The Influence of IL-10 and TNFα on Chondrogenesis of Human Mesenchymal Stromal Cells in Three-Dimensional Cultures
Abstract
:1. Introduction
2. Results
2.1. Results of Mesenchymal Stromal Cell (MSC) Characterization


2.2. Multipotency of MSCs
2.3. IL-10 and IL-10 Receptor-α Expression



2.4. Gene Expression of Chondrogenic Differentiated MSCs under the Influence of IL-10 and TNFα in High-Density (H-D) Culture

2.5. Histological Structure and Type II Collagen Expression of MSCs in H-D Culture

2.6. Chondrogenic Gene Expression and Histology of Chondrogenic Differentiated MSCs in H-D and Polyglycolic Acid (PGA) Culture


3. Discussion
4. Experimental Section
4.1. MSC Isolation
| Stem Cell Growth Medium | Concentration |
|---|---|
| Selenium (Sigma–Aldrich, Munich, Germany) | 5 ng/mL |
| Transferrin (Sigma–Aldrich) | 5 µg/mL |
| Linoleic acid (Sigma–Aldrich) | 4.7 µg/mL |
| Insulin (Sigma–Aldrich) | 5 µg/mL |
| Ascorbic acid (Sigma–Aldrich) | 1 µg/mL |
| Dexamethasone (Sigma–Aldrich) | 1 µg/mL |
| MCDB 201 with l-glutamine solution (Sigma–Aldrich) | 34 mL/100 mL |
| Dulbecco’s modified Eagle’s medium (Biochrom AG) | 51 mL/100 mL |
| Fetal calf serum (FCS, Biochrom AG) | 15 mL/100 mL |
| Streptomycin (Biochrom AG) | 50 IU/mL |
| Penicillin (Biochrom AG) | 50 IU/mL |
| Chondrocytes Growth Medium | Concentration |
| Ham’s F-12/Dulbecco’s modified Eagle’s medium supplemented with 25 μg/mL ascorbic acid (Sigma–Aldrich) | 1000 mL |
| Streptomycin (Biochrom AG) | 50 IU/mL |
| Penicillin (Biochrom AG) | 50 IU/mL |
| Amphotericin B (Biochrom AG) | 2.5 μg/mL |
| Essential amino acids (Biochrom AG) | 1 mL/100 mL |
| Fetal calf serum (Biochrom AG) | 1 mL/100 mL |
| Lipogenic Medium | Concentration |
| Indomethacin (Sigma–Aldrich) | 2 µL/mL |
| Isobutyl-1-methylxanthine (Sigma–Aldrich) | 1 µL/mL |
| Rosiglitazone (Sigma–Aldrich) | 1 µL/mL |
| Insulin (Sigma–Aldrich) | 4 µL/mL |
| Dexamethasone (Sigma–Aldrich) | 1 µL/mL |
| Fetal calf serum (FCS, Biochrom AG) | 0.1 mL/mL |
| Streptomycin (Biochrom AG) | 50 IU/mL |
| Penicillin (Biochrom AG) | 50 IU/mL |
| HEPES (Biochrom AG) | 25 µL/mL |
| Dulbecco’s modified Eagle’s medium with 3.7 g/L NaHCO3 and 4.5 g/L glucose (Biochrom AG) | 10 mL |
| Osteogenic Medium | Concentration |
| Dexamethasone (Sigma–Aldrich) | 1 µL/mL |
| Glycerol-3-phosphate (Sigma–Aldrich) | 10 µL/mL |
| Ascorbic acid (Sigma–Aldrich) | 2 µL/mL |
| HEPES (Biochrom AG) | 25 µL/mL |
| Streptomycin (Biochrom AG) | 50 IU/mL |
| Penicillin (Biochrom AG) | 50 IU/mL |
| Chondrogenic Medium | Concentration |
| l-Glutamine (Biochrom AG) | 10 µL/mL |
| HEPES (Biochrom AG) | 25 µL/mL |
| Sodium pyruvate (Sigma–Aldrich) | 10 µL/mL |
| Dexamethason (Sigma–Aldrich) | 0.1 µL/mL |
| Ascorbic acid (Sigma–Aldrich) | 1.7 µL/mL |
| Prolin (Sigma–Aldrich) | 1 µL/mL |
| ITS+1 (Sigma–Aldrich) | 10 µL/mL |
| Streptomycin (Biochrom AG) | 50 IU/mL |
| Penicillin (Biochrom AG) | 50 IU/mL |
| TGF-β1 (Pepro Tech GmbH, Hamburg, Germany) | 10 ng/mL |
| Dulbecco’s modified Eagle’s medium with 3.7 g/L NaHCO3 and 4.5 g/L glucose (Biochrom AG) | 10 mL |
4.2. Chondrocyte Isolation
4.3. MSC Characterisation Using Flow Cytometry
