Association of Genetic Polymorphisms of Renin–Angiotensin–Aldosterone System-Related Genes with Arterio-Venous Fistula Malfunction in Hemodialysis Patients
Abstract
:1. Introduction
2. Results
2.1. Patient Characteristics
2.2. Univariate Analysis of the Risk Factor of AVF Malfunction
2.2.1. Clinical and Genetic Risk Factor of AVF Malfunction in all Study Subjects
2.2.2. Clinical and Genetic Risk Factor of AVF Malfunction in Female Study Subjects
2.2.3. Clinical and Genetic Risk Factor of AVF Malfunction in Male Study Subjects
2.3. Multivariate Analysis of Risk Factors of AVF Malfunction in Male HD Patients
3. Discussion
3.1. AVF Malfunction, HD Characteristics and Comorbidities
3.2. Genetic Risk Factors of AVF Malfunction
3.3. Limitations
4. Materials and Methods
4.1. Study Subjects
4.2. DNA Isolation and Genotyping of Renin-Angiotensin-Aldosterone System-Related Genes
4.3. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
| ACE | Angiotensin converting enzyme |
| ACE-I | Angiotensin converting enzyme inhibitor |
| AGT | Angiotensinogen |
| AGTR-1/2 | Angiotensin II receptor 1/2 |
| ARB | Angiotensin receptor blocker |
| AVF | Arterio-venous fistula |
| CI | Confidence interval |
| ESRD | End stage renal disease |
| HTN | Hypertension |
| HD | Hemodialysis |
| HIF-1α | Hypoxia inducible factor-1α |
| HO-1 | Heme oxygenase-1 |
| MMPs | Matrix metalloproteinases |
| MTHFR | Methylene tetrahydrofolate reductase |
| NIH | Neo-intimal hyperplasia |
| OR | Odds ratio |
| PRMT1 | Protein arginine methyltransferase 1 |
| RAAS | Renin-angiotensin-aldosterone system |
| RRT | Renal replacement therapy |
| SNP | Single nucleotide polymorphism |
| TGF-β1 | Transforming growth factor-β1 |
| VEGF-A | Vascular endothelial growth factor-A |
| VEGFR-1/2 | Vascular endothelial growth factor receptor-1/2 |
References
- Abouchacra, S.; Chaaban, A.; Sajwani, S.; Bashir, M.; Beghdash, O.; Abdulle, A. Encapsulating peritoneal sclerosis: A rare complication of peritoneal dialysis in Al-ain, United Arab Emirates. Case Rep. Nephrol. Urol. 2013, 3, 22–27. [Google Scholar] [CrossRef] [PubMed]
- Astor, B.C.; Eustace, J.A.; Powe, N.R.; Klag, M.J.; Fink, N.E.; Coresh, J. Type of vascular access and survival among incident hemodialysis patients: The Choices for Healthy Outcomes in Caring for ESRD (CHOICE) Study. J. Am. Soc. Nephrol. 2005, 16, 1449–1455. [Google Scholar] [CrossRef] [PubMed]
- Girndt, M.; Heine, G.H.; Ulrich, C.; Kohler, H. Gene polymorphism association studies in dialysis: Vascular access. Semin. Dial. 2007, 20, 63–67. [Google Scholar] [CrossRef] [PubMed]
