Novel and Sensitive Touchdown Polymerase Chain Reaction Assays for the Detection of Goat and Sheep Milk Adulteration with Cow Milk
Abstract
1. Introduction
2. Results and Discussion
2.1. Assay Optimization
2.2. Analytical Validation
2.2.1. Specificity
2.2.2. Sensitivity
2.2.3. Intra-Assay Repeatability
2.2.4. Recovery–Quality Control
2.3. Application of the Developed Assay in Commercial Goat Milks
2.4. Direct Comparison Study between the Developed Assay, ELISA and Rapid Immunochromatographic Test
3. Materials and Methods
3.1. Sample Collection
3.2. DNA Extraction and Recovery Evaluation
3.2.1. DNA Extraction
3.2.2. Evaluation of DNA Recovery
3.3. Design of Species-Specific Primers
3.4. Duplex TD-PCR Protocols
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dairy Market Review Emerging Trends and Outlook 2022. Available online: https://www.fao.org/3/cc3418en/cc3418en.pdf (accessed on 14 March 2024).
- Montgomery, H.; Haughey, S.A.; Elliott, C.T. Recent food safety and fraud issues within the dairy supply chain (2015–2019). Glob. Food Secur. 2020, 26, 100447. [Google Scholar] [CrossRef]
- Giglioti, R.; Polli, H.; Azevedo, B.T.; Katiki, L.M.; Vercesi Filho, A.E. Detection and quantification of adulteration in milk and dairy products: A novel and sensitive qPCR-based method. Food Chem. 2022, 4, 100074. [Google Scholar] [CrossRef]
- Ortega, J.F.; Morales-Palomo, F.; Fernandez-Elias, V.; Hamouti, N.; Bernardo, F.J.; Martin-Doimeadios, R.C.; Nelson, R.K.; Horowitz, J.F.; Mora-Rodriguez, R. Dietary supplementation with omega-3 fatty acids and oleate enhances exercise training effects in patients with metabolic syndrome. Obesity 2016, 24, 1704–1711. [Google Scholar] [CrossRef]
- Kritikou, A.S.; Aalizadeh, R.; Damalas, D.E.; Barla, I.V.; Baessmann, C.; Thomaidis, N.S. MALDI-TOF-MS integrated workflow for food authenticity investigations: An untargeted protein-based approach for rapid detection of PDO feta cheese adulteration. Food Chem. 2022, 370, 131057. [Google Scholar] [CrossRef]
- Kastanos, E.; Papaneophytou, C.; Georgiou, T.; Demoliou, C. A simple and fast triplex-PCR for the identification of milk’s animal origin in Halloumi cheese and yoghurt. J. Dairy Res. 2022, 89, 323–326. [Google Scholar] [CrossRef]
- Tsakali, E.; Agkastra, C.; Koliaki, C.; Livanios, D.; Boutris, G.; Christopoulou, M.I.; Koulouris, S.; Koussissis, S.; van Impe, J.F.M.; Houhoula, D. Milk adulteration: Detection of bovine milk in caprine dairy products by real time PCR. J. Food Res. 2019, 8, 52–57. [Google Scholar] [CrossRef]
- Mafra, I.; Honrado, M.; Amaral, J.S. Animal species authentication in dairy products. Foods 2022, 11, 1124–1155. [Google Scholar] [CrossRef]
- Woolfe, M.; Primrose, S. Box 1. Examples of premium foodstuffs. Trends Biotechnol. 2004, 22, 222. [Google Scholar]
- Li, B.; Yu, M.; Xu, W.; Chen, L.; Han, J. Comparison of PCR techniques in adulteration identification of dairy products. Agriculture 2023, 13, 1450–1462. [Google Scholar] [CrossRef]
