Type IV Collagen Is Essential for Proper Function of Integrin-Mediated Adhesion in Drosophila Muscle Fibers
Abstract
:1. Introduction
2. Results and Discussion
2.1. Characterization of col4a1 Mutation Sites
2.2. Loss of Sarcomere Structure in col4a1 Mutants
2.3. The Myopathic Phenotype Co-Segregates with the Mutation-Carrying Chromosome
2.4. Z-disc Disintegration, Streaming and Aberrant Integrin Expression in col4a1 Mutants
2.5. Fiber Atrophy and Fiber Size Diversity
3. Conclusions
4. Materials and Methods
4.1. PCR Amplification and Sequencing
4.2. Maintenance of Drosophila Strains
4.3. Immunostaining and Antibodies
4.4. Confocal Microscopy
4.5. Size Determination of the Muscle Fibers
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Pozzi, A.; Yurchenco, P.D.; Iozzo, R.V. The nature and biology of basement membranes. Matrix Biol. 2017, 57–58, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Sanes, J.R. The Basement Membrane/Basal Lamina of Skeletal Muscle. J. Biol. Chem. 2003, 278, 12601–12604. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guicheney, P.; Vignier, N.; Helbling-Leclerc, A.; Nissinen, M.; Zhang, X.; Cruaud, C.; Lambert, J.-C.; Richelme, C.; Topaloglu, H.; Merlini, L.; et al. Genetics of laminin alpha 2 chain (or merosin) deficient congenital muscular dystrophy: From identification of mutations to prenatal diagnosis. Neuromuscul. Disord. 1997, 7, 180–186. [Google Scholar] [CrossRef]
- Durbeej, M.; Campbell, K.P. Muscular dystrophies involving the dystrophin–glycoprotein complex: An overview of current mouse models. Curr. Opin. Genet. Dev. 2002, 12, 349–361. [Google Scholar] [CrossRef]
- Lampe, A.K.; Bushby, K.M. Collagen VI related muscle disorders. J. Med. Genet. 2005, 42, 673–685. [Google Scholar] [CrossRef] [Green Version]
- Mayer, U.; Saher, G.; Fassler, R.; Bornemann, A.; Echtermeyer, F.; von der Mark, H.; Miosge, N.; Pösch, E.; von der Mark, K. Absence of integrin alpha-7 causes a novel form of muscular dystrophy. Nat. Genet. 1997, 17, 318–323. [Google Scholar] [CrossRef]
- Bertini, E.; D’Amico, A.; Gualandi, F.; Petrini, S. Congenital Muscular Dystrophies: A Brief Review. Semin. Pediatr. Neurol. 2011, 18, 277–288. [Google Scholar] [CrossRef] [Green Version]
- Hynes, R.O. Integrins: Bidirectional Allosteric Signaling Machines. Cell 2002, 110, 673–687. [Google Scholar] [CrossRef]
- Kelemen-Valkony, I.; Kiss, M.; Csiha, J.; Kiss, A.; Bircher, U.; Szidonya, J.; Maróy, P.; Juhász, G.; Komonyi, O.; Csiszár, K.; et al. Drosophila basement membrane collagen col4a1 mutations cause severe myopathy. Matrix Biol. 2012, 31, 29–37. [Google Scholar] [CrossRef]
- Alport, A.C. Hereditary familial congenital haemorrhagic nephritis. Br. Med. J. 1927, 1, 504–506. [Google Scholar] [CrossRef]
- Hudson, B.G.; Tryggvason, K.; Sundaramoorthy, M.; Neilson, E.G. Alport’s Syndrome, Goodpasture’s Syndrome, and Type IV Collagen. N. Engl. J. Med. 2003, 348, 2543–2556. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Mochizuki, T.; Smeets, H.; Antignac, C.; Laurila, P.; de Paepe, A.; Tryggvason, K.; Reeders, S.T. Deletion of the Paired Alpha 5(IV) and Alpha 6(IV) Collagen Genes in Inherited Visceral Muscle Tumors. Science 1993, 261, 1167–1169. [Google Scholar] [CrossRef] [PubMed]