- Misra, S.; Shergill, U.; Yang, B.; Janardhanan, R.; Misra, K.D. Increased expression of HIF-1α, VEGF-A and its receptors, MMP-2, TIMP-1, and ADAMTS-1 at the venous stenosis of arteriovenous fistula in a mouse model with renal insufficiency. J. Vasc. Interv. Radiol. (JVIR) 2010, 21, 1255–1261. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.C.; Yang, W.C.; Lin, S.J.; Chen, T.W.; Lee, W.S.; Chang, C.F.; Lee, P.C.; Lee, S.D.; Su, T.S.; Fann, C.S.; et al. Length polymorphism in heme oxygenase-1 is associated with arteriovenous fistula patency in hemodialysis patients. Kidney Int. 2006, 69, 165–172. [Google Scholar] [CrossRef] [PubMed]
- Heine, G.H.; Ulrich, C.; Kohler, H.; Girndt, M. Is AV fistula patency associated with angiotensin-converting enzyme (ACE) polymorphism and ACE inhibitor intake? Am. J. Nephrol. 2004, 24, 461–468. [Google Scholar] [CrossRef] [PubMed]
- Gungor, Y.; Kayatas, M.; Yildiz, G.; Ozdemir, O.; Candan, F. The presence of PAI-1 4G/5G and ACE DD genotypes increases the risk of early-stage AVF thrombosis in hemodialysis patients. Renal Fail. 2011, 33, 169–175. [Google Scholar] [CrossRef] [PubMed]
- Lynch, A.I.; Arnett, D.K.; Davis, B.R.; Boerwinkle, E.; Ford, C.E.; Eckfeldt, J.H.; Leiendecker-Foster, C. Sex-Specific Effects of AGT-6 and ACE I/D on Pulse Pressure After 6 Months on Antihypertensive Treatment: The GenHAT Study. Ann. Hum. Genet. 2007, 71, 735–745. [Google Scholar] [CrossRef] [PubMed]
- Hadjadj, S.; Tarnow, L.; Forsblom, C.; Kazeem, G.; Marre, M.; Groop, P.H.; Parving, H.H.; Cambien, F.; Tregouet, D.A.; Gut, I.G.; et al. Association between angiotensin-converting enzyme gene polymorphisms and diabetic nephropathy: Case-control, haplotype, and family-based study in three European populations. J. Am. Soc. Nephrol. 2007, 18, 1284–1291. [Google Scholar] [CrossRef] [PubMed]
- Ezzidi, I.; Mtiraoui, N.; Kacem, M.; Chaieb, M.; Mahjoub, T.; Almawi, W.Y. Identification of specific angiotensin-converting enzyme variants and haplotypes that confer risk and protection against type 2 diabetic nephropathy. Diabetes Metab. Res. Rev. 2009, 25, 717–724. [Google Scholar] [CrossRef] [PubMed]
- Domingues-Montanari, S.; Fernandez-Cadenas, I.; Del Rio-Espinola, A.; Mendioroz, M.; Ribo, M.; Obach, V.; Marti-Fabregas, J.; Freijo, M.; Serena, J.; Corbeto, N.; et al. The I/D polymorphism of the ACE1 gene is not associated with ischaemic stroke in Spanish individuals. Eur. J. Neurol. 2010, 17, 1390–1392. [Google Scholar] [CrossRef] [PubMed]
- Mendelsohn, M.E.; Karas, R.H. The protective effects of estrogen on the cardiovascular system. N. Engl. J. Med. 1999, 340, 1801–1811. [Google Scholar] [CrossRef]
- Konner, K.; Hulbert-Shearon, T.E.; Roys, E.C.; Port, F.K. Tailoring the initial vascular access for dialysis patients. Kidney Int. 2002, 62, 329–338. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.H.; Tsai, W.J.; Chen, Y.W.; Yang, W.C.; Lee, C.Y.; Ou, S.M.; Chen, Y.T.; Chien, C.C.; Lee, P.C.; Chung, M.Y.; et al. Genotype polymorphisms of genes regulating nitric oxide synthesis determine long-term arteriovenous fistula patency in male hemodialysis patients. Renal Fail. 2016, 38, 228–237. [Google Scholar] [CrossRef] [PubMed]