4.4. Chondrogenic, Adipogenic and Osteogenic Differentiation of MSCs
| Primary Antibody | Secondary Antibody |
|---|---|
| CD3, mouse anti-human CD3 (mouse IgG2a), r-phycoerythrin conjugate (Caltag, Buckingham, UK) | none |
| CD4, mouse anti-human CD 4 (mouse IgG2a), fluorescein (FITC) conjugate (Caltag) | none |
| CD8, mouse anti-human CD 8 (mouse IgG2a), fluorescein (FITC) conjugate (Caltag) | none |
| CD14, mouse anti-human CD14 antigen (mouse IgG 2a), fluorescein (FITC) conjugate (Invitrogen, Carlsbad, CA, USA) | none |
| CD29, mouse anti-human Integrin β1 monoclonal antibody (mouse IgG1) (Millipore, Billerica, MA, USA) | Donkey F(ab)2 Fragment-anti-mouse-APC (Dianova, Hamburg, Germany) |
| CD34, mouse anti-human CD34 (mouse IgG1, k), allophycocyanin (APC) conjugate (BD Pharmingen, Franklin Lakes, NJ, USA) | none |
| CD44, mouse anti-human CD 44 antibody (mouse IgG 2a) (Cell signaling, Cambridge, UK) | Donkey F(ab)2 Fragment-anti-mouse-APC (Dianova, Hamburg, Germany) |
| CD90, mouse anti-human CD90 (mouse IgG1, k), fluorescein (FITC) conjugate (BD Pharmingen) | none |
| CD106, mouse anti-human VCAM-1 monoclonal antibody (mouse IgG1) (Chemicon, Billerica, MA, USA) | Donkey F(ab)2 Fragment-anti-mouse-APC (Dianova) |
| Type II collagen, rabbit anti-human polyclonal antibody (Acris Antibodies, Herford, Germany) | Alexa-Fluor®488, donkey-anti-rabbit (Invitrogen) |
| IL-10, rabbit anti-human polyclonal antibody (tebu bio GmbH, Le-Perray-en-Yvelines, France) | Alexa-Fluor®488, donkey-anti-rabbit (Invitrogen) |
| IL-10-Receptor-α, mouse anti-human monoclonal antibody (Sigma–Aldrich) | Alexa-Fluor®488, donkey-anti-mouse (Invitrogen) |
| STAT1, rabbit anti-human monoclonal antibody (Cell Signaling) | Alexa-Fluor®488, donkey-anti-mouse (Invitrogen) |
| STAT3, rabbit anti-human monoclonal antibody (Cell Signaling) | Alexa-Fluor®488, donkey-anti-mouse (Invitrogen) |
4.5. MSCs in H-D Culture and Cultured in Non-Woven PGA Scaffolds
4.6. Differentiation of MSCs and Stimulation with Cytokines
4.7. Histological Staining Procedures
4.8. Gene Expression Analysis Using RTD-PCR
| Gene (Symbol) | NCBI Gene Reference | Length | Manufacturer |
|---|---|---|---|
| β-actin (ACTB) | NM_001101.2 | 171 | ABI® * |
| aggrecan (ACAN) | NM_013227.2 | 93 | ABI® * |
| sox9 (SOX9) | NM_000346.2 | 102 | ABI® * |
| TNFα (TNFα) | NM_000594.2 | 80 | ABI® * |
| β-actin (ACTB) (5'–3') | TGGGACGACATGGAGAA/GAAGGTCTCAAACATGATCTGG | 146 | Qiagen® |
| type II collagen (COL2A1) | NM_001844, NM_033150 | 142 | Qiagen® |
4.9. Immunolabelling
4.10. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Filardo, G.; Vannini, F.; Marcacci, M.; Andriolo, L.; Ferruzzi, A.; Giannini, S.; Kon, E. Matrix-assisted autologous chondrocyte transplantation for cartilage regeneration in osteoarthritic knees: Results and failures at midterm follow-up. Am. J. Sports Med. 2013, 41, 95–100. [Google Scholar]
- Kon, E.; Filardo, G.; di Matteo, B.; Perdisa, F.; Marcacci, M. Matrix assisted autologous chondrocyte transplantation for cartilage treatment: A systematic review. Bone Jt. Res. 2013, 2, 18–25. [Google Scholar]
- Steinwachs, M.R.; Guggi, T.; Kreuz, P.C. Marrow stimulation techniques. Injury 2008, 39, S26–S31. [Google Scholar]
