HSCs requires PU.1-coordinated microRNA expression. Blood 2011, 118, 2275–2284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peng, L.; Zhang, H.; Hao, Y.; Xu, F.; Yang, J.; Zhang, R.; Lu, G.; Zheng, Z.; Cui, M.; Qi, C.-F.; et al. Reprogramming macrophage orientation by microRNA 146b targeting transcription factor IRF5. EBioMedicine 2016, 14, 83–96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taganov, K.D.; Boldin, M.P.; Chang, K.J.; Baltimore, D. NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. Proc. Natl. Acad. Sci. USA 2006, 103, 12481–12486. [Google Scholar] [CrossRef] [Green Version]
- Huang, C.; Liu, X.J.; Zhou, Q.; Xie, J.; Ma, T.T.; Meng, X.M.; Li, J. MiR-146a modulates macrophage polarization by inhibiting Notch1 pathway in RAW264.7 macrophages. Int. Immunopharmacol. 2016, 32, 46–54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xue, X.; Woldemariam, N.T.; Caballero-Solares, A.; Umasuthan, N.; Fast, M.D.; Taylor, R.G.; Rise, M.L.; Andreassen, R. Dietary Immunostimulant CpG Modulates MicroRNA Biomarkers Associated with Immune Responses in Atlantic Salmon (Salmo salar). Cells 2019, 8, 1592. [Google Scholar] [CrossRef] [Green Version]
- Mann, M.; Barad, O.; Agami, R.; Geiger, B.; Hornstein, E. miRNA-based mechanism for the commitment of multipotent progenitors to a single cellular fate. Proc. Natl. Acad. Sci. USA 2010, 107, 15804–15809. [Google Scholar] [CrossRef] [Green Version]
- Sharbati, J.; Lewin, A.; Kutz-Lohroff, B.; Kamal, E.; Einspanier, R.; Sharbati, S. Integrated MicroRNA-mRNA-Analysis of Human Monocyte Derived Macrophages upon Mycobacterium avium subsp. hominissuis Infection. PLoS ONE 2011, 6, e20258. [Google Scholar] [CrossRef]
- Schnitger, A.K.; Machova, A.; Mueller, R.U.; Androulidaki, A.; Schermer, B.; Pasparakis, M.; Kronke, M.; Papadopoulou, N. Listeria monocytogenes infection in macrophages induces vacuolar-dependent host miRNA response. PLoS ONE 2011, 6, e27435. [Google Scholar] [CrossRef]
- O’Connell, R.M.; Taganov, K.D.; Boldin, M.P.; Cheng, G.; Baltimore, D. MicroRNA-155 is induced during the macrophage inflammatory response. Proc. Natl. Acad. Sci. USA 2007, 104, 1604–1609. [Google Scholar]
- Xiao, C.; Calado, D.P.; Galler, G.; Thai, T.H.; Patterson, H.C.; Wang, J.; Rajewsky, N.; Bender, T.P.; Rajewsky, K. MiR-150 controls B cell differentiation by targeting the transcription factor c-Myb. Cell 2007, 131, 146–159. [Google Scholar] [CrossRef] [Green Version]
- Shakerian, L.; Ghorbani, S.; Talebi, F.; Noorbakhsh, F. MicroRNA-150 targets PU.1 and regulates macrophage differentiation and function in experimental autoimmune encephalomyelitis. J. Neuroimmunol. 2018, 323, 167–174. [Google Scholar] [CrossRef]
- Gentner, B.; Visigalli, I.; Hiramatsu, H.; Lechman, E.; Ungari, S.; Giustacchini, A.; Schira, G.; Amendola, M.; Quattrini, A.; Martino, S.; et al. Identification of hematopoietic stem cell-specific miRNAs enables gene therapy of globoid cell leukodystrophy. Sci. Transl. Med. 2010, 2, 58ra84. [Google Scholar] [CrossRef]
- Lechman, E.R.; Gentner, B.; van Galen, P.; Giustacchini, A.; Saini, M.; Boccalatte, F.E.; Hiramatsu, H.; Restuccia, U.; Bachi, A.; Voisin, V.; et al. Attenuation of miR-126 activity expands HSC in vivo without exhaustion. Cell Stem Cell 2012, 11, 799–811. [Google Scholar] [CrossRef] [Green Version]