- Tien, K.J.; Hsiao, J.Y.; Hsu, S.C.; Liang, H.T.; Lin, S.R.; Chen, H.C.; Hsieh, M.C. Gender-dependent effect of ACE I/D and AGT M235T polymorphisms on the progression of urinary albumin excretion in Taiwanese with type 2 diabetes. Am. J. Nephrol. 2009, 29, 299–308. [Google Scholar] [CrossRef] [PubMed]
- Domingues-Montanari, S.; Mendioroz, M.; del Rio-Espinola, A.; Fernandez-Cadenas, I.; Montaner, J. Genetics of stroke: A review of recent advances. Expert Rev. Mol. Diagn. 2008, 8, 495–513. [Google Scholar] [CrossRef] [PubMed]
- Moon, J.Y.; Jeong, K.H.; Paik, S.S.; Han, J.J.; Lee, S.H.; Lee, T.W.; Ihm, C.G.; Kim, M.J.; Chung, J.H. Arteriovenous fistula patency associated with angiotensin-converting enzyme I/D polymorphism and ACE inhibition or AT1 receptor blockade. Nephron Clin. Pract. 2009, 111, c110–c116. [Google Scholar] [CrossRef] [PubMed]
- Sotoodehnia, N.; Li, G.; Johnson, C.O.; Lemaitre, R.N.; Rice, K.M.; Rea, T.D.; Siscovick, D.S. Genetic variation in angiotensin-converting enzyme-related pathways associated with sudden cardiac arrest risk. Heart Rhythm 2009, 6, 1306–1314. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Rodriguez, N.; Posadas-Romero, C.; Cardoso, G.; Perez-Rodriguez, J.M.; Perez-Hernandez, N.; Vallejo, M.; Vargas-Alarcon, G. Association of angiotensin II type 1-receptor gene polymorphisms with the risk of developing hypertension in Mexican individuals. J. Renin-Angiotensin-Aldosterone Syst. (JRAAS) 2012, 13, 133–140. [Google Scholar] [CrossRef] [PubMed]
- Benigni, A.; Orisio, S.; Noris, M.; Iatropoulos, P.; Castaldi, D.; Kamide, K.; Rakugi, H.; Arai, Y.; Todeschini, M.; Ogliari, G.; et al. Variations of the angiotensin II type 1 receptor gene are associated with extreme human longevity. Age 2013, 35, 993–1005. [Google Scholar] [CrossRef] [PubMed]
- Baudin, B. Polymorphism in angiotensin II receptor genes and hypertension. Exp. Physiol. 2005, 90, 277–282. [Google Scholar] [CrossRef] [PubMed]
- Abdollahi, M.R.; Gaunt, T.R.; Syddall, H.E.; Cooper, C.; Phillips, D.I.W.; Ye, S.; Day, I.N.M. Angiotensin II type I receptor gene polymorphism: Anthropometric and metabolic syndrome traits. J. Med. Genet. 2005, 42, 396–401. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.X.; Zhang, Y.Q.; Hu, B.; Zhang, J.; Zhao, Q. Association of AT1R polymorphism with hypertension risk: An update meta-analysis based on 28,952 subjects. J. Renin-Angiotensin-Aldosterone Syst. (JRAAS) 2015, 16, 898–909. [Google Scholar] [CrossRef] [PubMed]
