Omics Reveals the Antibacterial Mechanism of Dihydromyricetin and Vine Tea Extract Against Staphylococcus aureus via Cell Wall and Membrane Disruption
Abstract
1. Introduction
2. Results and Discussion
2.1. Characterization of Major Flavonoids in Vine Tea Extract
2.2. Identification of DEPs
2.3. Functional Annotation and Pathway Enrichment
2.4. DEPs Associated with the Cell Wall and Cell Membrane in the DMY-Treated Group
2.4.1. DEPs Associated with the Cell Wall
2.4.2. DEPs Associated with the Cell Membrane
2.4.3. DEPs Associated with Membrane Proteins
2.5. DEPs Associated with the Cell Wall and Cell Membrane in the VTE-Treated Group
2.6. DEPs Associated with Pyrimidine Metabolism in the VTE-Treated Group
2.7. DEPs Related to Aminoacyl-tRNA Biosynthesis in the VTE-Treated Group
2.8. Lipidomics Analysis
2.8.1. Effects of DMY and VTE on Lipid Composition in S. aureus
2.8.2. Effects of DMY and VTE on Glycerophospholipids
Saturated and Unsaturated Fatty Acids in Phospholipids
Carbon Chain Length of Phospholipid Fatty Acids
2.8.3. Effects of DMY and VTE on Glycerolipids
2.8.4. Effects of DMY and VTE on Isoprenoid Lipids
2.9. Evaluation of Selected Proteins by RT-qPCR
3. Materials and Methods
3.1. Materials
3.2. Chemical Characterization of VTE
3.3. Mass Spectrometric Characterization of Proteins
3.4. Lipidomic Analysis
3.5. Bioinformatics Analysis
3.6. Total RNA Extraction and Quantitative Real-Time Fluorescent PCR for Bacteria
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Schneewind, O.; Missiakas, D. Sortases, Surface Proteins, and Their Roles in Staphylococcus aureus Disease and Vaccine Development. Microbiol. Spectr. 2019, 7, PSIB-0004-2018. [Google Scholar] [CrossRef] [Scilit]
- Jenul, C.; Horswill, A.R. Regulation of Staphylococcus aureus Virulence. Microbiol. Spectr. 2019, 7, GPP3-0031-2018. [Google Scholar] [CrossRef] [Scilit]
- Guerra, F.E.; Borgogna, T.R.; Patel, D.M.; Sward, E.W.; Voyich, J.M. Epic Immune Battles of History: Neutrophils vs. Staphylococcus aureus. Front. Cell. Infect. Microbiol. 2017, 7, 286. [Google Scholar] [CrossRef] [Scilit]
- Miller, L.S.; Fowler, V.G., Jr.; Shukla, S.K.; Rose, W.E.; Proctor, R.A. Development of a Vaccine against Staphylococcus aureus Invasive Infections: Evidence Based on Human Immunity, Genetics and Bacterial Evasion Mechanisms. FEMS Microbiol. Rev. 2020, 44, 123–153. [Google Scholar] [CrossRef] [Scilit]
- Balasubramanian, D.; Harper, L.; Shopsin, B.; Torres, V.J. Staphylococcus aureus Pathogenesis in Diverse Host Environments. Pathog. Dis. 2017, 75, ftx005. [Google Scholar] [CrossRef] [Scilit]
- Lakhundi, S.; Zhang, K. Methicillin-Resistant Staphylococcus aureus: Molecular Characterization, Evolution, and Epidemiology. Clin. Microbiol. Rev. 2018, 31, e00020-18. [Google Scholar] [CrossRef] [Scilit]