- Baptista, M.; Cunha, J.T.; Domingues, L. DNA-based approaches for dairy products authentication: A review and perspectives. Trends Food Sci. Technol. 2021, 109, 386–397. [Google Scholar]
- Böhme, K.; Calo-Mata, P.; Barros-Velázquez, J.; Ortea, I. Review of recent DNA-based methods for main food-authentication topics. J. Agric. Food Chem. 2019, 67, 3854–3864. [Google Scholar] [CrossRef]
- Agrimonti, C.; Bottari, B.; Sardaro, M.L.S.; Marmiroli, N. Application of real-time PCR (qPCR) for characterization of microbial populations and type of milk in dairy food products. Crit. Rev. Food Sci. Nutr. 2019, 59, 423–442. [Google Scholar] [CrossRef]
- Kalogianni, D.P. DNA-based analytical methods for milk authentication. Eur. Food Res. Technol. 2018, 244, 775–793. [Google Scholar] [CrossRef]
- Liao, J.; Liu, Y.F.; Ku, T.; Liu, M.H.; Huang, Y. Qualitative and quantitative identification of adulteration of milk powder using DNA extracted with a novel method. J. Dairy Sci. 2017, 100, 1657–1663. [Google Scholar] [CrossRef]
- Ewida, R.M.; Abd El-Magiud, D.S.M. Species adulteration in raw milk samples using polymerase chain reaction-restriction fragment length polymorphism. Vet. World 2018, 11, 830–833. [Google Scholar] [CrossRef]
- Vafin, R.R.; Galstyan, A.G.; Tyulkin, S.V.; Gilmanov, K.K.; Yurova, E.A.; Semipyatniy, V.K.; Bigaeva, A.V. Species identification of ruminant milk by genotyping of the k-casein gene. J. Dairy Sci. 2022, 105, 1004–1113. [Google Scholar] [CrossRef]
- Cunha, J.T.; Ribeiro, T.I.B.; Rocha, J.B.; Nunes, J.; Teixeira, J.A.; Domingues, L. RAPD and SCAR markers as potential tools for detection of milk origin in dairy products: Adulterant sheep breeds in Serra da Estrela cheese production. Food Chem. 2016, 211, 631–636. [Google Scholar] [CrossRef]
- Ribani, A.; Schiavo, G.; Utzeri, V.J.; Bertolini, F.; Geraci, C.; Bovo, S.; Fontanesi, L. Application of next generation semiconductor based sequencing for species identification in dairy products. Food Chem. 2018, 246, 90–98. [Google Scholar] [CrossRef]
- Bottero, M.T.; Civera, T. A multiplex polymerase chain reaction for the identification of cow’s, goat’s and sheep’s milk in dairy products. Int. Dairy J. 2003, 13, 277–282. [Google Scholar] [CrossRef]
- Tsirigoti, E.; Katsirma, Z.; Papadopoulos, A.I.; Samouris, G.; Ekateriniadou, L.V.; Boukouvala, E. Application of triplex-PCR with an innovative combination of 3 pairs of primers for the detection of milk’s animal origin in cheese and yoghurt. J. Dairy Res. 2020, 87, 239–242. [Google Scholar] [CrossRef]
- Deng, L.; Li, A.L.; Gao, Y.; Shen, T.; Yue, H.T.; Miao, J.; Li, R.R.; Yang, J. Detection of the Bovine Milk Adulterated in Camel, Horse, and Goat Milk Using Duplex PCR. Food Anal. Method 2020, 13, 560–567. [Google Scholar] [CrossRef]
- Agrimonti, C.; Pirondini, A.; Marmiroli, M.; Marmiroli, N. A quadruplex PCR (qxPCR) assay for adulteration in dairy products. Food Chem. 2015, 187, 58–64. [Google Scholar] [CrossRef]