- Gould, D.B.; Phalan, F.C.; Breedveld, G.J.; van Mil, S.E.; Smith, R.S.; Schimenti, J.C.; Aguglia, U.; van der Knaap, M.S.; Heutink, P.; John, S.W. Mutations in Col4a1 Cause Perinatal Cerebral Hemorrhage and Porencephaly. Science 2005, 308, 1167–1171. [Google Scholar] [CrossRef] [PubMed]
- van Agtmael, T.; Schlötzer-Schrehardt, U.; McKie, L.; Brownstein, D.G.; Lee, A.W.; Cross, S.H.; Sado, Y.; Mullins, J.J.; Pöschl, E.; Jackson, I.J. Dominant Mutations of Col4a1 Result in Basement Membrane Defects Which Lead to Anterior Segment Dysgenesis and Glomerulopathy. Hum. Mol. Genet. 2005, 14, 3161–3168. [Google Scholar] [CrossRef] [PubMed]
- Favor, J.; Gloeckner, C.J.; Janik, D.; Klempt, M.; Neuhäuser-Klaus, A.; Pretsch, W.; Schmahl, W.; Quintanilla-Fend, L. Type IV Procollagen Missense Mutations Associated with Defects of the Eye, Vascular Stability, the Brain, Kidney Function and Embryonic or Postnatal Viability in the Mouse, Mus Musculus: An Extension of the Col4a1 Allelic Series and the Identification of the First Two Col4a2 Mutant Alleles. Genetics 2007, 175, 725–736. [Google Scholar] [PubMed]
- Kuo, D.S.; Labelle-Dumais, C.; Gould, D.B. COL4A1 and COL4A2 Mutations and Disease: Insights into Pathogenic Mechanisms and Potential Therapeutic Targets. Hum. Mol. Genet. 2012, 21, R97–R110. [Google Scholar] [CrossRef]
- Plaisier, E.; Gribouval, O.; Alamowitch, S.; Mougenot, B.; Prost, C.; Verpont, M.C.; Marro, B.; Desmettre, T.; Cohen, S.Y.; Roullet, E.; et al. COL4A1 Mutations and Hereditary Angiopathy, Nephropathy, Aneurysms, and Muscle Cramps. N. Engl. J. Med. 2007, 357, 2687–2695. [Google Scholar] [CrossRef]
- Alamowitch, S.; Plaisier, E.; Favrole, P.; Prost, C.; Chen, Z.; Van Agtmael, T.; Marro, B.; Ronco, P. Cerebrovascular Disease Related to COL4A1 Mutations in HANAC Syndrome. Neurology 2009, 73, 1873–1882. [Google Scholar] [CrossRef]
- Labelle-Dumais, C.; Dilworth, D.J.; Harrington, E.P.; De Leau, M.; Lyons, D.; Kabaeva, Z.; Manzini, M.C.; Dobyns, W.B.; Walsh, C.A.; Michele, D.E.; et al. COL4A1 Mutations Cause Ocular Dysgenesis, Neuronal Localization Defects, and Myopathy in Mice and Walker-Warburg Syndrome in Humans. PLoS Genet. 2011, 7, e1002062. [Google Scholar] [CrossRef]
- Guiraud, S.; Migeon, T.; Ferry, A.; Chen, Z.; Ouchelouche, S.; Verpont, M.C.; Sado, Y.; Allamand, V.; Ronco, P.; Plaisier, E. HANAC Col4a1 Mutation in Mice Leads to Skeletal Muscle Alterations due to a Primary Vascular Defect. Am. J. Pathol. 2017, 187, 505–516. [Google Scholar] [CrossRef] [Green Version]
- Parkin, J.D.; San Antonio, J.D.; Pedchenko, V.; Hudson, B.; Jensen, S.T.; Savige, J. Mapping Structural Landmarks, Ligand Binding Sites, and Missense Mutations to the Collagen IV Heterotrimers Predicts Major Functional Domains, Novel Interactions, and Variation in Phenotypes in Inherited Diseases Affecting Basement Membranes. Hum Mutat. 2011, 32, 127–143. [Google Scholar] [CrossRef] [PubMed]
- Plaisier, E.; Chen, Z.; Gekeler, F.; Benhassine, S.; Dahan, K.; Marro, B.; Alamowitch, S.; Paques, M.; Ronco, P. Novel COL4A1 Mutations Associated with HANAC Syndrome: A Role for the Triple Helical CB3[IV] Domain. Am. J. Med. Genet. A 2010, 152A, 2550–2555. [Google Scholar] [CrossRef] [PubMed]
- Rui, Y.; Bai, J.; Perrimon, N. Sarcomere Formation Occurs by the Assembly of Multiple Latent Protein Complexes. PLoS Genet. 2010, 6, e1001208. [Google Scholar] [CrossRef] [PubMed]