- Di Domenico, E.G.; Cavallo, I.; Capitanio, B.; Ascenzioni, F.; Pimpinelli, F.; Morrone, A.; Ensoli, F. Staphylococcus aureus and the Cutaneous Microbiota Biofilms in the Pathogenesis of Atopic Dermatitis. Microorganisms 2019, 7, 301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mairi, A.; Touati, A.; Lavigne, J.-P. Methicillin-Resistant Staphylococcus aureus St80 Clone: A Systematic Review. Toxins 2020, 12, 119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kane, T.L.; Carothers, K.E.; Lee, S.W. Virulence Factor Targeting of the Bacterial Pathogen Staphylococcus aureus for Vaccine and Therapeutics. Curr. Drug Targets 2018, 19, 111–127. [Google Scholar] [CrossRef] [Scilit]
- Tam, K.; Torres, V.J. Staphylococcus aureus Secreted Toxins and Extracellular Enzymes. Microbiol. Spectr. 2019, 7, GPP3-0039-2018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orlin, I.; Rokney, A.; Onn, A.; Glikman, D.; Peretz, A. Hospital Clones of Methicillin-Resistant Staphylococcus aureus Are Carried by Medical Students Even before Healthcare Exposure. Antimicrob. Resist. Infect. Control. 2017, 6, 15. [Google Scholar] [CrossRef] [Scilit]
- Cortimiglia, C.; Luini, M.; Bianchini, V.; Marzagalli, L.; Vezzoli, F.; Avisani, D.; Bertoletti, M.; Ianzano, A.; Franco, A.; Battisti, A. Prevalence of Staphylococcus aureus and of Methicillin-Resistant S. aureus Clonal Complexes in Bulk Tank Milk from Dairy Cattle Herds in Lombardy Region (Northern Italy). Epidemiol. Infect. 2016, 144, 3046–3051. [Google Scholar] [CrossRef] [Scilit]
- Carneiro, R.C.V.; Ye, L.; Baek, N.; Teixeira, G.H.A.; O’Keefe, S.F. Vine Tea (Ampelopsis grossedentata): A Review of Chemical Composition, Functional Properties, and Potential Food Applications. J. Funct. Foods 2021, 76, 104317. [Google Scholar] [CrossRef] [Scilit]
- Kun, X.; Xi, H.; Keyu, C.; Jihua, C.; Kozue, S.; De-Xing, H. Antioxidant Properties of a Traditional Vine Tea, Ampelopsis grossedentata. Antioxidants 2019, 8, 295. [Google Scholar] [CrossRef] [Scilit]
- Caihua, J.; Jinghuan, L.; Mingxing, Z.; Weibo, M.; Siming, Z.; Ru, L.; Jianhua, R.; Xiaohua, L. Antioxidant Properties of the Extracts of Vine Tea (Ampelopsis grossedentata) with the Different Color Characteristics and Inhibition of Rapeseed and Sunflower Oil Oxidation. LWT—Food Sci. Technol. 2021, 136, 110292. [Google Scholar] [CrossRef] [Scilit]
- Guo, Z.; Hu, G.; Wang, H.; Li, Z.; Liu, N. Ampelopsin Inhibits Human Glioma through Inducing Apoptosis and Autophagy Dependent on Ros Generation and Jnk Pathway. Biomed. Pharmacother. 2019, 116, 108524. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Shu, F.; Liang, X.; Chang, H.; Shi, L.; Peng, X.; Zhu, J.; Mi, M. Ampelopsin Induces Cell Growth Inhibition and Apoptosis in Breast Cancer Cells through Ros Generation and Endoplasmic Reticulum Stress Pathway. PLoS ONE 2014, 9, e89021. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Wu, Y.; Zou, J.; Gao, K. α-Glucosidase Inhibition and Antihyperglycemic Activity of Flavonoids from Ampelopsis grossedentata and the Flavonoid Derivatives. Bioorganic Med. Chem. 2016, 24, 1488–1494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ran, L.; Wang, X.; Lang, H.; Xu, J.; Wang, J.; Liu, H.; Mi, M.; Qin, Y. Ampelopsis Grossedentata Supplementation Effectively Ameliorates the Glycemic Control in Patients with Type 2 Diabetes Mellitus. Eur. J. Clin. Nutr. 2019, 73, 776–782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiong, Y.; Zhu, G.