- Pelttari, K.; Steck, E.; Richter, W. The use of mesenchymal stem cells for chondrogenesis. Injury 2008, 39, S58–S65. [Google Scholar]
- Yoo, J.U.; Barthel, T.S.; Nishimura, K.; Solchaga, L.; Caplan, A.I.; Goldberg, V.M.; Johnstone, B. The chondrogenic potential of human bone-marrow-derived mesenchymal progenitor cells. J. Bone Jt. Surg. Am. 1998, 80, 1745–1757. [Google Scholar]
- Goldring, M.B.; Otero, M.; Plumb, D.A.; Dragomir, C.; Favero, M.; el Hachem, K.; Hashimoto, K.; Roach, H.I.; Olivotto, E.; Borzi, R.M.; et al. Roles of inflammatory and anabolic cytokines in cartilage metabolism: Signals and multiple effectors converge upon MMP-13 regulation in osteoarthritis. Eur. Cells Mater. 2011, 21, 202–220. [Google Scholar]
- Fernandes, J.C.; Martel-Pelletier, J.; Pelletier, J.P. The role of cytokines in osteoarthritis pathophysiology. Biorheology 2002, 39, 237–246. [Google Scholar]
- Wehling, N.; Palmer, G.D.; Pilapil, C.; Liu, F.; Wells, J.W.; Muller, P.E.; Evans, C.H.; Porter, R.M. Interleukin-1β and tumor necrosis factor α inhibit chondrogenesis by human mesenchymal stem cells through NF-κB-dependent pathways. Arthritis Rheumatol. 2009, 60, 801–812. [Google Scholar]
- Bocker, W.; Docheva, D.; Prall, W.C.; Egea, V.; Pappou, E.; Rossmann, O.; Popov, C.; Mutschler, W.; Ries, C.; Schieker, M. IKK-2 is required for TNF-α-induced invasion and proliferation of human mesenchymal stem cells. J. Mol. Med. 2008, 86, 1183–1192. [Google Scholar]
- Chen, F.H.; Tuan, R.S. Mesenchymal stem cells in arthritic diseases. Arthritis Res. Ther. 2008, 10. [Google Scholar] [CrossRef]
- Jui, H.Y.; Lin, C.H.; Hsu, W.T.; Liu, Y.R.; Hsu, R.B.; Chiang, B.L.; Tseng, W.Y.; Chen, M.F.; Wu, K.K.; Lee, C.M. Autologous mesenchymal stem cells prevent transplant arteriosclerosis by enhancing local expression of interleukin-10, interferon-γ, and indoleamine 2,3-dioxygenase. Cell Transplant. 2012, 21, 971–984. [Google Scholar] [CrossRef]
- Kang, J.W.; Koo, H.C.; Hwang, S.Y.; Kang, S.K.; Ra, J.C.; Lee, M.H.; Park, Y.H. Immunomodulatory effects of human amniotic membrane-derived mesenchymal stem cells. J. Vet. Sci. 2012, 13, 23–31. [Google Scholar]
- Ryan, J.M.; Barry, F.; Murphy, J.M.; Mahon, B.P. Interferon-γ does not break, but promotes the immunosuppressive capacity of adult human mesenchymal stem cells. Clin. Exp. Immunol. 2007, 149, 353–363. [Google Scholar]
- Lin, J.Q.; Lin, C.Z.; Lin, X.Z.; Zeng, K.; Gao, Y.G. Construction of a bicistronic recombinant adenoviral vector for human interleukin-10 and enhanced green fluorescent protein expression in bone marrow mesenchymal stem cells. Chin. Med. J. 2012, 125, 102–108. [Google Scholar]
- Min, C.K.; Kim, B.G.; Park, G.; Cho, B.; Oh, I.H. IL-10-transduced bone marrow mesenchymal stem cells can attenuate the severity of acute graft-versus-host disease after experimental allogeneic stem cell transplantation. Bone Marrow Transplant. 2007, 39, 637–645. [Google Scholar] [CrossRef]
- Mackay, A.M.; Beck, S.C.; Murphy, J.M.; Barry, F.P.; Chichester, C.O.; Pittenger, M.F. Chondrogenic differentiation of cultured human mesenchymal stem cells from marrow. Tissue Eng. 1998, 4, 415–428. [Google Scholar]
