Identification of Self-Incompatibility Alleles by Specific PCR Analysis and S-RNase Sequencing in Apricot
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. DNA Extraction
4.3. S-RNase Allele Identification by PCR Analysis
4.4. Sequencing of Genomic PCR Products
4.5. Pollination Experiments
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
GSI | Gametophytic Self-Incompatibility System |
SSI | Self-Incompatibility System |
SI | Self-Incompatibility |
References
- Silva, N.F.; Goring, D.R. Mechanisms of self-incompatibility in flowering plants. Cell. Mol. Life Sci. 2007, 58, 1988–2007. [Google Scholar] [CrossRef] [PubMed]
- Barrett, S.C.H. Mating strategies in flowering plants: The outcrossing-selfing paradigm and beyond. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 2003, 358, 991–1004. [Google Scholar] [CrossRef] [PubMed]
- Pandey, K.K. Evolution of Incompatibility Systems in Plants: Origin of “Independent” and “Complementary” Control of Incompatibility in Angiosperms. New Phytol. 1980, 84, 381–400. [Google Scholar] [CrossRef]
- Raduski, A.R.; Haney, E.B.; Igić, B. The expression of self-incompatibility in angiosperms is bimodal. Evolution 2012, 66, 1275–1283. [Google Scholar] [CrossRef] [PubMed]
- Bedinger, P.A.; Broz, A.K.; Tovar-Mendez, A.; McClure, B. Pollen-Pistil Interactions and Their Role in Mate Selection. Plant Physiol. 2017, 173, 79–90. [Google Scholar] [CrossRef] [PubMed]
- De Nettancourt, D. Incompatibility and Incongruity in Wild and Cultivated Plants; Springer-Verlang: Berlin/Heidelberg, Germany, 2001; ISBN 978-3-642-08457-7. [Google Scholar]
- Gibbs, P.E. Late-acting self-incompatibility—The pariah breeding system in flowering plants. New Phytol. 2014, 203, 717–734. [Google Scholar] [CrossRef] [PubMed]
- Barrett, S.C.H. The evolution, maintenance, and loss of self-incompatibility systems. In Plant Reproductive Ecology: Patterns and Strategies; Lovett Doust, J., Lovett Doust, L., Eds.; Oxford University Press: New York, NY, USA, 1988; pp. 84–124. [Google Scholar]
- Hegedűs, A.; Lénárt, J.; Halász, J. Sexual incompatibility in Rosaceae fruit tree species: Molecular interactions and evolutionary dynamics. Biol. Plant. 2012, 56, 201–209. [Google Scholar] [CrossRef]
- Kao, T.; Tsukamoto, T. The Molecular and Genetic Bases of S-RNase-Based Self-Incompatibility. Plant Cell 2004, 16, 72–83. [Google Scholar] [CrossRef] [PubMed]
- Brugière, N.; Rothstein, S.J.; Cui, Y. Molecular mechanisms of self-recognition in Brassica self-incompatibility. Trends Plant Sci. 2000, 5, 432–438. [Google Scholar] [CrossRef]
- Charlesworth, D.; Vekemans, X.; Castric, V.; Glémin, S. Plant self-incompatibility systems: A molecular evolutionary perspective. New Phytol. 2005, 168, 61–69. [Google Scholar] [CrossRef] [PubMed]
- Tao, R.; Yamane, H.; Sassa, H.; Mori, H.; Gradziel, T.M.; Dandekar, A.M.; Sugiura, A. Identification of Stylar RNases Associated with Gametophytic Self-Incompatibility in Almond (Prunus dulcis). Plant Cell Physiol. 1997, 38, 304–311. [Google Scholar] [CrossRef] [PubMed]
- Tao, R.; Iezzoni, A.F. The S-RNase-based gametophytic self-incompatibility system in Prunus exhibits distinct genetic and molecular features. Sci. Hortic. 2010, 124, 423–433. [Google Scholar] [CrossRef]