- Ganopoulos, I.; Sakaridis, I.; Argiriou, A.; Madesis, P.; Tsaftaris, A. A novel closed-tube method based on high resolution melting (HRM) analysis for authenticity testing and quantitative detection in Greek PDO Feta cheese. Food Chem. 2013, 141, 835–840. [Google Scholar] [CrossRef]
- Guo, L.; Qian, J.-P.; Guo, Y.-S.; Hai, X.; Liu, G.-Q.; Luo, J.X.; Ya, M. Simultaneous identification of bovine and equine DNA in milks and dairy products inferred from triplex TaqMan real-time PCR technique. J. Dairy Sci. 2018, 101, 6776–6786. [Google Scholar] [CrossRef]
- Guo, L.; Ya, M.; Hai, X.; Guo, Y.-S.; Li, C.-D.; Xu, W.-L.; Liao, C.-S.; Feng, W.; Cai, Q. A simultaneous triplex TaqMan real-time PCR approach for authentication of caprine and bovine meat, milk and cheese. Int. Dairy J. 2019, 95, 58–64. [Google Scholar] [CrossRef]
- Hai, X.; Liu, G.-Q.; Luo, J.-X.; Guo, Y.-S.; Qian, J.-P.; Ya, M.; Guo, L. Triplex real-time PCR assay for the authentication of camel-derived dairy and meat products. J. Dairy Sci. 2020, 103, 9841–9850. [Google Scholar] [CrossRef]
- Cutarelli, A.; Fulgione, A.; Fraulo, P.; Serpe, F.P.; Gallo, P.; Biondi, L.; Corrado, F.; Citro, A.; Capuano, F. Droplet Digital PCR (ddPCR) Analysis for the Detection and Quantification of Cow DNA in Buffalo Mozzarella Cheese. Animals 2021, 11, 1270–1280. [Google Scholar] [CrossRef]
- Korbie, D.J.; Mattick, J.S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 2008, 3, 1452–1456. [Google Scholar] [CrossRef]
- Bottero, M.T.; Dalmasso, A.; Nucera, D.; Turi, R.M.; Rosati, S.; Squadrone, S.; Goria, M.; Civera, T. Development of a PCR assay for the detection of animal tissues in ruminant feeds. J. Food Prot. 2003, 66, 2307–2312. [Google Scholar] [CrossRef]
- Herman, L. Determination of the animal origin of raw food by species-specific PCR. J. Dairy Res. 2001, 68, 429–436. [Google Scholar] [CrossRef]
- Commission Regulation (EC). No 273/2008 of 5 March 2008 laying down detailed rules for the application of Council Regulation (EC) No. 1255/1999 as regards methods for the analysis and quality evaluation of milk and milk products. Off. J. Eur. Union 2008, L 88, 1. [Google Scholar]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 54, 611–622. [Google Scholar] [CrossRef]
- Stolovitzky, G.; Cecchi, G. Efficiency of DNA replication in the polymerase chain reaction. Proc. Natl. Acad. Sci. USA 1996, 93, 12947–12952. [Google Scholar] [CrossRef]
- Di Pinto, A.; Terio, V.; Marchetti, P.; Bottaro, M.; Mottola, A.; Bozzo, G.; Bonerba, E.; Ceci, E.; Tantillo, G. DNA-based approach for species identification of goat-milk products. Food Chem. 2017, 229, 93–97. [Google Scholar] [CrossRef]
- Lopez-Calleja, I.M.; Gonzalez, I.; Fajardo, V.; Hernandez, P.E.; Garcia, T.; Martin, R. Application of an indirect ELISA and a PCR technique for detection of cows’ milk in sheep’s and goats’ milk cheeses. Int. Dairy J. 2007, 17, 87–93. [Google Scholar] [CrossRef]