-H.; Zhang, Y.-N.; Hu, Q.; Wang, H.-N.; Yu, H.-N.; Qin, X.-Y.; Guan, X.-Q.; Xiang, Y.-W.; Tang, H.; et al. Flavonoids in Ampelopsis grossedentata as Covalent Inhibitors of SARS-CoV-2 3CLpro: Inhibition Potentials, Covalent Binding Sites and Inhibitory Mechanisms. Int. J. Biol. Macromol. 2021, 187, 976–987. [Google Scholar] [CrossRef] [Scilit]
- Hou, X.L.; Tong, Q.; Wang, W.Q.; Shi, C.Y.; Xiong, W.; Chen, J.; Liu, X.; Fang, J.G. Suppression of Inflammatory Responses by Dihydromyricetin, a Flavonoid from Ampelopsis grossedentata, via Inhibiting the Activation of NF-κB and MAPK Signaling Pathways. J. Nat. Prod. 2015, 78, 1689–1696. [Google Scholar] [CrossRef] [Scilit]
- Xiao, X.-N.; Wang, F.; Yuan, Y.-T.; Liu, J.; Liu, Y.-Z.; Yi, X. Antibacterial Activity and Mode of Action of Dihydromyricetin from Ampelopsis grossedentata Leaves against Food-Borne Bacteria. Molecules 2019, 24, 2831. [Google Scholar] [CrossRef] [Scilit]
- Yirong, W.; Junmin, W.; Hongjiao, X.; Peilun, D.; Tao, W.; Guang, J. Recent Update on Application of Dihydromyricetin in Metabolic Related Diseases. Biomed. Pharmacother. 2022, 148, 112771. [Google Scholar] [CrossRef] [Scilit]
- Dan, L.; Wencong, P.; Lijun, D.; Jianxia, S. An Insight into the Inhibitory Activity of Dihydromyricetin against Vibrio Parahaemolyticus. Food Control 2016, 67, 25–30. [Google Scholar] [CrossRef] [Scilit]
- Xiao, X.; Wang, J.; Tan, X.; Hu, J.; Yi, X. Antibacterial Activity and Influential Factors of Dihydromyricetin. J. Chin. Inst. Food Sci. Technol. 2016, 16, 124–129. [Google Scholar] [CrossRef]
- Liang, H.; He, K.; Li, T.; Cui, S.; Tang, M.; Kang, S.; Ma, W.; Song, L. Mechanism and Antibacterial Activity of Vine Tea Extract and Dihydromyricetin against Staphylococcus aureus. Sci. Rep. 2020, 10, 21416. [Google Scholar] [CrossRef] [Scilit]
- Aizat, W.M.; Hassan, M. Proteomics in Systems Biology. In Omics Applications for Systems Biology; Aizat, W.M., Goh, H.H., Baharum, S.N., Eds.; Advances in Experimental Medicine and Biology; Springer: Berlin/Heidelberg, Germany, 2018; Volume 1102, pp. 31–49. [Google Scholar]
- Navas-Iglesias, N.; Carrasco-Pancorbo, A.; Cuadros-Rodriguez, L. From Lipids Analysis Towards Lipidomics, a New Challenge for the Analytical Chemistry of the 21st Century. Part II: Analytical Lipidomics. TRAC-Trends Anal. Chem. 2009, 28, 393–403. [Google Scholar] [CrossRef] [Scilit]
- Jacobs, L.M.C.; Consol, P.; Chen, Y. Drug Discovery in the Field of β-Lactams: An Academic Perspective. Antibiotics 2024, 13, 59. [Google Scholar] [CrossRef] [Scilit]
- Odintsov, S.G.; Sabala, I.; Marcyjaniak, M.; Bochtler, M. Latent LytM at 1.3 s Resolution. J. Mol. Biol. 2004, 335, 775–785. [Google Scholar] [CrossRef] [PubMed]