- Ushijima, K.; Sassa, H.; Dandekar, A.M.; Gradziel, T.M.; Tao, R.; Hirano, H. Structural and Transcriptional Analysis of the Self-Incompatibility Locus of Almond: Identification of a Pollen-Expressed F-Box Gene with Haplotype-Specific Polymorphism. Plant Cell 2003, 15, 771–781. [Google Scholar] [CrossRef] [PubMed]
- Dirlewanger, E.; Graziano, E.; Joobeur, T.; Garriga-Caldere, F.; Cosson, P.; Howad, W.; Arus, P. Comparative mapping and marker-assisted selection in Rosaceae fruit crops. Proc. Natl. Acad. Sci. USA 2004, 101, 9891–9896. [Google Scholar] [CrossRef] [PubMed]
- Burgos, L.; Egea, J.; Guerriero, R.; Viti, R.; Monteleone, P.; Audergon, J.M. The self-compatibility trait of the main apricot cultivars and new selections from breeding programmes. J. Hortic. Sci. 1997, 72, 147–154. [Google Scholar] [CrossRef]
- Hormaza, J.I.; Yamane, H.; Rodrigo, J. Apricot. In Fruits and Nuts: Genome Mapping and Molecular Breeding in Plants, Volume IV; Kole, C., Ed.; Springer-Verlag: Berlin/Heidelberg, Germany; New York, NY, USA, 2007; Volume 4, pp. 171–187. [Google Scholar]
- Zhebentyayeva, T.; Ledbetter, C.; Burgos, L.; Llácer, G. Apricot. In Fruit Breeding; Badenes, M.L., Byrne, D., Eds.; Springer-Verlang: New York, NY, USA, 2012; ISBN 978-1-4419-0762-2. [Google Scholar]
- Rodrigo, J.; Herrero, M.; Hormaza, J.I. Pistil traits and flower fate in apricot (Prunus armeniaca). Ann. Appl. Biol. 2009, 154, 365–375. [Google Scholar] [CrossRef]
- Julian, C.; Herrero, M.; Rodrigo, J. Flower bud differentiation and development in fruiting and non-fruiting shoots in relation to fruit set in apricot (Prunus armeniaca L.). Trees 2010, 24, 833–841. [Google Scholar] [CrossRef]
- Rodrigo, J.; Herrero, M. Effects of pre-blossom temperatures on flower development and fruit set in apricot. Sci. Hortic. 2002, 92, 125–135. [Google Scholar] [CrossRef]
- Hedhly, A.; Hormaza, J.I.; Herrero, M. Effect of temperature on pollen tube kinetics and dynamics in sweet cherry, Prunus avium (Rosaceae). Am. J. Bot. 2004, 91, 558–564. [Google Scholar] [CrossRef] [PubMed]
- Herrera, S.; Lora, J.; Hormaza, J.I.; Herrero, M.; Rodrigo, J. Optimizing Production in the New Generation of Apricot Cultivars: Self-incompatibility, S-RNase Allele Identification, and Incompatibility Group Assignment. Front. Plant Sci. 2018, 9, 527. [Google Scholar] [CrossRef] [PubMed]
- Guerra, M.E.; Rodrigo, J. Japanese plum pollination: A review. Sci. Hortic. 2015, 197, 674–686. [Google Scholar] [CrossRef]
- Nasrallah, J.B.; Kao, T.-H.; Goldberg, M.L.; Nasrallah, M.E. A cDNA clone encoding an S-locus-specific glycoprotein from Brassica oleracea. Nature 1985, 318, 263–267. [Google Scholar] [CrossRef]
- Tao, R.; Yamane, H.; Sugiura, A.; Murayama, H.; Sassa, H.; Mori, H. Molecular Typing of S-alleles through Identification, Characterization and cDNA Cloning for S-RNases in Sweet Cherry. J. Am. Soc. Hortic. Sci. 1999, 124, 224–233. [Google Scholar]
- Tamura, M.; Ushijima, K.; Sassa, H.; Hirano, H.; Tao, R.; Gradziel, T.M.; Dandekar, A.M. Identification of self-incompatibility genotypes of almond by allele-specific PCR analysis. TAG Theor. Appl. Genet. 2000, 101, 344–349. [Google Scholar] [CrossRef]
- Beppu, K.; Yamane, H.; Yaegaki, H.; Yamaguchi, M.; Kataoka, I.; Tao, R. Diversity of S -RNase genes and S -haplotypes in Japanese plum (Prunus salicina Lindl.). J. Hortic. Sci. Biotechnol. 2002, 77, 658–664. [Google Scholar] [CrossRef]