- Tuan, R.S. Biology of developmental and regenerative skeletogenesis. Clin. Orthop. Relat. Res. 2004, 427, S105–S117. [Google Scholar]
- Tew, S.R.; Murdoch, A.D.; Rauchenberg, R.P.; Hardingham, T.E. Cellular methods in cartilage research: Primary human chondrocytes in culture and chondrogenesis in human bone marrow stem cells. Methods 2008, 45, 2–9. [Google Scholar]
- Pillai, C.K.; Sharma, C.P. Review paper: Absorbable polymeric surgical sutures: Chemistry, production, properties, biodegradability, and performance. J. Biomater. Appl. 2010, 25, 291–366. [Google Scholar] [CrossRef]
- Yamanaka, T.; Sawai, Y.; Hosoi, H. A new supporting material for fascia grafting during myringoplasty: Polyglycolic acid sheets. Otolaryngology 2013, 149, 342–344. [Google Scholar]
- Erggelet, C.; Neumann, K.; Endres, M.; Haberstroh, K.; Sittinger, M.; Kaps, C. Regeneration of ovine articular cartilage defects by cell-free polymer-based implants. Biomaterials 2007, 28, 5570–5580. [Google Scholar]
- Patrascu, J.M.; Kruger, J.P.; Boss, H.G.; Ketzmar, A.K.; Freymann, U.; Sittinger, M.; Notter, M.; Endres, M.; Kaps, C. Polyglycolic acid-hyaluronan scaffolds loaded with bone marrow-derived mesenchymal stem cells show chondrogenic differentiation in vitro and cartilage repair in the rabbit model. J. Biomed. Mater. Res. B 2013, 101, 1310–1320. [Google Scholar] [CrossRef]
- Barry, F.; Boynton, R.E.; Liu, B.; Murphy, J.M. Chondrogenic differentiation of mesenchymal stem cells from bone marrow: Differentiation-dependent gene expression of matrix components. Exp. Cell Res. 2001, 268, 189–200. [Google Scholar]
- Kim, M.; Erickson, I.E.; Choudhury, M.; Pleshko, N.; Mauck, R.L. Transient exposure to TGF-β3 improves the functional chondrogenesis of MSC-laden hyaluronic acid hydrogels. J. Mech. Behav. Biomed. Mater. 2012, 11, 92–101. [Google Scholar]
- Mueller, M.B.; Fischer, M.; Zellner, J.; Berner, A.; Dienstknecht, T.; Prantl, L.; Kujat, R.; Nerlich, M.; Tuan, R.S.; Angele, P. Hypertrophy in mesenchymal stem cell chondrogenesis: Effect of TGF-β isoforms and chondrogenic conditioning. Cells Tissues Organs 2010, 192, 158–166. [Google Scholar]
- Tuan, R.S.; Chen, A.F.; Klatt, B.A. Cartilage regeneration. J. Am. Acad. Orthop. Surg. 2013, 21, 303–311. [Google Scholar]
- Chung, C.; Burdick, J.A. Engineering cartilage tissue. Adv. Drug Deliv. Rev. 2008, 60, 243–262. [Google Scholar]
- Mafi, R.; Hindocha, S.; Mafi, P.; Griffin, M.; Khan, W.S. Sources of adult mesenchymal stem cells applicable for musculoskeletal applications—A systematic review of the literature. Open Orthop. J. 2011, 5, 242–248. [Google Scholar]
- Martins, A.A.; Paiva, A.; Morgado, J.M.; Gomes, A.; Pais, M.L. Quantification and immunophenotypic characterization of bone marrow and umbilical cord blood mesenchymal stem cells by multicolor flow cytometry. Transplant. Proc. 2009, 41, 943–946. [Google Scholar]
- Augello, A.; Kurth, T.B.; de Bari, C. Mesenchymal stem cells: A perspective from in vitro cultures to in vivo migration and niches. Eur. Cells Mater. 2010, 20, 121–133. [Google Scholar]