- Wijpkema, J.S.; van Haelst, P.L.; Monraats, P.S.; Bruinenberg, M.; Zwinderman, A.H.; Zijlstra, F.; van der Steege, G.; de Winter, R.J.; Doevendans, P.A.; Waltenberger, J.; et al. Restenosis after percutaneous coronary intervention is associated with the angiotensin-II type-1 receptor 1166A/C polymorphism but not with polymorphisms of angiotensin-converting enzyme, angiotensin-II receptor, angiotensinogen or heme oxygenase-1. Pharm. Genom. 2006, 16, 331–337. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Chen, F.; Zhang, X.; Gao, Y.; Wu, C.; Li, H.; Zhang, Y. Angiotensin type 1 receptor A1166C gene polymorphism is associated with endothelial dysfunction and in-stent restenosis after percutaneous coronary intervention. Int. J. Clin. Exp. Pathol. 2015, 8, 7350–7357. [Google Scholar] [PubMed]
- Wassmann, S.; Nickenig, G. Pathophysiological regulation of the AT1-receptor and implications for vascular disease. J. Hypertens. 2006, 24, S15–S21. [Google Scholar] [CrossRef] [PubMed]
- Paul, M.; Poyan Mehr, A.; Kreutz, R. Physiology of local renin-angiotensin systems. Physiol. Rev. 2006, 86, 747–803. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, H.; Suzuki, H.; Ohtsu, H.; Chao, J.Y.; Utsunomiya, H.; Frank, G.D.; Eguchi, S. Angiotensin II regulates vascular and endothelial dysfunction: Recent topics of Angiotensin II type-1 receptor signaling in the vasculature. Curr. Vasc. Pharmacol. 2006, 4, 67–78. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Maric, C.; Roesch, D.M.; Zheng, W.; Verbalis, J.G.; Sandberg, K. Estrogen regulates adrenal angiotensin AT1 receptors by modulating AT1 receptor translation. Endocrinology 2003, 144, 3251–3261. [Google Scholar] [CrossRef] [PubMed]
- Komukai, K.; Mochizuki, S.; Yoshimura, M. Gender and the renin-angiotensin-aldosterone system. Fundam. Clin. Pharmacol. 2010, 24, 687–698. [Google Scholar] [CrossRef] [PubMed]
- Daemen, M.; Lombardi, D.; Bosman, F.; Schwartz, S. Angiotensin II induces smooth muscle cell proliferation in the normal and injured rat arterial wall. Circ. Res. 1991, 68, 450–456. [Google Scholar] [CrossRef] [PubMed]
- Salanti, G.; Amountza, G.; Ntzani, E.E.; Ioannidis, J.P. Hardy-Weinberg equilibrium in genetic association studies: An empirical evaluation of reporting, deviations, and power. Eur. J. Hum. Genet. (EJHG) 2005, 13, 840–848. [Google Scholar] [CrossRef] [PubMed]
| Characteristic | Malfunction (n = 154) | No Malfunction (n = 423) | p Value |
|---|---|---|---|
| Age (years) | 60.7 ± 16.1 | 59.8 ± 14.0 | 0.517 |
| Gender (%) | |||
| Male | 55.2 | 52.2 | 0.531 |
| Female | 44.8 | 47.8 | |
| HD duration (months) | 92.5 ± 68.1 | 61.2 ± 51.9 | <0.001 |
| Smoking (%) | 11.7 | 9.5% | 0.432 |
| Hypertension (%) | 44.8 | 55.3 | 0.025 |
| Diabetes mellitus (%) | 26.1 | 31.9 | 0.173 |
| Cerebrovascular accidents (%) | 11.0 | 7.3 | 0.192 |
| Peripheral arterial disease (%) | 5.2 | 4.0 | 0.540 |
| Coronary artery disease (%) | 23.0 | 20.2 | 0.462 |