- Rodrigues, M.S.; Morelli, K.A.; Jansen, A.M. Cytochrome c oxidase subunit 1 gene as a DNA barcode for discriminating Trypanosoma cruzi DTUs and closely related species. Parasit. Vectors 2017, 10, 488. [Google Scholar] [CrossRef]




| Sequence (cox1 Gene) | Product Length (bp) | Product Tm (°C) | |
|---|---|---|---|
| Bovine (Bos taurus) | |||
| Forward (5′→3′) | TTAATCTTACCTGGGTTTGGA | 120 | 79 |
| Reverse (5′→3′) | GAAACCTAGAAATCCGATTGAC | ||
| Extended primers bovine | |||
| Loop Forward (5′→3′) | GAAAGAAGGCGAGGACGGAAGAATGTGCGTCTCGCCTTCTTTCTTAATCTTACCTGGGTTTGGA | 173 | 82 |
| Extended Reverse (5′→3′) | ATTCATTATCATTCATTATCGAAACCTAGAAATCCGATTGAC | ||
| Goat (Capra hircus) | |||
| Forward (5′→3′) | CTTATTTTACCTGGATTTGGA | 124 | 80.5 |
| Reverse (5′→3′) | CAATAAATCCTAGAAACCCGA | ||
| Sheep (Ovis aries) | |||
| Forward (5′→3′) | TTTGGGATAATCTCCCATATT | 93 | 77 |
| Reverse (5′→3′) | CCCAATTGATATTATGGCTCAT | ||
| External Control (synthetic control) | |||
| Forward (5′→3′) | TGTTAGCAACTCTTCAAGTTCCCT | 128 | 86 |
| Reverse (5′→3′) | AGGCAGGTAGGGCTGGAACA | ||
| Cq1 | Cq2 | Cq3 | Mean Cq | SD | %RSD | |
|---|---|---|---|---|---|---|
| 1% cow–99% sheep | 8.15 | 9.11 | 7.68 | 8.31 | 0.60 | 7.16% |
| 5% cow–95% sheep | 9.88 | 9.84 | 9.35 | 9.69 | 0.24 | 2.49% |
| 1% cow–99% goat | 8.54 | 8.22 | 8.15 | 8.30 | 0.17 | 2.04% |
| 5% cow–95% goat | 8.41 | 8.66 | 8.71 | 8.59 | 0.13 | 1.53% |
| Sticks (IC bovino) | Total | |||
| 0 | 1 | |||
| TD-PCR Cow-goat assay | Negative | 5 | 0 | 5 |
| Adultarated samples | 2 | 3 | 5 | |
| K-cohen = 0.60 | ||||
| ELISA | Total | |||
| 0 | 1 | |||
| TD-PCR Cow-goat assay | Negative | 5 | 0 | 5 |
| Adultarated samples | 3 | 2 | 5 | |
| K-cohen = 0.40 | ||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kourkouli, A.; Thomaidis, N.; Dasenaki, M.; Markou, A. Novel and Sensitive Touchdown Polymerase Chain Reaction Assays for the Detection of Goat and Sheep Milk Adulteration with Cow Milk. Molecules 2024, 29, 1820. https://doi.org/10.3390/molecules29081820
Kourkouli A, Thomaidis N, Dasenaki M, Markou A. Novel and Sensitive Touchdown Polymerase Chain Reaction Assays for the Detection of Goat and Sheep Milk Adulteration with Cow Milk. Molecules. 2024; 29(8):1820. https://doi.org/10.3390/molecules29081820
Chicago/Turabian StyleKourkouli, Ariadni, Nikolaos Thomaidis, Marilena Dasenaki, and Athina Markou. 2024. "Novel and Sensitive Touchdown Polymerase Chain Reaction Assays for the Detection of Goat and Sheep Milk Adulteration with Cow Milk" Molecules 29, no. 8: 1820. https://doi.org/10.3390/molecules29081820
APA StyleKourkouli, A., Thomaidis, N., Dasenaki, M., & Markou, A. (2024). Novel and Sensitive Touchdown Polymerase Chain Reaction Assays for the Detection of Goat and Sheep Milk Adulteration with Cow Milk. Molecules, 29(8), 1820. https://doi.org/10.3390/molecules29081820