- Volk, T.; Fessler, L.I.; Fessler, J.H. A role for integrin in the formation of sarcomeric cytoarchitecture. Cell 1990, 63, 525–536. [Google Scholar] [CrossRef]
- Brown, N.H.; Gregory, S.L.; Rickoll, W.L.; Fessler, L.I.; Prout, M.; White, R.A.; Fristrom, J.W. Talin Is Essential for Integrin Function in Drosophila. Dev. Cell. 2002, 3, 569–579. [Google Scholar] [CrossRef]
- Perkins, A.D.; Ellis, S.J.; Asghari, P.; Shamsian, A.; Moore, E.D.; Tanentzapf, G. Integrin mediated adhesion maintains sarcomeric integrity. Dev. Biol. 2010, 338, 15–27. [Google Scholar] [CrossRef]
- Kelemen-Valkony, I.; Kiss, M.; Csiszar, K.; Mink, M. Inherited Myopathies. In Myopathies: New Research; Washington, H.S., Jimenez, C.E.C., Eds.; Nova Science Publishers: Hauppauge, NY, USA, 2012; ISBN 9781622573721. [Google Scholar]
- Kiss, M.; Kiss, A.A.; Radics, M.; Popovics, N.; Hermesz, E.; Csiszár, K.; Mink, M. Drosophila type IV collagen mutation associates with immune system activation and intestinal dysfunction. Matrix Biol. 2016, 49, 120–131. [Google Scholar] [CrossRef] [Green Version]
- Kiss, A.A.; Popovics, N.; Boldogkői, Z.; Csiszár, K.; Mink, M. 4-Hydroxy-2-nonenal Alkylated and Peroxynitrite Nitrated Proteins Localize to the Fused Mitochondria in Malpighian Epithelial Cells of Type IV Collagen Drosophila Mutants. BioMed Res. Int. 2018, 2018, 3502401. [Google Scholar] [CrossRef]
- Kiss, A.A.; Popovics, N.; Szabó, G.; Csiszár, K.; Mink, M. Altered stress fibers and integrin expression in the Malpighian epithelium of Drosophila type IV collagen mutants. Data Brief 2016, 7, 868–872. [Google Scholar] [CrossRef] [Green Version]
- Kiss, M.; Kelemen-Valkony, I.; Kiss, A.A.; Kiss, B.; Csiszár, K.; Mink, M. Muscle dystrophy is triggered by type IV collagen alleles affecting integrin binding sites directly or indirectly in Drosophila. Acta Biochim. Pol. 2012, 59, 26. [Google Scholar]
- Kiss, A.A.; Somlyai-Popovics, N.; Tubak, V.; Boldogkoi, Z.; Csiszár, K.; Mink, M. Novel Phenotypic Elements of Type IV Collagenopathy Revealed by the Drosophila Model. Appl. Sci. 2019, 9, 2083. [Google Scholar] [CrossRef]
- Hollfelder, D.; Frasch, M.; Reim, I. Distinct functions of the laminin β LN domain and collagen IV during cardiac extracellular matrix formation and stabilization of alary muscle attachments revealed by EMS mutagenesis in Drosophila. BMC Dev. Biol. 2014, 14, 26. [Google Scholar] [CrossRef] [PubMed]
- Jeanne, M.; Gould, D.B. Genotype-phenotype correlations in pathology caused by collagen type IV alpha 1 and 2 mutations. Matrix Biol. 2017, 57–58, 29–44. [Google Scholar] [CrossRef] [PubMed]
- Rahimov, F.; Kunkel, L.M. Cellular and molecular mechanisms underlying muscular dystrophy. J. Cell Biol. 2013, 201, 499–510. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ueyama, M.; Akimoto, Y.; Ichimiya, T.; Ueda, R.; Kawakami, H.; Aigaki, T.; Nishihara, S. Increased Apoptosis of Myoblasts in Drosophila Model for the Walker-Warburg Syndrome. PLoS ONE 2010, 5, e11557. [Google Scholar] [CrossRef]
- Sakai, T.; Li, S.; Docheva, D.; Grashoff, C.; Sakai, K.; Kostka, G.; Braun, A.; Pfeifer, A.; Yurchenco, P.D.; Fässler, R. Integrin-linked kinase (ILK) is required for polarizing the epiblast, cell adhesion, and controlling actin accumulation. Genes Dev. 2003, 17, 926–940. [Google Scholar] [CrossRef] [Green Version]