| ACE inhibitor (%) | 9.7 | 11.1 | 0.643 |
| ARB (angiotensin II receptor blocker) (%) | 14.9 | 18.0 | 0.391 |
| Site of AVF (%) | |||
| Right side | 31.8 | 18.4 | 0.002 |
| Left side | 68.2 | 81.6 | |
| Location of AVF (%) | |||
| Forearm | 73.4 | 90.3 | <0.001 |
| Upper arm | 26.6 | 9.7 | |
| Dynamic venous pressure (mmHg) under pump flow at 250 mL/min | 147.8 ± 28.3 | 139.8 ± 30.0 | 0.021 |
| Pre-dialytic mean arterial blood pressure (mmHg) | 104.8 ± 17.6 | 109.7 ± 19.1 | 0.109 |
| Post-dialytic mean arterial blood pressure (mmHg) | 92.8 ± 14.4 | 96.6 ± 15.1 | 0.184 |
| KT/V | 1.38 ± 0.13 | 1.49 ± 0.15 | 0.113 |
| URR (urea reduction rate) (%) | 73 ± 4.9 | 76 ± 5.2 | 0.124 |
| Maximal pump flow (mL/min) | 268.6 ± 29.3 | 274.5 ± 36.3 | 0.106 |
| Gene | SNP Name Position | Chromosome Position | Genotyping Method | Primer | Sequence (5′ to 3′) | Allele * |
|---|---|---|---|---|---|---|
| AGT | rs7079 exon5 (c. +1866) | chr1:230838331 | TaqMan Allelic discrimination | Forward | TGAAAGATGCAAGCACCTGAA | C/A * |
| Reverse | TTGGAGGCTTATTGTGGCAAG | |||||
| rs11568056 Intron (IVS2-551) | chr1:230842497 | RFLP-PCR | Forward | GACAGCTGGTGGGCTCTG | G/A * | |
| Reverse | (6Fam)-CAAAGGCTGTGGTTTGACAC | |||||
| rs6687360 Intron (IVS2+749) | chr1:230844992 | RFLP-PCR | Forward | (6Fam)-GTGCCATCATTGCTCACTGT | T/C * | |
| Reverse | GGCCTATACAGCCCTCCTCT | |||||
| rs4762 Non-synonymous 207 T>M Exon2, c. +620 | chr1:230845977 | RFLP-PCR | Forward | (6Fam)-CTACAGGCAATCCTGGGTGT | C/T * | |
| Reverse | AGGCCTGACTGGCTGATCT | |||||
| rs11568028 Intron (IVS1-645) | chr1:230847244 | RFLP-PCR | Forward | (6Fam)-GGACCACAGGGAGATGACAA | G/A * | |
| Reverse | ATGAGGCCATGAGGGTGA | |||||
| rs3789678 Intron (IVS1+350) | chr1:230849482 | RFLP-PCR | Forward | GGACAAGATGGTCAGGTCTTC | C/T * | |
| Reverse | (6Fam)-TCCCAAAGCTTAGAAAGCACT | |||||
| rs5051 5′-UTR (Exon 1, g. +172, c. −41) -6A>G | chr1:230849872 | RFLP-PCR | Forward | GTCCTTCTGGCCAGCCTGT | T/C * | |
| Reverse | (6Fam)-CGGCCTTTTCCTCCTAGC | |||||
| ACE | rs4295 Intron (IVS2-70) | chr17:61556298 | RFLP-PCR | Forward | (6Fam)-CTGTCCCCCACTCCACAG | C/G * |
| Reverse | GACCCTACACAACTGCATGG | |||||
| rs4340 Intron (Intron 16) | chr17:61565893 | Fragment length analysis | Forward | (6Fam)-GTAAGCCACTGCTGGAGAGC | I/D * | |
| Reverse | CCAGCCCTTAGCTCACCTCT | |||||
| rs10853044 3′-UTR (Exon17, c. +5150) | chr17:61586549 | RFLP-PCR | Forward | TGGCTAAAGGGTGAGATGGTG | T/C * | |
| Reverse | (6Fam)-CAGGGACAGACAGGCCAAG | |||||
| AGTR1 | rs409742 Upstream (g. −3294) | chr3:148412365 | RFLP-PCR | Forward | TTCCCACCAACAATATATGAGG | T/C * |
| Reverse | (6Fam)-AAACGTAGGAGTAAACCTTTGTTACC | |||||
| rs275653 Promotor (g. −113) −153A>G | chr3:148415545 | TaqMan Allelic discrimination | Forward | TGAACGCTGATCTGATAGTTGACA | A/G * | |
| Reverse | ACGAGGCTCTGTTTTGCATTC | |||||