- Antenucci, L.; Virtanen, S.; Thapa, C.; Jartti, M.; Pitkaenen, I.; Tossavainen, H.; Permi, P. Reassessing the Substrate Specificities of the Major Staphylococcus aureus Peptidoglycan Hydrolases Lysostaphin and LytM. elife 2024, 13, RP93673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pitkanen, I.; Tossavainen, H.; Permi, P. 1H, 13C, and 15N NMR Chemical Shift Assignment of LytM N-Terminal Domain (Residues 26-184). Biomol. Nmr Assign. 2023, 17, 257–263. [Google Scholar] [CrossRef] [Scilit]
- Stapleton, M.R.; Horsburgh, M.J.; Hayhurst, E.J.; Wright, L.; Jonsson, I.-M.; Tarkowski, A.; Kokai-Kun, J.F.; Mond, J.J.; Foster, S.J. Characterization of IsaA and SceD, Two Putative Lytic Transglycosylases of Staphylococcus aureus. J. Bacteriol. 2007, 189, 7316–7325. [Google Scholar] [CrossRef] [Scilit]
- Holtje, J.V.; Mirelman, D.; Sharon, N.; Schwarz, U. Novel Type of Murein Transglycosylase in Escherichia coli. J. Bacteriol. 1975, 124, 1067–1076. [Google Scholar] [CrossRef] [Scilit]
- Scheurwater, E.; Reid, C.W.; Clarke, A.J. Lytic Transglycosylases: Bacterial Space-Making Autolysins. Int. J. Biochem. Cell Biol. 2008, 40, 586–591. [Google Scholar] [CrossRef] [Scilit]
- Karatsa-Dodgson, M.; Woermann, M.E.; Gruendling, A. In Vitro Analysis of the Staphylococcus aureus Lipoteichoic Acid Synthase Enzyme Using Fluorescently Labeled Lipids. J. Bacteriol. 2010, 192, 5341–5349. [Google Scholar] [CrossRef] [Scilit]
- Wezen, X.C.; Chandran, A.; Eapen, R.S.; Waters, E.; Bricio-Moreno, L.; Tosi, T.; Dolan, S.; Millership, C.; Kadioglu, A.; Grundling, A.; et al. Structure-Based Discovery of Lipoteichoic Acid Synthase Inhibitors. J. Chem. Inf. Model. 2022, 62, 2586–2599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prentki, M.; Madiraju, S.R.M. Glycerolipid Metabolism and Signaling in Health and Disease. Endocr. Rev. 2008, 29, 647–676. [Google Scholar] [CrossRef] [Scilit]
- Wulf, H.; Perzborn, M.; Sievers, G.; Scholz, F.; Bornscheuer, U.T. Kinetic resolution of glyceraldehyde using an aldehyde dehydrogenase from Deinococcus geothermalis DSM 11300 combined with electrochemical cofactor recycling. J. Mol. Catal. B Enzym. 2012, 74, 144–150. [Google Scholar] [CrossRef] [Scilit]
- Imber, M.; Vu Van, L.; Reznikov, S.; Fritsch, V.N.; Pietrzyk-Brzezinska, A.J.; Prehn, J.; Hamilton, C.; Wahl, M.C.; Bronowska, A.K.; Antelmann, H. The Aldehyde Dehydrogenase AldA Contributes to the Hypochlorite Defense and is Redox-Controlled by Protein S-Bacillithiolation in Staphylococcus aureus. Redox Biol. 2018, 15, 557–568. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brady, R.A.; Leid, J.G.; Camper, A.K.; Costerton, J.W.; Shirtliff, M.E. Identification of Staphylococcus aureus Proteins Recognized by the Antibody-Mediated Immune Response to a Biofilm Infection. Infect. Immun. 2006, 74, 3415–3426. [Google Scholar] [CrossRef] [Scilit]
- Whittaker, V.P. Structure and Function of Animal-Cell Membranes. Br. Med. Bull. 1968, 24, 101–106. [Google Scholar] [CrossRef] [Scilit]