- Conti, F.J.; Monkley, S.J.; Wood, M.R.; Critchley, D.R.; Müller, U. Talin 1 and 2 are required for myoblast fusion, sarcomere assembly and the maintenance of myotendinous junctions. Development 2009, 136, 3597–3606. [Google Scholar] [CrossRef] [Green Version]
Former Designation | a-30 | b-9 | DTS-L2 | DTS-L3 |
---|---|---|---|---|
Present designation Mutation site | col4a1G233E p.G233E GGA->GAA | col4a1G467E p.G467E GGA->GAA | col4a1G552D1 p.G552D1 GGC->GAC | col4a1G552D2 p.G225D2 GGC->GAC |
Former designation | DTS-L4 | DTS-L5 | DTS-L10 | b-17 |
Present designation Mutation site | col4a1G1025E1 p.G1205E1 GGA->GAA | col4a1G1025E2 p.G1025E2 GGA->GAA | col4a1G1043S p.G1043S GGG->GAG | col4a1G1393E p.G1393E GGA->GAA |
Allele | col4a1G233E | col4a1G467E | col4a1G552D1 | col4a1G552D2 | col4a1G1025E1 | col4a1G1025E2 | col4a1G1043S | col4a1G1393E | OreR, wt |
---|---|---|---|---|---|---|---|---|---|
Sarcomere loss | + | + | + | + | + | + | + | + | - |
Z-disc streaming | + | + | + | + | + | + | + | + | - |
Irregular integrin expression | + | + | + | + | + | + | + | + | - |
Actin bundles | + | + | + | + | + | + | + | + | - |
Amorphic actin deposition | + | + | + | + | + | + | + | + | - |
Atrophy, fibers with D<8 micrometer at 20 °C | 10% | 10% | 14% | 14% | 14% | 18% | 16% | 8% | 30% |
Atrophy, fibers with D<8 micrometer at 29 °C | 28% | 22% | 48% | 36% | 26% | 42% | 36% | 20% | 30% |
Fiber size disproportion | + | + | + | + | + | + | + | + | - |
Uneven COL4A1 expression | + | + | + | + | + | + | + | + | - |
Name | Sequence |
---|---|
F1a | CACGGATAGTGTACATGAGC |
F2a | GCCTTTAGCAAACTCTCTTG |
F3 | TCCTCGTTTCCCGTCAAACC |
F4 | TTCAAGGGCAATGCTGGTGC |
F5 | GGTCTCAATGGTCTGCAAGG |
F6 | TCCCGGAATGGATGGTTTGC |
F7 | GAAGGGTGAACCAGGAATGC |
F8 | TCTGTTGGATACTGCGTAGC |
R1 | CATAGCTCTCTTCGATTGGC |
R2 | CTCCCTTCTGTCCCATATCG |
R3 | CCTTGATACCCATGTCTCCC |
R4 | AAACCAATGGGTCCGGTTGG |
R5 | TCACCAGGATAGCCAACAGC |
R6 | TCTCCCTTAGGTCCATTGCG |
R7 | CGGCAGTGTGCTATTATAGG |
R8 | GCATTGTTTCGCATTTAATCGG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kiss, A.A.; Somlyai-Popovics, N.; Kiss, M.; Boldogkői, Z.; Csiszár, K.; Mink, M. Type IV Collagen Is Essential for Proper Function of Integrin-Mediated Adhesion in Drosophila Muscle Fibers. Int. J. Mol. Sci. 2019, 20, 5124. https://doi.org/10.3390/ijms20205124
Kiss AA, Somlyai-Popovics N, Kiss M, Boldogkői Z, Csiszár K, Mink M. Type IV Collagen Is Essential for Proper Function of Integrin-Mediated Adhesion in Drosophila Muscle Fibers. International Journal of Molecular Sciences. 2019; 20(20):5124. https://doi.org/10.3390/ijms20205124
Chicago/Turabian StyleKiss, András A., Nikoletta Somlyai-Popovics, Márton Kiss, Zsolt Boldogkői, Katalin Csiszár, and Mátyás Mink. 2019. "Type IV Collagen Is Essential for Proper Function of Integrin-Mediated Adhesion in Drosophila Muscle Fibers" International Journal of Molecular Sciences 20, no. 20: 5124. https://doi.org/10.3390/ijms20205124
APA StyleKiss, A. A., Somlyai-Popovics, N., Kiss, M., Boldogkői, Z., Csiszár, K., & Mink, M. (2019). Type IV Collagen Is Essential for Proper Function of Integrin-Mediated Adhesion in Drosophila Muscle Fibers. International Journal of Molecular Sciences, 20(20), 5124. https://doi.org/10.3390/ijms20205124