| rs10935724 Intron (IVS1-4477) | chr3:148421253 | RFLP-PCR | Forward | CATTTTAGCAAAATCCTCAGGTG | A/C * | |
| Reverse | (6Fam)-CAGCTTTTGGGTAAACTACTTATCTC | |||||
| rs1492099 Intron (IVS2+11689) | chr3:148437503 | RFLP-PCR | Forward | (6Fam)-GCCTGTGCTGTTCTCAGGTT | G/A * | |
| Reverse | AACTTTAAATGTTTTACAGATCCAAAT | |||||
| rs385338 Intron (IVS2-9620) | chr3:148449156 | RFLP-PCR | Forward | (6Fam)-TTTCTTTTGGACAGCACTGAA | C/G * | |
| Reverse | AATGCAAGGGTAAGTAAAATGAA | |||||
| rs5182 Synonymous coding (Exon3, c. +573) | chr3:148459395 | RFLP-PCR | Forward | (6Fam)-CATCATCATTTGGCTGCTG | T/C * | |
| Reverse | CGTGTCCACAATATCTGCAA | |||||
| rs5186 3′-UTR (Exon3, c. 1166) 1166A>C | chr3:148459988 | RFLP-PCR | Forward | GAGAACATTCCTCTGCAGCAC | A/C * | |
| Reverse | (6Fam)-GAGCAGCCGTCATCTGTCTA | |||||
| AGTR2 | rs1403543 Intron (IVS1-29, g. 218) 1675A>G | chrX:115302192 | TaqMan Allelic discrimination | Forward | GCAGCCTGAATTTTGAAGGT | A/G * |
| Reverse | TCCACTTGAAGACTTACTGGTTGT | |||||
| rs11091046 3′-UTR (Exon 3, c. +1593) 3123A>C | chrX:115305126 | RFLP-PCR | Forward | (6Fam)-CATTGCATCATTTACAAGACAACA | C/A * | |
| Reverse | ACTGTAAAAATAAGCTAAAGCATAGGA | |||||
| rs12840631 Downstream (g. +4317) | chrX:115306351 | TaqMan Allelic discrimination | Forward | TGTATCCTCCATTTTATCTCCACTGA | C/G * | |
| Reverse | AGCTAATGGGAAATTATGGCTCAA |
| Clinical or Genetic Factors | Odds Ratio | 95% CI Lower | 95% CI Upper | Significance |
|---|---|---|---|---|
| Age (year) | 1.005 | 0.992 | 1.018 | 0.488 |
| Right side vs. left side | 2.064 | 1.358 | 3.138 | 0.001 * |
| Upper arm vs. forearm | 3.381 | 2.090 | 5.469 | <0.001 * |
| Hypertension | 0.656 | 0.452 | 0.950 | 0.026 * |
| Diabetes mellitus | 0.755 | 0.499 | 1.143 | 0.184 |
| Coronary artery disease | 1.183 | 0.757 | 1.848 | 0.462 |
| Peripheral artery disease | 1.309 | 0.553 | 3.097 | 0.541 |
| Cerebrovascular accident | 1.569 | 0.842 | 2.925 | 0.156 |
| Dynamic venous pressure (mmHg) | 1.011 | 1.005 | 1.018 | <0.001 * |
| AGT | ||||
| rs7079 | 1.781 | 0.623 | 5.093 | 0.282 |
| rs11568056 | 1.003 | 0.649 | 1.548 | 0.990 |
| rs6687360 | 1.205 | 0.824 | 1.761 | 0.336 |
| rs4762 | 0.660 | 0.398 | 1.092 | 0.106 |
| rs11568028 | 0.854 | 0.570 | 1.278 | 0.442 |
| rs3789678 | 1.012 | 0.638 | 1.605 | 0.960 |
| rs5051 | 0.922 | 0.609 | 1.398 | 0.703 |
| ACE | ||||
| rs4295 | 1.303 | 0.833 | 2.036 | 0.246 |
| rs4340 | 1.369 | 0.937 | 2.001 | 0.105 |
| rs10853044 | 1.138 | 0.690 | 1.876 | 0.612 |
| AGTR1 | ||||
| rs409742 | 1.233 | 0.727 | 2.093 | 0.437 |
| rs275653 | 1.393 | 0.881 | 2.203 | 0.157 |
| rs10935724 | 0.902 | 0.596 | 1.366 | 0.626 |
| rs1492099 | 1.437 | 0.846 | 2.441 | 0.180 |
| rs385338 | 1.119 | 0.743 | 1.686 | 0.591 |
| rs5182 | 1.285 | 0.852 | 1.937 | 0.231 |
| rs5186 | 0.729 | 0.374 | 1.421 | 0.353 |
| AGTR2 | ||||