- Beppu, K.; Takemoto, Y.; Yamane, H.; Yaegaki, H.; Yamaguchi, M.; Kataoka, I.; Tao, R. Determination of S-haplotypes of Japanese plum (Prunus salicina Lindl.) cultivars by PCR and cross-pollination tests. J. Hortic. Sci. Biotechnol. 2003, 78, 315–318. [Google Scholar] [CrossRef]
- Sutherland, B.G.; Robbins, T.P.; Tobutt, K.R. Primers amplifying a range of Prunus S-alleles. Plant Breed. 2004, 123, 582–584. [Google Scholar] [CrossRef]
- Halász, J.; Hegedus, A.; Hermán, R.; Stefanovits-Bányai, É.; Pedryc, A. New self-incompatibility alleles in apricot (Prunus armeniaca L.) revealed by stylar ribonuclease assay and S-PCR analysis. Euphytica 2005, 145, 57–66. [Google Scholar] [CrossRef]
- Vilanova, S.; Romero, C.; Llácer, G.; Badenes, M.L. Identification of Self-(in)compatibility Alleles in Apricot by PCR and Sequence Analysis. J. Am. Soc. Hortic. Sci. 2005, 130, 893–898. [Google Scholar]
- Zhang, L.; Chen, X.; Chen, X.; Zhang, C.; Liu, X.; Ci, Z.; Zhang, H.; Wu, C.; Liu, C. Identification of self-incompatibility (S-) genotypes of Chinese apricot cultivars. Euphytica 2008, 160, 241–248. [Google Scholar] [CrossRef]
- Muñoz-Sanz, J.V.; Zuriaga, E.; López, I.; Badenes, M.L.; Romero, C. Self-(in)compatibility in apricot germplasm is controlled by two major loci, S and M. BMC Plant Biol. 2017, 17, 82. [Google Scholar] [CrossRef] [PubMed]
- Murathan, Z.T.; Kafkas, S.; Asma, B.M.; Topçu, H. S_allele identification and genetic diversity analysis of apricot cultivars. J. Hortic. Sci. Biotechnol. 2017, 92, 251–260. [Google Scholar] [CrossRef]
- Szabó, Z.; Nyéki, J. Blossoming, fructification and combination of apricot varieties. Acta Hortic. 1991, 293, 295–302. [Google Scholar] [CrossRef]
- Egea, J.; Burgos, L. Detecting Cross-incompatibility of Three North American Apricot Cultivars and Establishing the First Incompatibility Group in Apricot. J. Am. Soc. Hortic. Sci. 1996, 121, 1002–1005. [Google Scholar]
- Halász, J.; Pedryc, A.; Ercisli, S.; Yilmaz, K.U.; Hegedűs, A. S-genotyping supports the genetic relationships between Turkish and Hungarian apricot germplasm. J. Am. Soc. Hortic. Sci. 2010, 135, 410–417. [Google Scholar]
- Lachkar, A.; Fattouch, S.; Ghazouani, T.; Halasz, J.; Pedryc, A.; Hegedüs, A.; Mars, M. Identification of self-(in)compatibility S- alleles and new cross-incompatibility groups in Tunisian apricot (Prunus armeniaca L.) cultivars. J. Hortic. Sci. Biotechnol. 2013, 88, 497–501. [Google Scholar] [CrossRef]
- Romero, C.; Vilanova, S.; Burgos, L.; Martínez-Calvo, J.; Vicente, M.; Llácer, G.; Badenes, M.L. Analysis of the S-locus structure in Prunus armeniaca L. Identification of S-haplotype specific S-RNase and F-box genes. Plant Mol. Biol. 2004, 56, 145–157. [Google Scholar] [CrossRef] [PubMed]
- Feng, J.; Chen, X.; Wu, Y.; Liu, W.; Liang, Q.; Zhang, L. Detection and transcript expression of S-RNase gene associated with self-incompatibility in apricot (Prunus armeniaca L.). Mol. Biol. Rep. 2006, 33, 215–221. [Google Scholar] [CrossRef] [PubMed]
- Halász, J.; Pedryc, A.; Hegedus, A. Origin and dissemination of the pollen-part mutated Sc haplotype which confers self-compatibility in apricot (Prunus armeniaca). New Phytol. 2007, 176, 792–803. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Gu, C.; Zhang, S.L.; Zhang, S.J.; Wu, H.Q.; Heng, W. Identification of s-haplotype-specific S-RNase and SFB alleles in native Chinese apricot (Prunus armeniaca L.). J. Hortic. Sci. Biotechnol. 2009, 84, 645–652. [Google Scholar] [CrossRef]