- Tormin, A.; Brune, J.C.; Olsson, E.; Valcich, J.; Neuman, U.; Olofsson, T.; Jacobsen, S.E.; Scheding, S. Characterization of bone marrow-derived mesenchymal stromal cells (MSC) based on gene expression profiling of functionally defined MSC subsets. Cytotherapy 2009, 11, 114–128. [Google Scholar]
- Bassi, G.; Pacelli, L.; Carusone, R.; Zanoncello, J.; Krampera, M. Adipose-derived stromal cells (ASCs). Transfus. Apher. Sci. 2012, 47, 193–198. [Google Scholar]
- Yu, G.; Wu, X.; Dietrich, M.A.; Polk, P.; Scott, L.K.; Ptitsyn, A.A.; Gimble, J.M. Yield and characterization of subcutaneous human adipose-derived stem cells by flow cytometric and adipogenic mRNA analyzes. Cytotherapy 2010, 12, 538–546. [Google Scholar]
- Buhring, H.J.; Treml, S.; Cerabona, F.; de Zwart, P.; Kanz, L.; Sobiesiak, M. Phenotypic characterization of distinct human bone marrow-derived MSC subsets. Ann. N. Y. Acad. Sci. 2009, 1176, 124–134. [Google Scholar]
- Gong, X.; Sun, Z.; Cui, D.; Xu, X.; Zhu, H.; Wang, L.; Qian, W.; Han, X. Isolation and characterization of lung resident mesenchymal stem cells capable of differentiating into alveolar epithelial type II cells. Cell Biol. Int. 2014, 38, 405–411. [Google Scholar]
- Moscoso, I.; Centeno, A.; Lopez, E.; Rodriguez-Barbosa, J.I.; Santamarina, I.; Filgueira, P.; Sanchez, M.J.; Dominguez-Perles, R.; Penuelas-Rivas, G.; Domenech, N. Differentiation “in vitro” of primary and immortalized porcine mesenchymal stem cells into cardiomyocytes for cell transplantation. Transplant. Proc. 2005, 37, 481–482. [Google Scholar] [CrossRef]
- Jung, Y.K.; Kim, G.W.; Park, H.R.; Lee, E.J.; Choi, J.Y.; Beier, F.; Han, S.W. Role of interleukin-10 in endochondral bone formation in mice: Anabolic effect via the bone morphogenetic protein/Smad pathway. Arthritis Rheumatol. 2013, 65, 3153–3164. [Google Scholar]
- Erggelet, C.; Endres, M.; Neumann, K.; Morawietz, L.; Ringe, J.; Haberstroh, K.; Sittinger, M.; Kaps, C. Formation of cartilage repair tissue in articular cartilage defects pretreated with microfracture and covered with cell-free polymer-based implants. J. Orthop. Res. 2009, 27, 1353–1360. [Google Scholar]
- Bedi, A.; Feeley, B.T.; Williams, R.J., 3rd. Management of articular cartilage defects of the knee. J. Bone Jt. Surg. Am. 2010, 92, 994–1009. [Google Scholar]
- Charlton, D.C.; Peterson, M.G.; Spiller, K.; Lowman, A.; Torzilli, P.A.; Maher, S.A. Semi-degradable scaffold for articular cartilage replacement. Tissue Eng. A 2008, 14, 207–213. [Google Scholar]
- Patrascu, J.M.; Freymann, U.; Kaps, C.; Poenaru, D.V. Repair of a post-traumatic cartilage defect with a cell-free polymer-based cartilage implant: A follow-up at two years by MRI and histological review. J. Bone Jt. Surg. Br. 2010, 92, 1160–1163. [Google Scholar]
- Shi, J.; Zhang, X.; Zeng, X.; Zhu, J.; Pi, Y.; Zhou, C.; Ao, Y. One-step articular cartilage repair: Combination of in situ bone marrow stem cells with cell-free poly(l-lactic-co-glycolic acid) scaffold in a rabbit model. Orthopedics 2012, 35, e665–e671. [Google Scholar] [CrossRef]
- Wegener, B.; Schrimpf, F.M.; Pietschmann, M.F.; Milz, S.; Berger-Lohr, M.; Bergschmidt, P.; Jansson, V.; Muller, P.E. Matrix-guided cartilage regeneration in chondral defects. Biotechnol. Appl. Biochem. 2009, 53, 63–70. [Google Scholar]