- Sohlenkamp, C.; Geiger, O. Bacterial Membrane Lipids: Diversity in Structures and Pathways. Fems Microbiol. Rev. 2016, 40, 133–159. [Google Scholar] [CrossRef] [Scilit]
- Dwyer, T.M.; Rao, K.S.; Westover, J.B.; Kim, J.J.P.; Frerman, F.E. The Function of Arg-94 in the Oxidation and Decarboxylation of Glutaryl-CoA by Human Glutaryl-CoA Dehydrogenase. J. Biol. Chem. 2001, 276, 133–138. [Google Scholar] [CrossRef] [Scilit]
- Agnihotri, G.; Liu, H.W. Enoyl-CoA Hydratase: Reaction, Mechanism, and Inhibition. Bioorganic Med. Chem. 2003, 11, 9–20. [Google Scholar] [CrossRef] [Scilit]
- Haack, T.B.; Jackson, C.B.; Murayama, K.; Kremer, L.S.; Schaller, A.; Kotzaeridou, U.; de Vries, M.C.; Schottmann, G.; Santra, S.; Buechner, B.; et al. Deficiency of ECHS1 Causes Mitochondrial Encephalopathy with Cardiac Involvement. Ann. Clin. Transl. Neurol. 2015, 2, 492–509. [Google Scholar] [CrossRef] [Scilit]
- Nikolau, B.J.; Oliver, D.J.; Schnable, P.S.; Wurtele, E.S. Molecular Biology of Acetyl-CoA Metabolism. Biochem. Soc. Trans. 2000, 28, 591–593. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Wu, C.; Gao, H.; Xu, C.; Dai, M.; Huang, L.; Hao, H.; Wang, X.; Cheng, G. Bacterial Multidrug Efflux Pumps at the Frontline of Antimicrobial Resistance: An Overview. Antibiotics 2022, 11, 520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanaka, K.J.; Song, S.; Mason, K.; Pinkett, H.W. Selective Substrate Uptake: The Role of ATP-Binding Cassette (ABC) Importers in Pathogenesis. Biochim. Biophys. Acta-Biomembr. 2018, 1860, 868–877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orelle, C.; Mathieu, K.; Jault, J.-M. Multidrug ABC Transporters in Bacteria. Res. Microbiol. 2019, 170, 381–391. [Google Scholar] [CrossRef] [Scilit]
- Johnson, J.W.; Fisher, J.F.; Mobashery, S. Bacterial Cell-Wall Recycling. Ann. N. Y. Acad. Sci. 2013, 1277, 54–75. [Google Scholar] [CrossRef] [Scilit]
- Benda, M.; Schulz, L.M.; Stuelke, J.; Rismondo, J. Influence of the ABC Transporter YtrBCDEF of Bacillus subtilis on Competence, Biofilm Formation and Cell Wall Thickness. Front. Microbiol. 2021, 12, 587035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- George, N.L.; Schilmiller, A.L.; Orlando, B.J. Conformational Snapshots of the Bacitracin Sensing and Resistance Transporter BceAB. Proc. Natl. Acad. Sci. USA 2022, 119, e2123268119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Houot, L.; Watnick, P.I. A Novel Role for Enzyme I of the Vibrio cholerae Phosphoenolpyruvate Phosphotransferase System in Regulation of Growth in a Biofilm. J. Bacteriol. 2008, 190, 311–320. [Google Scholar] [CrossRef] [Scilit]
- Neer, E.J.; Clapham, D.E. Roles of G Protein Subunits in Transmembrane Signalling. Nature 1988, 333, 129–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Auguet, M.; Lonchampt, M.O.; Delaflotte, S.; Goulin-Schulz, J.; Chabrier, P.E.; Braquet, P. Induction of Nitric Oxide Synthase by Lipoteichoic Acid from Staphylococcus aureus in Vascular Smooth Muscle Cells. FEBS Lett. 1992, 297, 183–185. [Google Scholar] [CrossRef] [Scilit]
