Secreted Frizzled-Related Protein Promotes Bone Regeneration by Human Bone Marrow-Derived Mesenchymal Stem Cells
Abstract
:1. Introduction
2. Results and Discussion
2.1. sFRP-3 Induces the Expression of Osteogenic Markers in hMSCs
2.2. sFRP-3 Enhances Bone Regeneration in Vivo
3. Experimental Section
3.1. Cell Culture
3.2. qRT-PCR
Gene | Sequence | Accession No. | |
---|---|---|---|
ALP | F | AGAAAGCCAGGGGCACGAG | NM_000478 |
R | GGGAGTGCTTGTATCTCGGTTTG | ||
Probe | CCTGGACCTCGTTGACACCTGGAAGAGC | ||
ColI | F | GACAGTCATTGAATACAAAAC | NM_053356 |
R | ACGGAATTCTTGGTTAGTA | ||
Probe | TAAGCCATCTCGCCTGCCAT | ||
OC | F | GACTCTGAGTCTGACAAA | NM_013414 |
R | AGTCCATTGTTGAGGTAG | ||
Probe | CATCCATCCATTCCACCACGC | ||
Runx2 | F | CCTCTTATCTGAGCCAGA | NM_053470 |
R | GCAGTGTCATCATCTGAA | ||
Probe | CATCCATCCATTCCACCACGC | ||
GAPDH | F | GTTCCAGTATGACTCTACC | NM_017008 |
R | TCACCCCATTTGATGTTA | ||
Probe | TTCAACGGCACAGTCAAGGC |
3.3. Rat Calvarial Bone Defect Model
3.4. Radiographic and Histological Analysis
3.5. Statistical Analysis
4. Conclusions
Supplementary Material
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Shimazu, C.; Hara, T.; Kinuta, Y.; Moriya, K.; Maruo, Y.; Hanada, S.; Minagi, S. Enhanced vertical alveolar bone augmentation by recombinant human bone morphogenic protein-2 with carrier in rats. J. Oral Rehabil. 2006, 33, 609–618. [Google Scholar] [CrossRef] [PubMed]
- Herford, A.S.; Boyne, P.J. Reconstruction of mandibular continuity defects with bone morphogenic protein-2 (rhBMP-2). J. Oral Maxillofac. Surg. 2008, 66, 616–624. [Google Scholar] [CrossRef] [PubMed]
- Kawasaki, K.; Aihara, M.; Honmo, J.; Sakurai, S.; Fujimaki, Y.; Sakamoto, K.; Fujimaki, E.; Wozney, J.M.; Yamaguchi, A. Effects of reconmbinant human bone morphogenetic protein-2 on differentiation of cells isolated from human bone, muscle, and skin. Bone 1998, 23, 223–231. [Google Scholar] [CrossRef]
- Perri, B.; Cooper, M.; Lauryssen, C.; Anand, N. Adverse swelling associated with use of rh-BMP-2 in anterior cervical discectomy and fusion: A case study. Spine J. 2007, 7, 235–239. [Google Scholar] [CrossRef] [PubMed]
- Shields, L.B.; Raque, G.H.; Glassman, S.D.; Campbell, M.; Vitaz, T.; Harpring, J.; Shields, C.B. Adeverse effects associated with high-dose recombinant human bone morphogenetic protein-2 use in anterior cervical spine fusion. Spine 2006, 31, 542–547. [Google Scholar] [CrossRef] [PubMed]
- Langer, R.; Vacanti, J.P. Tissue Engineering. Science 1993, 260, 920–926. [Google Scholar] [CrossRef] [PubMed]
- Yamada, Y.; Ueda, M.; Naiki, T.; Takahashi, M.; Hata, K.; Nagasaka, T. Autogenous injectable bone for regeneration with mesenchymal stem cells (MSCs) and platelet-rich plasma (PRP): Tissue-engineered bone regeneration. Tissue Eng. 2004, 10, 955–964. [Google Scholar] [CrossRef] [PubMed]
- Yamada, Y.; Nakamura, S.; Ito, K.; Umemura, E.; Hara, K.; Nagasaka, T.; Abe, A.; Baba, S.; Furuichi, Y.; Izumi, Y.; et al. Injectable bone tissue engineering using expanded mesenchymal stem cells. Stem Cells 2013, 31, 572–580. [Google Scholar] [CrossRef] [PubMed]
- Dale, T.C. Signal transduction by Wnt family of ligands. Biochem. J. 1998, 329 Pt 2, 209–223. [Google Scholar] [CrossRef] [PubMed]
- Akiyama, T. Wnt/β-catenin signaling. Cytokine Growth Factor Rev. 2000, 11, 273–282. [Google Scholar] [CrossRef]
- Reya, T.; Duncan, A.W.; Ailles, L.; Domen, J.; Scherer, D.C.; Willert, K.; Hintz, L.; Nusse, R.; Weissman, I.L. A role for Wnt signaling in self-renewal of haematopoietic stem cells. Nature 2003, 423, 409–414. [Google Scholar] [CrossRef] [PubMed]
- Boyden, L.M.; Mao, J.; Belsky, J.; Mitzner, L.; Farhi, A.; Mitnick, M.A.; Wu, D.; Insigna, K.; Lifton, R.P. High bone density due to a mutation in LDL-receptor-related protein 5. N. Engl. J. Med. 2002, 346, 1513–1521. [Google Scholar] [CrossRef] [PubMed]