- Siclari, A.; Mascaro, G.; Gentili, C.; Cancedda, R.; Boux, E. A cell-free scaffold-based cartilage repair provides improved function hyaline-like repair at one year. Clin. Orthop. Relat. Res. 2012, 470, 910–919. [Google Scholar]
- Erickson, I.E.; van Veen, S.C.; Sengupta, S.; Kestle, S.R.; Mauck, R.L. Cartilage matrix formation by bovine mesenchymal stem cells in three-dimensional culture is age-dependent. Clin. Orthop. Relat. Res. 2011, 469, 2744–2753. [Google Scholar]
- Gerter, R.; Kruegel, J.; Miosge, N. New insights into cartilage repair—The role of migratory progenitor cells in osteoarthritis. Matrix Biol. 2012, 31, 206–213. [Google Scholar]
- Koelling, S.; Kruegel, J.; Irmer, M.; Path, J.R.; Sadowski, B.; Miro, X.; Miosge, N. Migratory chondrogenic progenitor cells from repair tissue during the later stages of human osteoarthritis. Cell Stem Cell 2009, 4, 324–335. [Google Scholar]
- Kurz, B.; Lemke, A.K.; Fay, J.; Pufe, T.; Grodzinsky, A.J.; Schunke, M. Pathomechanisms of cartilage destruction by mechanical injury. Ann. Anat. 2005, 187, 473–485. [Google Scholar]
- Schulze-Tanzil, G. Activation and dedifferentiation of chondrocytes: Implications in cartilage injury and repair. Ann. Anat. 2009, 191, 325–338. [Google Scholar]
- Wassilew, G.I.; Lehnigk, U.; Duda, G.N.; Taylor, W.R.; Matziolis, G.; Dynybil, C. The expression of proinflammatory cytokines and matrix metalloproteinases in the synovial membranes of patients with osteoarthritis compared with traumatic knee disorders. Arthroscopy 2010, 26, 1096–1104. [Google Scholar]
- John, T.; Muller, R.D.; Oberholzer, A.; Zreiqat, H.; Kohl, B.; Ertel, W.; Hostmann, A.; Tschoeke, S.K.; Schulze-Tanzil, G. Interleukin-10 modulates pro-apoptotic effects of TNF-α in human articular chondrocytes in vitro. Cytokine 2007, 40, 226–234. [Google Scholar] [CrossRef]
- Iannone, F.; de Bari, C.; dell’Accio, F.; Covelli, M.; Cantatore, F.P.; Patella, V.; Lo Bianco, G.; Lapadula, G. Interleukin-10 and interleukin-10 receptor in human osteoarthritic and healthy chondrocytes. Clin. Exp. Rheumatol. 2001, 19, 139–145. [Google Scholar]
- Botha-Scheepers, S.; Watt, I.; Slagboom, E.; de Craen, A.J.; Meulenbelt, I.; Rosendaal, F.R.; Breedveld, F.C.; Huizinga, T.W.; Kloppenburg, M. Innate production of tumour necrosis factor α and interleukin 10 is associated with radiological progression of knee osteoarthritis. Ann. Rheum. Dis. 2008, 67, 1165–1169. [Google Scholar]
- Mrosewski, I.; Jork, N.; Gorte, K.; Conrad, C.; Wiegand, E.; Kohl, B.; Ertel, W.; John, T.; Oberholzer, A.; Kaps, C.; et al. Regulation of osteoarthritis-associated key mediators by TNFα and IL-10: Effects of IL-10 overexpression in human synovial fibroblasts and a synovial cell line. Cell Tissue Res. 2014, 357, 207–223. [Google Scholar]
- Liu, H.; Kemeny, D.M.; Heng, B.C.; Ouyang, H.W.; Melendez, A.J.; Cao, T. The immunogenicity and immunomodulatory function of osteogenic cells differentiated from mesenchymal stem cells. J. Immunol. 2006, 176, 2864–2871. [Google Scholar]