- Dassa, E.; Schneider, E. The Rise of a Protein Family: ATP-Binding Cassette Systems. Res. Microbiol. 2001, 152, 203. [Google Scholar] [CrossRef] [Scilit]
- Singh, V.K.; Carlos, M.R.; Singh, K. Physiological Significance of the Peptidoglycan Hydrolase, LytM, in Staphylococcus aureus. Fems Microbiol. Lett. 2010, 311, 167–175. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, A.M.; Azam, M.S.; Schneewind, O.; Missiakas, D. Processing of LtaS Restricts LTA Assembly and YSIRK Preprotein Trafficking into Staphylococcus aureus Cross-Walls. Mbio 2024, 15, e0285223. [Google Scholar] [CrossRef] [Scilit]
- Yan, J.; Liu, Y.; Gao, Y.; Dong, J.; Mu, C.; Li, D.; Yang, G. RNAIII Suppresses the Expression of LtaS via Acting as an Antisense RNA in Staphylococcus aureus. J. Basic Microbiol. 2015, 55, 255–261. [Google Scholar] [CrossRef] [Scilit]
- Tiedemann, M.T.; Stillman, M.J. Heme Binding to the Isde(M78a; H229a) Double Mutant: Challenging Unidirectional Heme Transfer in the Iron-Regulated Surface Determinant Protein Heme Transfer Pathway of Staphylococcus Aureus. J. Biol. Inorg. Chem. 2012, 17, 995–1007. [Google Scholar] [CrossRef] [Scilit]
- Fournier, B.; Hooper, D.C. A New Two-Component Regulatory System Involved in Adhesion Autolysis, and Extracellular Proteolytic Activity of Staphylococcus aureus. J. Bacteriol. 2000, 182, 3955–3964. [Google Scholar] [CrossRef] [Scilit]
- Bhatnagar, A.; Pemawat, G. Anticancer and Antibacterial Activeness of Fused Pyrimidines: Newfangled Updates. Bioorganic Chem. 2024, 153, 107780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Couto, S.G.; Cristina Nonato, M.; Costa-Filho, A.J. Site Directed Spin Labeling Studies of Escherichia coli Dihydroorotate Dehydrogenase N-Terminal Extension. Biochem. Biophys. Res. Commun. 2011, 414, 487–492. [Google Scholar] [CrossRef] [Scilit]
- Hee, C.C. Nucleoside Diphosphate Kinase from Microorganisms. J. Bacteriol. Virol. 2013, 43, 92–98. [Google Scholar] [CrossRef] [Scilit]
- Thangadurai, S.; Bajgiran, M.; Manickam, S.; Mohana-Kumaran, N.; Azzam, G. CTP Synthase: The Hissing of the Cellular Serpent. Histochem. Cell Biol. 2022, 158, 517–534. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Narvaez-Ortiz, H.Y.; Lopez, A.J.; Gupta, N.; Zimmermann, B.H. A CTP Synthase Undergoing Stage-Specific Spatial Expression Is Essential for the Survival of the Intracellular Parasite Toxoplasma gondii. Front. Cell. Infect. Microbiol. 2018, 8, 83. [Google Scholar] [CrossRef] [Scilit]
- Bakovic, M.; Fullerton, M.D.; Michel, V. Metabolic and Molecular Aspects of Ethanolamine Phospholipid Biosynthesis: The Role of Ctp: Phosphoethanolamine Cytidylyltransferase (Pcyt2). Biochem. Cell Biol. 2007, 85, 283–300. [Google Scholar] [CrossRef] [Scilit]