| rs1403543 | 1.014 | 0.699 | 1.472 | 0.940 |
| rs11091046 | 0.970 | 0.652 | 1.444 | 0.882 |
| rs12840631 | 1.105 | 0.726 | 1.684 | 0.641 |
| Clinical or Genetic Factors | Odds Ratio | 95% CI Lower | 95% CI Upper | Significance |
|---|---|---|---|---|
| Age (year) | 0.991 | 0.972 | 1.011 | 0.386 |
| Right side vs. left side | 0.766 | 0.406 | 1.445 | 0.411 |
| Upper arm vs. forearm | 2.690 | 1.371 | 5.279 | 0.004 * |
| Hypertension | 0.606 | 0.348 | 1.055 | 0.077 |
| Diabetes mellitus | 0.664 | 0.342 | 1.287 | 0.225 |
| Coronary artery disease | 0.933 | 0.455 | 1.912 | 0.850 |
| Peripheral artery disease | 0.832 | 0.169 | 4.101 | 0.821 |
| Cerebrovascular accident | 1.500 | 0.494 | 4.552 | 0.474 |
| Dynamic venous pressure (mmHg) | 1.017 | 1.007 | 1.027 | 0.001 * |
| AGT | ||||
| rs7079 | 0.981 | 0.523 | 1.840 | 0.952 |
| rs11568056 | 0.835 | 0.429 | 1.625 | 0.595 |
| rs6687360 | 0.867 | 0.499 | 1.509 | 0.615 |
| rs4762 | 0.510 | 0.234 | 1.110 | 0.090 |
| rs11568028 | 0.766 | 0.413 | 1.423 | 0.399 |
| rs3789678 | 1.310 | 0.662 | 2.590 | 0.438 |
| rs5051 | 1.011 | 0.560 | 1.825 | 0.972 |
| ACE | ||||
| rs4295 | 1.095 | 0.558 | 2.150 | 0.792 |
| rs4340 | 1.401 | 0.805 | 2.439 | 0.233 |
| rs10853044 | 1.520 | 0.723 | 3.197 | 0.269 |
| AGTR1 | ||||
| rs409742 | 0.856 | 0.366 | 2.003 | 0.720 |
| rs275653 | 0.933 | 0.455 | 1.912 | 0.850 |
| rs10935724 | 1.104 | 0.584 | 2.087 | 0.761 |
| rs1492099 | 0.680 | 0.267 | 1.735 | 0.420 |
| rs385338 | 1.204 | 0.669 | 2.167 | 0.535 |
| rs5182 | 0.952 | 0.510 | 1.777 | 0.878 |
| rs5186 | 0.483 | 0.179 | 1.304 | 0.151 |
| AGTR2 | ||||
| rs1403543 | 0.982 | 0.546 | 1.768 | 0.953 |
| rs11091046 | 0.871 | 0.474 | 1.600 | 0.656 |
| rs12840631 | 1.136 | 0.641 | 2.013 | 0.661 |
| Clinical or Genetic Factors | Odds Ratio | 95% CI Lower | 95% CI Upper | Significance |
|---|---|---|---|---|
| Age (year) | 1.014 | 0.997 | 1.031 | 0.115 |
| Right side vs. left side | 3.051 | 1.724 | 5.397 | <0.0001 * |
| Upper arm vs. forearm | 4.474 | 2.215 | 9.038 | <0.0001 * |
| Hypertension | 1.450 | 0.878 | 2.396 | 0.147 |
| Diabetes mellitus | 0.806 | 0.470 | 1.380 | 0.432 |
| Coronary artery disease | 1.374 | 0.771 | 2.447 | 0.281 |
| Peripheral artery disease | 1.603 | 0.564 | 4.555 | 0.376 |
| Cerebrovascular accident | 1.566 | 0.733 | 3.342 | 0.247 |
| Dynamic venous pressure (mmHg) | 1.008 | 1.000 | 1.017 | 0.061 |
| AGT | ||||
| rs7079 | 0.984 | 0.547 | 1.768 | 0.956 |
| rs11568056 | 1.185 | 0.668 | 2.107 | 0.563 |
| rs6687360 | 1.615 | 0.951 | 2.744 | 0.076 |
| rs4762 | 0.817 | 0.418 | 1.594 | 0.552 |
| rs11568028 | 0.942 | 0.552 | 1.608 | 0.827 |
| rs3789678 | 0.809 | 0.431 | 1.515 | 0.507 |
| rs5051 | 0.850 | 0.472 | 1.530 | 0.588 |
| ACE | ||||
| rs4295 | 1.459 | 0.799 | 2.663 | 0.219 |
| rs4340 | 1.320 | 0.780 | 2.233 | 0.301 |