- Razmkhah, M.; Jaberipour, M.; Erfani, N.; Habibagahi, M.; Talei, A.R.; Ghaderi, A. Adipose derived stem cells (ASCs) isolated from breast cancer tissue express IL-4, IL-10 and TGF-β1 and upregulate expression of regulatory molecules on T cells: Do they protect breast cancer cells from the immune response? Cell. Immunol. 2011, 266, 116–122. [Google Scholar]
- Engela, A.U.; Baan, C.C.; Peeters, A.M.; Weimar, W.; Hoogduijn, M.J. Interaction between adipose tissue-derived mesenchymal stem cells and regulatory T-cells. Cell Transplant. 2013, 22, 41–54. [Google Scholar]
- Luz-Crawford, P.; Kurte, M.; Bravo-Alegria, J.; Contreras, R.; Nova-Lamperti, E.; Tejedor, G.; Noel, D.; Jorgensen, C.; Figueroa, F.; Djouad, F.; et al. Mesenchymal stem cells generate a CD4+CD25+Foxp3+ regulatory T cell population during the differentiation process of Th1 and Th17 cells. Stem Cell Res. Ther. 2013, 4. [Google Scholar] [CrossRef]
- Fahy, N.; de Vries-van Melle, M.L.; Lehmann, J.; Wei, W.; Grotenhuis, N.; Farrell, E.; van der Kraan, P.M.; Murphy, J.M.; Bastiaansen-Jenniskens, Y.M.; van Osch, G.J. Human osteoarthritic synovium impacts chondrogenic differentiation of mesenchymal stem cells via macrophage polarisation state. Osteoarthr. Cartil. 2014, 22, 1167–1175. [Google Scholar]
- Gerstenfeld, L.C.; Cho, T.J.; Kon, T.; Aizawa, T.; Tsay, A.; Fitch, J.; Barnes, G.L.; Graves, D.T.; Einhorn, T.A. Impaired fracture healing in the absence of TNF-α signaling: The role of TNF-α in endochondral cartilage resorption. J. Bone Miner. Res. 2003, 18, 1584–1592. [Google Scholar]
- Hess, K.; Ushmorov, A.; Fiedler, J.; Brenner, R.E.; Wirth, T. TNFα promotes osteogenic differentiation of human mesenchymal stem cells by triggering the NF-κB signaling pathway. Bone 2009, 45, 367–376. [Google Scholar]
- Lu, Z.; Wang, G.; Dunstan, C.R.; Chen, Y.; Lu, W.Y.; Davies, B.; Zreiqat, H. Activation and promotion of adipose stem cells by tumour necrosis factor-α preconditioning for bone regeneration. J. Cell. Physiol. 2013, 228, 1737–1744. [Google Scholar]
- Mountziaris, P.M.; Dennis Lehman, E.; Mountziaris, I.; Sing, D.C.; Kasper, F.K.; Mikos, A.G. Effect of temporally patterned TNF-α delivery on in vitro osteogenic differentiation of mesenchymal stem cells cultured on biodegradable polymer scaffolds. J. Biomater. Sci. Polym. Ed. 2013, 24, 1794–1813. [Google Scholar] [CrossRef] [Green Version]
- Langen, R.C.; Schols, A.M.; Kelders, M.C.; Wouters, E.F.; Janssen-Heininger, Y.M. Inflammatory cytokines inhibit myogenic differentiation through activation of nuclear factor-κB. FASEB J. 2001, 15, 1169–1180. [Google Scholar]
- Heldens, G.T.; Blaney Davidson, E.N.; Vitters, E.L.; Schreurs, B.W.; Piek, E.; van den Berg, W.B.; van der Kraan, P.M. Catabolic factors and osteoarthritis-conditioned medium inhibit chondrogenesis of human mesenchymal stem cells. Tissue Eng. A 2012, 18, 45–54. [Google Scholar]
- Murakami, S.; Lefebvre, V.; de Crombrugghe, B. Potent inhibition of the master chondrogenic factor Sox9 gene by interleukin-1 and tumor necrosis factor-α. J. Biol. Chem. 2000, 275, 3687–3692. [Google Scholar]