- Egea, J.; Ruiz, D.; Burgos, L. “ Dorada ” Apricot. HortScience 2005, 40, 1919–1920. [Google Scholar]
- Egea, J.; Ruiz, D.; Dicenta, F.; Burgos, L. “ Murciana ” Apricot. HortScience 2005, 40, 254–255. [Google Scholar]
- Mehlenbacher, S.A.; Cociu, V.; Hough, F.L. Apricots (Prunus). Acta Hortic. 1991, 290, 65–110. [Google Scholar] [CrossRef]
- Alburquerque, N.; Egea, J.; Pérez-Tornero, O.; Burgos, L. Genotyping apricot cultivars for self-(in)compatibility by means of RNases associated with S-alleles. Plant Breed. 2002, 121, 343–347. [Google Scholar] [CrossRef]
- i Company, R.S.; Kodad, O.; i Martí, A.F.; Alonso, J.M. Mutations conferring self-compatibility in Prunus species: From deletions and insertions to epigenetic alterations. Sci. Hortic. 2015, 192, 125–131. [Google Scholar] [CrossRef]
- Vilanova, S.; Badenes, M.L.; Burgos, L.; Martínez-Calvo, J.; Llácer, G.; Romero, C. Self-Compatibility of Two Apricot Selections Is Associated with Two Pollen-Part Mutations of Different Nature. Plant Physiol. 2006, 142, 629–641. [Google Scholar] [CrossRef] [PubMed]
- Kodad, O.; Hegedűs, A.; Halász, J. Self-(in)compatibility genotypes of Moroccan apricots indicate differences and similarities in the crop history of European and North African apricot germplasm. BMC Plant Biol. 2013, 13, 196. [Google Scholar] [CrossRef] [PubMed]
- Hormaza, J.I. Molecular characterization and similarity relationships among apricot (Prunus armeniaca L.) genotypes using simple sequence repeats. Theor. Appl. Genet. 2002, 104, 321–328. [Google Scholar] [CrossRef] [PubMed]
- Sonneveld, T.; Tobutt, K.R.; Robbins, T.P. Allele-specific PCR detection of sweet cherry self-incompatibility (S) alleles S1 to S16 using consensus and allele-specific primers. Theor. Appl. Genet. 2003, 107, 1059–1070. [Google Scholar] [CrossRef] [PubMed]
- Zuriaga, E.; Muñoz-Sanz, J.V.; Molina, L.; Gisbert, A.D.; Badenes, M.L.; Romero, C. An S-Locus Independent Pollen Factor Confers Self-Compatibility in “Katy” Apricot. PLoS ONE 2013, 8, e53947. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Pastor, A.; Ruiz-Sánchez, M.C.; Domingo, R.; Torrecillas, A. Growth and phenological stages of Búlida apricot trees in south-east Spain. Agronomie 2004, 24, 93–100. [Google Scholar] [CrossRef]
- Rodrigo, J.; Herrero, M. Evaluation of pollination as the cause of erratic fruit set in apricot “Moniqui”. J. Hortic. Sci. 1996, 71, 801–805. [Google Scholar] [CrossRef]
- Williams, J.H.; Friedman, W.E.; Arnold, M.L. Developmental selection within the angiosperm style: Using gamete DNA to visualize interspecific pollen competition. Proc. Natl. Acad. Sci. USA 1999, 96, 9201–9206. [Google Scholar] [CrossRef] [PubMed]
- Hormaza, J.I.; Pinney, K.; Polito, V.S. Correlation in the tolerance to ozone between sporophytes and male gametophytes of several fruit and nut tree species (Rosaceae). Sex. Plant Reprod. 1996, 9, 44–48. [Google Scholar] [CrossRef]
- Jefferies, C.J.; Belcher, A.R. A Fluorescent Brightener used for Pollen Tube Identification In Vivo. Stain Technol. 1974, 49, 199–202. [Google Scholar] [CrossRef] [PubMed]
- Linskens, H.F.; Esser, K. Über eine spezifische Anfärbung der Pollenschläuche im Griffel und die Zahl der Kallosepfropfen nach Selbstung und Fremdung. Naturwissenschaften 1957, 44, 16. [Google Scholar] [CrossRef]
- Burgos, L.; Berenguer, T.; Egea, J. Self- and Cross-compatibility among Apricot Cultivars. HortScience 1993, 28, 148–150. [Google Scholar]