- Matsubara, T.; Ishikura, M.; Aida, M. A Quantum Chemical Study of the Catalysis for Cytidine Deaminase: Contribution of the Extra Water Molecule. J. Chem. Inf. Model. 2006, 46, 1276–1285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arsene-Ploetze, F.; Nicoloff, H.; Kammerer, B.; Martinussen, J.; Bringel, F. Uracil Salvage Pathway in Lactobacillus plantarum: Transcription and Genetic Studies. J. Bacteriol. 2006, 188, 4777–4786. [Google Scholar] [CrossRef] [Scilit]
- Karunaratne, K.; Luedtke, N.; Quinn, D.M.; Kohen, A. Flavin-Dependent Thymidylate Synthase: N5 of Flavin as a Methylene Carrier. Arch. Biochem. Biophys. 2017, 632, 11–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.-Y.; Kim, T.-J. Metabolic Stress Induced by Quercetin Enhances Dormancy and Persistence in Staphylococcus aureus. Antibiotics 2025, 14, 424. [Google Scholar] [CrossRef] [Scilit]
- Harini, M.; Kavitha, K.; Prabakaran, V.; Krithika, A.; Dinesh, S.; Rajalakshmi, A.; Suresh, G.; Puvanakrishnan, R.; Ramesh, B. Identification of Apigenin-4′-Glucoside as Bacterial DNA Gyrase Inhibitor by QSAR Modeling, Molecular Docking, DFT, Molecular Dynamics, and In Vitro Confirmation Studies. J. Mol. Model. 2024, 30, 22. [Google Scholar] [CrossRef] [Scilit]
- Ibba, M.; Söll, D. Aminoacyl-tRNA Synthesis. Annu. Rev. Biochem. 2000, 69, 617–650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nikonova, E.Y.; Mihaylina, A.O.; Nemchinova, M.S.; Garber, M.B.; Nikonov, O.S. Glycyl-tRNA Synthetase as a Potential Universal Regulator of Translation Initiation at IRES-I. Mol. Biol. 2018, 52, 7–14. [Google Scholar] [CrossRef] [Scilit]
- Lin, J.; Huang, J.F. Evolution of Structures and Specific Recognitions in Aminoacyl-tRNA Synthetases. Prog. Biochem. Biophys. 2002, 29, 837–841. [Google Scholar]
- Zhang, Z.-L.; Xu, W.; Zhao, S.-M. The Canonical and Noncanonical Functions of Aminoacyl-tRNA Synthetases. Prog. Biochem. Biophys. 2023, 50, 1133–1143. [Google Scholar] [CrossRef]
- Curnow, A.W.; Ibba, M.; Soll, D. tRNA-Dependent Asparagine Formation. Nature 1996, 382, 589–590. [Google Scholar] [CrossRef] [Scilit]
- Schmitt, E.; Panvert, M.; Blanquet, S.; Mechulam, Y. Structural Basis for tRNA-Dependent Amidotransferase Function. Structure 2005, 13, 1421–1433. [Google Scholar] [CrossRef] [Scilit]
- Kozhikkadan Davis, C.; Nasla, K.; Anjana, A.K.; Rajanikant, G.K. Taxifolin as Dual Inhibitor of Mtb DNA Gyrase and Isoleucyl-tRNA Synthetase: In Silico Molecular Docking, Dynamics Simulation and In Vitro Assays. In Silico Pharmacol. 2018, 6, 8. [Google Scholar] [CrossRef] [Scilit]
- Nakaya, T.; Li, Y.J. Phospholipid Polymers. Prog. Polym. Sci. 1999, 24, 143–181. [Google Scholar] [CrossRef] [Scilit]
- Yoon, Y.; Lee, H.; Lee, S.; Kim, S.; Choi, K.-H. Membrane Fluidity-Related Adaptive Response Mechanisms of Foodborne Bacterial Pathogens under Environmental Stresses. Food Res. Int. 2015, 72, 25–36. [Google Scholar] [CrossRef] [Scilit]
- Velisek, J.; Cejpek, K. Biosynthesis of Food Constituents: Lipids. 1. Fatty Acids and Derivated Compounds—A Review. Czech J. Food Sci. 2006, 24, 193–216. [Google Scholar] [CrossRef] [Scilit]