- Ramachandra, R.K.; Salem, M.; Gahr, S.; Rexroad, C.E., 3rd; Yao, J. Cloning and characterization of microRNAs from rainbow trout (Oncorhynchus mykiss): Their expression during early embryonic development. BMC Dev. Biol. 2008, 8, 41. [Google Scholar] [CrossRef] [Green Version]
- Biyashev, D.; Veliceasa, D.; Topczewski, J.; Topczewska, J.M.; Mizgirev, I.; Vinokour, E.; Reddi, A.L.; Licht, J.D.; Revskoy, S.Y.; Volpert, O. V miR-27b controls venous specification and tip cell fate. Blood 2012, 119, 2679–2687. [Google Scholar] [CrossRef] [Green Version]
- Fish, J.E.; Santoro, M.M.; Morton, S.U.; Yu, S.; Yeh, R.-F.; Wythe, J.D.; Ivey, K.N.; Bruneau, B.G.; Stainier, D.Y.R.; Srivastava, D. miR-126 regulates angiogenic signaling and vascular integrity. Dev. Cell 2008, 15, 272–284. [Google Scholar] [CrossRef] [Green Version]
- Juanchich, A.; Le Cam, A.; Montfort, J.; Guiguen, Y.; Bobe, J. Identification of differentially expressed miRNAs and their potential targets during fish ovarian development. Biol. Reprod. 2013, 88, 128. [Google Scholar] [CrossRef]
- Najib, A.; Kim, M.S.; Choi, S.H.; Kang, Y.J.; Kim, K.H. Changes in microRNAs expression profile of olive flounder (Paralichthys olivaceus) in response to viral hemorrhagic septicemia virus (VHSV) infection. Fish Shellfish Immunol. 2016, 51, 384–391. [Google Scholar] [CrossRef]
- Wallner, S.; Grandl, M.; Konovalova, T.; Sigrüner, A.; Kopf, T.; Peer, M.; Orsó, E.; Liebisch, G.; Schmitz, G. Monocyte to Macrophage Differentiation Goes along with Modulation of the Plasmalogen Pattern through Transcriptional Regulation. PLoS ONE 2014, 9, e94102. [Google Scholar] [CrossRef] [Green Version]
- Batista-Gonzalez, A.; Vidal, R.; Criollo, A.; Carreño, L.J. New Insights on the Role of Lipid Metabolism in the Metabolic Reprogramming of Macrophages. Front. Immunol. 2020, 10, 2993. [Google Scholar] [CrossRef]
- Im, S.-S.; Yousef, L.; Blaschitz, C.; Liu, J.Z.; Edwards, R.A.; Young, S.G.; Raffatellu, M.; Osborne, T.F. Linking lipid metabolism to the innate immune response in macrophages through sterol regulatory element binding protein-1a. Cell Metab. 2011, 13, 540–549. [Google Scholar] [CrossRef] [Green Version]
- Ecker, J.; Liebisch, G.; Englmaier, M.; Grandl, M.; Robenek, H.; Schmitz, G. Induction of fatty acid synthesis is a key requirement for phagocytic differentiation of human monocytes. Proc. Natl. Acad. Sci. USA 2010, 107, 7817–7822. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.-H.; Phelan, P.; Shin, M.; Oh, B.-C.; Han, X.; Im, S.-S.; Osborne, T.F. SREBP-1a–stimulated lipid synthesis is required for macrophage phagocytosis downstream of TLR4-directed mTORC1. Proc. Natl. Acad. Sci. USA 2018, 115, E12228–E12234. [Google Scholar] [CrossRef] [Green Version]
- Krausgruber, T.; Blazek, K.; Smallie, T.; Alzabin, S.; Lockstone, H.; Sahgal, N.; Hussell, T.; Feldmann, M.; Udalova, I.A. IRF5 promotes inflammatory macrophage polarization and TH1-TH17 responses. Nat. Immunol. 2011, 12, 231–238. [Google Scholar] [CrossRef]
- Weiss, M.; Blazek, K.; Byrne, A.J.; Perocheau, D.P.; Udalova, I.A. IRF5 is a specific marker of inflammatory macrophages in vivo. Mediators Inflamm. 2013, 2013, 245804. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.; Qi, C.; Shan, S.; Zhang, F.; Li, H.; An, L.; Yang, G. Characterization of common carp (Cyprinus carpio L.) interferon regulatory factor 5 (IRF5) and its expression in response to viral and bacterial challenges. BMC Vet. Res. 2016, 12, 127. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Jiang, T.; Li, M.-Q.; Zheng, X.-L.; Zhao, G.-J. Transcriptional Regulation of Macrophages Polarization by MicroRNAs. Front. Immunol. 2018, 9, 1175. [Google Scholar] [CrossRef]