Incompatibility Group | S-RNase Genotype | Apricot Genotypes Analyzed in this Study |
---|---|---|
I | S1S2 | T069 |
T120 | ||
T139A | ||
II | S8S9 | C007 1 |
V | S2S8 | C012 1 |
VIII | S6S9 | Cheyenne |
T001 | ||
XVIII | S1S3 | A150 |
XXII | S3S9 | A153 |
Kosmos | ||
XXIV 2 | S1S6 | Primaya |
XXV 2 | S1S9 | A106 |
XXVI 2 | S6S8 | C009 1 |
Self-compatible cultivars | S2Sc | Kalao |
Regibus | ||
S3Sc | C014 1 | |
Rambo | ||
S4Sc | T002 | |
S7Sc | Beliana | |
S9Sc | C003 1 | |
Lido | ||
Sc | Dorada | |
Memphis | ||
Milord | ||
Murciana | ||
Oscar | ||
Sherpa | ||
T003 | ||
S1 | A154 | |
T004 | ||
T005 | ||
T109 | ||
T124 | ||
T139B | ||
T140 | ||
S2 | Cyrano | |
T098 | ||
S3 | Mikado | |
T006 | ||
S7 | T116 | |
S9 | A151 | |
A152 | ||
A155 | ||
S20 | T007 |
Primers | Amplified Region | Sequence (5′ → 3′) | Reference |
---|---|---|---|
SRc-F | S-RNase 1st intron | CTCGCTTTCCTTGTTCTTGC | [41] |
SRc-R | S-RNase 1st intron | GGCCATTGTTGCACCCCTTG | [41] |
Pru-C2 | S-RNase 2nd intron | CTTTGGCCAAGTAATTATTCAAACC | [27] |
Pru-C4R | S-RNase 2nd intron | GGATGTGGTACGATTGAAGCG | [27] |
AprFBC8-F | SFB | CATGGAAAAAGCTGACTTATGG | [39] |
AprFBC8-R | SFB | GCCTCTAATGTCATCTACTCTTAG | [39] |
SHLM1-F 1 | S1-RNase 2nd intron | GGTGGAGGTGATAAGGTAGCC | |
SHLM2-R 1 | S1-RNase 2nd intron | GGCTGCATAAGGAAGCTGTAGG | |
SHLM3-F 1 | S7-RNase 2nd intron | TATATCTTACTCTTTGGC | |
SHLM4-R 1 | S7-RNase 2nd intron | CACTATGATAATGTGTATG |
Cultivar | Number of Pistils Examined | Pistils (%) with Pollen Tubes | Percentage of Style Travelled by the Longest Pollen Tube | Mean Number of Pollen Tubes at the Base of the Style | Compatible (C) or Incompatible (I) Behavior | ||
---|---|---|---|---|---|---|---|
in the Middle of the Style | at the Base of the Style | Reaching the Ovule | |||||
Self-pollination | |||||||
C003 | 10 | 100 | 90 | 80 | 100 | 2 | C |
C014 | 18 | 100 | 94 | 83 | 100 | 2.1 | C |
C007 | 8 | 75 | 0 | 0 | 57 | 0 | I |
C009 | 10 | 60 | 0 | 0 | 56 | 0 | I |
C012 | 9 | 100 | 0 | 0 | 66 | 0 | I |
Cross-pollination | |||||||
C003 × Katy | 18 | 100 | 78 | 78 | 100 | 1 | C |
C014 × Katy | 5 | 100 | 100 | 100 | 100 | 3.4 | C |
C007 × Katy | 5 | 100 | 80 | 80 | 100 | 1 | C |
C009 × Katy | 5 | 100 | 80 | 80 | 100 | 1.6 | C |
C012 × Katy | 4 | 100 | 100 | 100 | 100 | 1.5 | C |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Herrera, S.; Rodrigo, J.; Hormaza, J.I.; Lora, J. Identification of Self-Incompatibility Alleles by Specific PCR Analysis and S-RNase Sequencing in Apricot. Int. J. Mol. Sci. 2018, 19, 3612. https://doi.org/10.3390/ijms19113612
Herrera S, Rodrigo J, Hormaza JI, Lora J. Identification of Self-Incompatibility Alleles by Specific PCR Analysis and S-RNase Sequencing in Apricot. International Journal of Molecular Sciences. 2018; 19(11):3612. https://doi.org/10.3390/ijms19113612
Chicago/Turabian StyleHerrera, Sara, Javier Rodrigo, José I. Hormaza, and Jorge Lora. 2018. "Identification of Self-Incompatibility Alleles by Specific PCR Analysis and S-RNase Sequencing in Apricot" International Journal of Molecular Sciences 19, no. 11: 3612. https://doi.org/10.3390/ijms19113612
APA StyleHerrera, S., Rodrigo, J., Hormaza, J. I., & Lora, J. (2018). Identification of Self-Incompatibility Alleles by Specific PCR Analysis and S-RNase Sequencing in Apricot. International Journal of Molecular Sciences, 19(11), 3612. https://doi.org/10.3390/ijms19113612