- Liu, X.; Xu, Y.; Chen, S.; Tan, Z.; Xiong, K.; Li, Y.; Ye, Y.; Luo, Z.P.; He, F.; Gong, Y. Rescue of proinflammatory cytokine-inhibited chondrogenesis by the antiarthritic effect of melatonin in synovium mesenchymal stem cells via suppression of reactive oxygen species and matrix metalloproteinases. Free Radic. Biol. Med. 2014, 68, 234–246. [Google Scholar]
- Hemeda, H.; Jakob, M.; Ludwig, A.K.; Giebel, B.; Lang, S.; Brandau, S. Interferon-γ and tumor necrosis factor-α differentially affect cytokine expression and migration properties of mesenchymal stem cells. Stem Cells Dev. 2010, 19, 693–706. [Google Scholar]
- Kehoe, O.; Cartwright, A.; Askari, A.; El Haj, A.J.; Middleton, J. Intra-articular injection of mesenchymal stem cells leads to reduced inflammation and cartilage damage in murine antigen-induced arthritis. J. Transl. Med. 2014, 12. [Google Scholar] [CrossRef]
- Liu, L.N.; Wang, G.; Hendricks, K.; Lee, K.; Bohnlein, E.; Junker, U.; Mosca, J.D. Comparison of drug and cell-based delivery: Engineered adult mesenchymal stem cells expressing soluble tumor necrosis factor receptor II prevent arthritis in mouse and rat animal models. Stem Cells Transl. Med. 2013, 2, 362–375. [Google Scholar]
- Van Buul, G.M.; Villafuertes, E.; Bos, P.K.; Waarsing, J.H.; Kops, N.; Narcisi, R.; Weinans, H.; Verhaar, J.A.; Bernsen, M.R.; van Osch, G.J. Mesenchymal stem cells secrete factors that inhibit inflammatory processes in short-term osteoarthritic synovium and cartilage explant culture. Osteoarthr. Cartil. 2012, 20, 1186–1196. [Google Scholar]
- Ojeda Ojeda, M.; Silva, C.V.; de, J.A.R.M.; Fernandez-Ortega, C. TNFα production in whole blood cultures from healthy individuals. Biochem. Biophys. Res. Commun. 2002, 292, 538–541. [Google Scholar]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Jagielski, M.; Wolf, J.; Marzahn, U.; Völker, A.; Lemke, M.; Meier, C.; Ertel, W.; Godkin, O.; Arens, S.; Schulze-Tanzil, G. The Influence of IL-10 and TNFα on Chondrogenesis of Human Mesenchymal Stromal Cells in Three-Dimensional Cultures. Int. J. Mol. Sci. 2014, 15, 15821-15844. https://doi.org/10.3390/ijms150915821
Jagielski M, Wolf J, Marzahn U, Völker A, Lemke M, Meier C, Ertel W, Godkin O, Arens S, Schulze-Tanzil G. The Influence of IL-10 and TNFα on Chondrogenesis of Human Mesenchymal Stromal Cells in Three-Dimensional Cultures. International Journal of Molecular Sciences. 2014; 15(9):15821-15844. https://doi.org/10.3390/ijms150915821
Chicago/Turabian StyleJagielski, Michal, Johannes Wolf, Ulrike Marzahn, Anna Völker, Marion Lemke, Carola Meier, Wolfgang Ertel, Owen Godkin, Stephan Arens, and Gundula Schulze-Tanzil. 2014. "The Influence of IL-10 and TNFα on Chondrogenesis of Human Mesenchymal Stromal Cells in Three-Dimensional Cultures" International Journal of Molecular Sciences 15, no. 9: 15821-15844. https://doi.org/10.3390/ijms150915821
APA StyleJagielski, M., Wolf, J., Marzahn, U., Völker, A., Lemke, M., Meier, C., Ertel, W., Godkin, O., Arens, S., & Schulze-Tanzil, G. (2014). The Influence of IL-10 and TNFα on Chondrogenesis of Human Mesenchymal Stromal Cells in Three-Dimensional Cultures. International Journal of Molecular Sciences, 15(9), 15821-15844. https://doi.org/10.3390/ijms150915821