- Tugal, D.; Liao, X.; Jain, M.K. Transcriptional control of macrophage polarization. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 1135–1144. [Google Scholar] [CrossRef] [Green Version]
- Lee, B.; Qiao, L.; Lu, M.; Yoo, H.S.; Cheung, W.; Mak, R.; Schaack, J.; Feng, G.-S.; Chi, N.-W.; Olefsky, J.M.; et al. C/EBPα regulates macrophage activation and systemic metabolism. Am. J. Physiol. Endocrinol. Metab. 2014, 306, E1144–E1154. [Google Scholar] [CrossRef] [Green Version]
- Ruffell, D.; Mourkioti, F.; Gambardella, A.; Kirstetter, P.; Lopez, R.G.; Rosenthal, N.; Nerlov, C. A CREB-C/EBPbeta cascade induces M2 macrophage-specific gene expression and promotes muscle injury repair. Proc. Natl. Acad. Sci. USA 2009, 106, 17475–17480. [Google Scholar] [CrossRef] [Green Version]
- Worm, J.; Stenvang, J.; Petri, A.; Frederiksen, K.S.; Obad, S.; Elmén, J.; Hedtjärn, M.; Straarup, E.M.; Hansen, J.B.; Kauppinen, S. Silencing of microRNA-155 in mice during acute inflammatory response leads to derepression of c/ebp Beta and down-regulation of G-CSF. Nucleic Acids Res. 2009, 37, 5784–5792. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Li, F.; Wang, L.; Ada, y.; Ana, A.; Tian, F.; Ian, W.; Prediman, S.; Behrooz, S. Abstract 13424: GATA3 Regulates Macrophage Polarization and Phenotype. Circulation 2012, 126, A13424. [Google Scholar]
- Parameswaran, N.; Patial, S. Tumor necrosis factor-α signaling in macrophages. Crit. Rev. Eukaryot. Gene Expr. 2010, 20, 87–103. [Google Scholar] [CrossRef]
- Arango Duque, G.; Descoteaux, A. Macrophage cytokines: Involvement in immunity and infectious diseases. Front. Immunol. 2014, 5, 491. [Google Scholar] [CrossRef] [Green Version]
- Idriss, H.T.; Naismith, J.H. TNF alpha and the TNF receptor superfamily: Structure-function relationship(s). Microsc. Res. Tech. 2000, 50, 184–195. [Google Scholar] [CrossRef]
- Zou, J.; Peddie, S.; Scapigliati, G.; Zhang, Y.; Bols, N.C.; Ellis, A.E.; Secombes, C.J. Functional characterisation of the recombinant tumor necrosis factors in rainbow trout, Oncorhynchus mykiss. Dev. Comp. Immunol. 2003, 27, 813–822. [Google Scholar] [CrossRef]
- Witsell, A.L.; Schook, L.B. Tumor necrosis factor alpha is an autocrine growth regulator during macrophage differentiation. Proc. Natl. Acad. Sci. USA 1992, 89, 4754–4758. [Google Scholar] [CrossRef] [Green Version]
- Solberg, R.; Smith, R.; Almlof, M.; Tewolde, E.; Nilsen, H.; Johansen, H.T. Legumain expression, activity and secretion are increased during monocyte-to-macrophage differentiation and inhibited by atorvastatin. Biol. Chem. 2015, 396, 71–80. [Google Scholar] [CrossRef]
- Barreda, D.R.; Hanington, P.C.; Belosevic, M. Regulation of myeloid development and function by colony stimulating factors. Dev. Comp. Immunol. 2004, 28, 509–554. [Google Scholar] [CrossRef]
- Wen, H.; Hogaboam, C.M.; Lukacs, N.W.; Cook, D.N.; Lira, S.A.; Kunkel, S.L. The chemokine receptor CCR6 is an important component of the innate immune response. Eur. J. Immunol. 2007, 37, 2487–2498. [Google Scholar] [CrossRef] [Green Version]
- Xuan, W.; Qu, Q.; Zheng, B.; Xiong, S.; Fan, G.-H. The chemotaxis of M1 and M2 macrophages is regulated by different chemokines. J. Leukoc. Biol. 2015, 97, 61–69. [Google Scholar] [CrossRef]