| rs10853044 | 0.902 | 0.456 | 1.785 | 0.768 |
| AGTR1 | ||||
| rs409742 | 1.584 | 0.795 | 3.156 | 0.191 |
| rs275653 | 1.900 | 1.035 | 3.489 | 0.038 * |
| rs10935724 | 0.785 | 0.452 | 1.361 | 0.388 |
| rs1492099 | 2.287 | 1.160 | 4.509 | 0.017 * |
| rs385338 | 1.053 | 0.592 | 1.872 | 0.860 |
| rs5182 | 1.623 | 0.938 | 2.808 | 0.084 |
| rs5186 | 1.159 | 0.459 | 2.926 | 0.735 |
| AGTR2 | ||||
| rs1403543 | 1.099 | 0.661 | 1.826 | 0.717 |
| rs11091046 | 1.133 | 0.654 | 1.964 | 0.656 |
| rs12840631 | 1.145 | 0.598 | 2.191 | 0.683 |
| Clinical or Genetic Factors | Significance | Odds Ratio | 95% CI Lower | 95% CI Upper |
|---|---|---|---|---|
| Right side vs. left side | 0.001 * | 3.559 | 1.709 | 7.412 |
| Upper arm vs. forearm | 0.003 * | 3.837 | 1.590 | 9.258 |
| AGTR1 rs1492099_CA+AA vs. CC | 0.005 * | 3.632 | 1.469 | 8.982 |
| Age | 0.543 | 1.007 | 0.985 | 1.029 |
| Hypertension | 0.313 | 0.702 | 0.353 | 1.395 |
| Dynamic venous pressure | 0.473 | 1.004 | 0.994 | 1.014 |
| AGT rs6687360 | 0.065 | 1.885 | 0.962 | 3.692 |
| AGTR1 rs409742 | 0.522 | 1.500 | 0.433 | 5.195 |
| AGTR1 rs275653 | 0.913 | 0.917 | 0.195 | 4.307 |
| AGTR1 rs5182 | 0.712 | 1.148 | 0.551 | 2.391 |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.-W.; Wu, Y.-T.; Lin, J.-S.; Yang, W.-C.; Hsu, Y.-H.; Lee, K.-H.; Ou, S.-M.; Chen, Y.-T.; Shih, C.-J.; Lee, P.-C.; et al. Association of Genetic Polymorphisms of Renin–Angiotensin–Aldosterone System-Related Genes with Arterio-Venous Fistula Malfunction in Hemodialysis Patients. Int. J. Mol. Sci. 2016, 17, 833. https://doi.org/10.3390/ijms17060833
Chen Y-W, Wu Y-T, Lin J-S, Yang W-C, Hsu Y-H, Lee K-H, Ou S-M, Chen Y-T, Shih C-J, Lee P-C, et al. Association of Genetic Polymorphisms of Renin–Angiotensin–Aldosterone System-Related Genes with Arterio-Venous Fistula Malfunction in Hemodialysis Patients. International Journal of Molecular Sciences. 2016; 17(6):833. https://doi.org/10.3390/ijms17060833
Chicago/Turabian StyleChen, Yu-Wei, Yu-Te Wu, Jhin-Shyaun Lin, Wu-Chang Yang, Yung-Ho Hsu, Kuo-Hua Lee, Shou-Ming Ou, Yung-Tai Chen, Chia-Jen Shih, Pui-Ching Lee, and et al. 2016. "Association of Genetic Polymorphisms of Renin–Angiotensin–Aldosterone System-Related Genes with Arterio-Venous Fistula Malfunction in Hemodialysis Patients" International Journal of Molecular Sciences 17, no. 6: 833. https://doi.org/10.3390/ijms17060833
APA StyleChen, Y.-W., Wu, Y.-T., Lin, J.-S., Yang, W.-C., Hsu, Y.-H., Lee, K.-H., Ou, S.-M., Chen, Y.-T., Shih, C.-J., Lee, P.-C., Chan, C.-H., Chung, M.-Y., & Lin, C.-C. (2016). Association of Genetic Polymorphisms of Renin–Angiotensin–Aldosterone System-Related Genes with Arterio-Venous Fistula Malfunction in Hemodialysis Patients. International Journal of Molecular Sciences, 17(6), 833. https://doi.org/10.3390/ijms17060833