- Song, X.; Tan, Y.; Liu, Y.; Zhang, J.; Liu, G.; Feng, Y.; Cui, Q. Different Impacts of Short-Chain Fatty Acids on Saturated and Polyunsaturated Fatty Acid Biosynthesis in Aurantiochytrium sp. SD116. J. Agric. Food Chem. 2013, 61, 9876–9881. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsuoka, S.; Hashimoto, M.; Kamiya, Y.; Miyazawa, T.; Ishikawa, K.; Hara, H.; Matsumoto, K. The Bacillus subtilis Essential Gene dgkB Is Dispensable in Mutants with Defective Lipoteichoic Acid Synthesis. Genes Genet. Syst. 2011, 86, 365–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yilmaz, M.A.; Ertas, A.; Yener, I.; Akdeniz, M.; Cakir, O.; Altun, M.; Demirtas, I.; Boga, M.; Temel, H. A Comprehensive Lc-Ms/Ms Method Validation for the Quantitative Investigation of 37 Fingerprint Phytochemicals in Achillea Species: A Detailed Examination of A. coarctata and A. monocephala. J. Pharm. Biomed. Anal. 2018, 154, 413–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]












| Peak No. | Compound | RT (min) | Quantifier Transition (m/z) | Qualifier Transition (m/z) | Ion Ratio | Concentration (μg/mL) |
|---|---|---|---|---|---|---|
| 1 | Dihydromyricetin | 3.29 | 319.3/193.0 | 319.3/125.1 | 0.2724 (0.2498) | 2780.237 |
| 2 | Dihydroquercetin | 3.38 | 303.1/151.0 | 303.1/175.0 | 0.6823 (0.6235) | 157.658 |
| 3 | Myricetin-3-O-rhamnoside | 3.40 | 463.1/316.0 | 463.1/271.0 | 0.3520 (0.3605) | 308.769 |
| 4 | Myricetin | 3.46 | 317.0/151.0 | 317.0/179.0 | 0.7162 (0.7429) | 0.589 |
| Target Gene | Primer Name | Primer Sequence 5′–3′ |
|---|---|---|
| lytM | LytM-F | ACGGTGTCGACTATGCAATGC |
| LytM-R | TACTTGATTGCCGCCACCA | |
| ltaS | LtaS-F | TTAGCCAACTGAATCTGC |
| LtaS-R | GATGCCTCTTTCACTTTT | |
| dgkB | DgkB-F | CCGCTCCAATGCTCCCCCTT |
| DgkB-R | CACGTCGTACGTCAGCTCCG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Hui, Q.; Li, T.; He, K.; Ma, W.; Guo, Y.; Zhang, Y.; Song, L. Omics Reveals the Antibacterial Mechanism of Dihydromyricetin and Vine Tea Extract Against Staphylococcus aureus via Cell Wall and Membrane Disruption. Molecules 2026, 31, 313. https://doi.org/10.3390/molecules31020313
Hui Q, Li T, He K, Ma W, Guo Y, Zhang Y, Song L. Omics Reveals the Antibacterial Mechanism of Dihydromyricetin and Vine Tea Extract Against Staphylococcus aureus via Cell Wall and Membrane Disruption. Molecules. 2026; 31(2):313. https://doi.org/10.3390/molecules31020313
Chicago/Turabian StyleHui, Qiaoni, Ting Li, Keke He, Wei Ma, Ying Guo, Yao Zhang, and Liya Song. 2026. "Omics Reveals the Antibacterial Mechanism of Dihydromyricetin and Vine Tea Extract Against Staphylococcus aureus via Cell Wall and Membrane Disruption" Molecules 31, no. 2: 313. https://doi.org/10.3390/molecules31020313
APA StyleHui, Q., Li, T., He, K., Ma, W., Guo, Y., Zhang, Y., & Song, L. (2026). Omics Reveals the Antibacterial Mechanism of Dihydromyricetin and Vine Tea Extract Against Staphylococcus aureus via Cell Wall and Membrane Disruption. Molecules, 31(2), 313. https://doi.org/10.3390/molecules31020313