- Ritchie, W.; Rasko, J.E.J. Refining microRNA target predictions: Sorting the wheat from the chaff. Biochem. Biophys. Res. Commun. 2014, 445, 780–784. [Google Scholar] [CrossRef] [PubMed]
- Herkenhoff, M.E.; Oliveira, A.C.; Nachtigall, P.G.; Costa, J.M.; Campos, V.F.; Hilsdorf, A.W.S.; Pinhal, D. Fishing Into the MicroRNA Transcriptome. Front. Genet. 2018, 9, 88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rise, M.L.; Jones, S.R.; Brown, G.D.; von Schalburg, K.R.; Davidson, W.S.; Koop, B.F. Microarray analyses identify molecular biomarkers of Atlantic salmon macrophage and hematopoietic kidney response to Piscirickettsia salmonis infection. Physiol. Genomics 2004, 20, 21–35. [Google Scholar] [CrossRef] [PubMed]
- Overland, H.S.; Pettersen, E.F.; Ronneseth, A.; Wergeland, H.I. Phagocytosis by B-cells and neutrophils in Atlantic salmon (Salmo salar L.) and Atlantic cod (Gadus morhua L.). Fish Shellfish Immunol. 2010, 28, 193–204. [Google Scholar] [CrossRef]
- Kalgraff, C.A.K.; Wergeland, H.I.; Pettersen, E.F. Flow cytometry assays of respiratory burst in Atlantic salmon (Salmo salar L.) and in Atlantic cod (Gadus morhua L.) leucocytes. Fish Shellfish Immunol. 2011, 31, 381–388. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10. [Google Scholar] [CrossRef]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. FeatureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550–558. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johansen, I.; Andreassen, R. Validation of miRNA genes suitable as reference genes in qPCR analyses of miRNA gene expression in Atlantic salmon (Salmo salar). BMC Res. Notes 2014, 8, 945. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Krüger, J.; Rehmsmeier, M. RNAhybrid: MicroRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006, 34, W451–W454. [Google Scholar] [CrossRef] [PubMed]
Sample | Total Number of Reads a | Trimmed and Filtered Reads b | Reads Mapped to miRNA (%) c | Accession Number d |
---|---|---|---|---|
Fish 1 Day 1 | 10,954,203 | 6,089,270 | 87.9% | SRR9710703 |
Fish 1 Day 5 | 14,469,109 | 7,317,802 | 95.4% | SRR9710704 |
Fish 3 Day 1 e | 27,215,751 | 5,019,027 | 76.6% | SRR9710705 |
Fish 3 Day 5 | 19,158,159 | 6,104,257 | 88.3% | SRR9710706 |
Fish 4 Day 1 | 29,288,867 | 5,521,671 | 77.6% | SRR9710709 |
Fish 4 Day 5 | 26,403,552 | 6,365,057 | 81.9% | SRR9710710 |
Fish 5 Day 1 | 10,711,291 | 6,013,861 | 78.8% | SRR9710711 |
Fish 5 Day 5 | 8,325,813 | 4,870,035 | 79.6% | SRR9710712 |
Fish 6 Day 1 | 10,064,941 | 5,282,051 | 80.5% | SRR9710707 |
Fish 6 Day 5 | 8,760,222 | 6,032,420 | 87.1% | SRR9710708 |
Sequencing | qPCR | ||||
---|---|---|---|---|---|
Mature miRNA | Base Mean a | log2 FC b | Adjusted p-Value c | log2 FC d | p-Value e |
miR-146a-5p | 737973.84 | 2.91 | 1.02 × 10−11 | 10.99 | 2.00 × 10−4 |
miR-146b-5p | 15429.78 | 4.03 | 3.76 × 10−17 | 12.88 | 1.00 × 10−4 |
miR-155-5p | 38126.56 | 1.39 | 5.81 × 10−3 | 2.09 | 3.01 × 10−2 |
miR-126-3p | 11661.74 | −1.52 | 3.51 × 10−6 | −2.99 | 2.00 × 10−4 |
miR-150-5p | 3140.46 | −1.52 | 1.28 × 10−8 | −2.97 | 2.00 × 10−4 |
miR-139-5p | 643.30 | −1.00 | 1.78 × 10−2 | −0.87 | 5.30 × 10−3 |
miR-2188-3p | 1269.71 | −1.49 | 8.23 × 10−3 | −5.00 | 2.00 × 10−4 |
Functional Category | miRNA | Predicted Target mRNA (Gene Symbol) a | Predicted Target mRNA (Gene Name) |