- Little, L.D.; Carulli, J.P.; del Mastro, R.G.; Dupuis, J.; Osborne, M.; Folz, C.; Manning, S.P.; Swain, P.M.; Zhao, S.C.; Eustace, B.; et al. A mutation in the LDL receptor-related protein 5 gene results in the autosomal dominant high-bone-mass trait. Am. J. Hum. Genet. 2002, 70, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Boland, M.; Perkins, G.; Hall, D.J.; Tuan, R.S. Wnt 3a promotes proliferation and surpresses osteogenic differentiation of adult human mesenchymal stem cells. J. Cell. Biochem. 2004, 93, 1210–1230. [Google Scholar] [CrossRef] [PubMed]
- De Boer, J.; Wang, H.J.; van Blitterswijk, C. Effects of Wnt signaling on proliferation and differentiation of human mesenchymal stem cells. Tissue Eng. 2004, 10, 393–401. [Google Scholar] [CrossRef] [PubMed]
- Etheridge, S.L.; Spencer, G.J.; Heath, D.J.; Genever, P.G. Expression profiling and functional analysis of Wnt signaling mechanisms in mesenchymal stem cells. Stem Cells 2004, 22, 849–860. [Google Scholar] [CrossRef] [PubMed]
- Baksh, D.; Boland, G.M.; Tuan, R.S. Cross-talk between Wnt signaling pathways in human mesenchymal stem cells leads to functional antagonism during osteogenic differentiation. J. Cell. Biochem. 2007, 101, 1109–1124. [Google Scholar] [CrossRef] [PubMed]
- Westendorf, J.J.; Kahler, R.A.; Schroeder, T.M. Wnt signaling in osteoblasts and bone diseases. Gene 2004, 341, 19–39. [Google Scholar] [CrossRef] [PubMed]
- Bodine, P.V.; Zhao, W.; Kharode, Y.P.; Bex, F.J.; Lambert, A.J.; Goad, M.B.; Gaur, T.; Stein, G.S.; Lian, J.B.; Komm, B.S. The Wnt antagonist secreted frizzled-related protein-1 is a negative regulator of trabecular bone formation in adult mice. Mol. Endocrinol. 2004, 18, 1222–1237. [Google Scholar] [CrossRef] [PubMed]
- Oshima, T.; Abe, M.; Asano, J.; Hara, T.; Kitazoe, K.; Sekimoto, E.; Tanaka, Y.; Shibata, H.; Hashimoto, T.; Ozaki, S.; et al. Myeloma cells suppress bone formation by secreting a soluble Wnt inhibitor, sFRP-2. Blood 2005, 106, 3160–3165. [Google Scholar] [CrossRef] [PubMed]
- Yamada, A.; Iwata, T.; Yamato, M.; Okano, T.; Izumi, Y. Diverse functions of secreted frizzled-related proteins in the osteoblastogenesis of human multipotent mesenchymal stromal cells. Biomaterials 2013, 34, 3270–3278. [Google Scholar] [CrossRef] [PubMed]
- Bain, G.; Müller, T.; Wang, X.; Papkoff, J. Activated beta-catenin induces osteoblast differentiation of C3H10T1/2 cells and participates in BMP-2 mediated signal transduction. Biochem. Biophys. Res. Commun. 2003, 301, 84–91. [Google Scholar] [CrossRef]
- Gaur, T.; Lengner, C.J.; Hovhannisyan, H.; Bhat, R.A.; Bodine, P.V.; Komm, B.S.; Javed, A.; van Wijnen, A.J.; Stein, J.L.; Stein, G.S.; et al. Canonical Wnt signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J. Biol. Chem. 2005, 280, 33132–33140. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Katagiri, W.; Osugi, M.; Kawai, T.; Hibi, H. Secreted Frizzled-Related Protein Promotes Bone Regeneration by Human Bone Marrow-Derived Mesenchymal Stem Cells. Int. J. Mol. Sci. 2015, 16, 23250-23258. https://doi.org/10.3390/ijms161023250
Katagiri W, Osugi M, Kawai T, Hibi H. Secreted Frizzled-Related Protein Promotes Bone Regeneration by Human Bone Marrow-Derived Mesenchymal Stem Cells. International Journal of Molecular Sciences. 2015; 16(10):23250-23258. https://doi.org/10.3390/ijms161023250
Chicago/Turabian StyleKatagiri, Wataru, Masashi Osugi, Takamasa Kawai, and Hideharu Hibi. 2015. "Secreted Frizzled-Related Protein Promotes Bone Regeneration by Human Bone Marrow-Derived Mesenchymal Stem Cells" International Journal of Molecular Sciences 16, no. 10: 23250-23258. https://doi.org/10.3390/ijms161023250
APA StyleKatagiri, W., Osugi, M., Kawai, T., & Hibi, H. (2015). Secreted Frizzled-Related Protein Promotes Bone Regeneration by Human Bone Marrow-Derived Mesenchymal Stem Cells. International Journal of Molecular Sciences, 16(10), 23250-23258. https://doi.org/10.3390/ijms161023250