---|---|---|---|
Lipid related | ssa-miR-139-5p | srebf1 | Sterol regulatory element-binding protein 1 |
ssa-miR-139-5p | srebf2 | Sterol regulatory element-binding protein 2 | |
ssa-miR-139-5p | elovl5a | Elongation of very-long-chain fatty acids protein 5 | |
ssa-miR-155-5p | elovl5a | Elongation of very-long-chain fatty acids protein 5 | |
ssa-miR-200ae-3p | elovl7 | Elongation of very-long-chain fatty acids protein 7 | |
ssa-miR-221-5p | elovl5 | Elongation of very-long-chain fatty acids protein 5 | |
ssa-miR-221-5p | facr1 | Fatty acyl-CoA reductase | |
Transcription factors | ssa-miR-146a-5p | gata3 | Transcription factor GATA-3 |
ssa-miR-146b-5p | gata3 | Transcription factor GATA-3 | |
ssa-miR-200ae-3p | irf5 | Interferon regulatory factor 5 | |
ssa-miR-200ae-3p | cebpb | CCAAT/enhancer-binding protein beta | |
ssa-miR-2188-3p | cebpa | CCAAT/enhancer-binding protein alpha | |
Immune/macrophage related | ssa-miR-126-3p | i13r2 | Interleukin-13 receptor alpha-2 chain |
ssa-miR-139-5p | tnr1a | Tumor necrosis factor receptor superfamily member 1A | |
ssa-miR-150-5p | lgmn | Legumain | |
ssa-miR-155-5p | tnr1a | Tumor necrosis factor receptor superfamily member 1A | |
ssa-miR-155-5p | grn | Granulin | |
ssa-miR-155-5p | ccl25 | C-C motif chemokine 25 | |
ssa-miR-200ae-3p | ccr6 | C-C chemokine receptor type 6 | |
ssa-miR-2188-3p | tnr1a | Tumor necrosis factor receptor superfamily member 1A |
miRNA | Primer Sequence 5′ to 3′ a | R2 | Amplification Efficiency (%) |
---|---|---|---|
miR-155-5p b | TTAATGCTAATCGTGATAGGGGT | 0.999 | 81.3 |
miR-146b-5p | TGAGAACTGAAGTCCATAGATGG | 0.986 | 104.6 |
miR-146a-5p b | TGAGAACTGAATTCCATAGATGG | 0.989 | 115.9 |
miR-126-3p | TCGTACCGTGAGTAATAATGCA | 0.984 | 107.2 |
miR-150-5p | TCTCCCAATCCTTGTACCAGTG | 0.992 | 113.9 |
miR-2188-3p | GCTGTGTGAGGTCAGACCTATC | 0.982 | 116.5 |
miR-139-5p | TCTACAGTGCATGTGTCTCCAGT | 0.974 | 100.9 |
miR-221-5p | ACCTAGCATACAATGTAGATTTC | 0.984 | 115.4 |
miR-200ae-3p | TAATACTGCCTGGTAATGATGAT | 0.952 | 82.3 |
Normalizers | |||
miR-125a-5p | TCCCTGAGACCCTAACTTGTGA | 0.994 | 115.1 |
miR-19c-3p | TGTGCAAATCCATGCAAAACTG | 0.990 | 104.1 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Smith, N.C.; Christian, S.L.; Woldemariam, N.T.; Clow, K.A.; Rise, M.L.; Andreassen, R. Characterization of miRNAs in Cultured Atlantic Salmon Head Kidney Monocyte-Like and Macrophage-Like Cells. Int. J. Mol. Sci. 2020, 21, 3989. https://doi.org/10.3390/ijms21113989
Smith NC, Christian SL, Woldemariam NT, Clow KA, Rise ML, Andreassen R. Characterization of miRNAs in Cultured Atlantic Salmon Head Kidney Monocyte-Like and Macrophage-Like Cells. International Journal of Molecular Sciences. 2020; 21(11):3989. https://doi.org/10.3390/ijms21113989
Chicago/Turabian StyleSmith, Nicole C., Sherri L. Christian, Nardos T. Woldemariam, Kathy A. Clow, Matthew L. Rise, and Rune Andreassen. 2020. "Characterization of miRNAs in Cultured Atlantic Salmon Head Kidney Monocyte-Like and Macrophage-Like Cells" International Journal of Molecular Sciences 21, no. 11: 3989. https://doi.org/10.3390/ijms21113989
APA StyleSmith, N. C., Christian, S. L., Woldemariam, N. T., Clow, K. A., Rise, M. L., & Andreassen, R. (2020). Characterization of miRNAs in Cultured Atlantic Salmon Head Kidney Monocyte-Like and Macrophage-Like Cells. International Journal of Molecular Sciences, 21(11), 3989. https://doi.org/10.3390/ijms21113989