Levistilide A Exerts a Neuroprotective Effect by Suppressing Glucose Metabolism Reprogramming and Preventing Microglia Polarization Shift: Implications for Parkinson’s Disease
Abstract
1. Introduction
2. Results
2.1. LA Inhibits the Production of Inflammatory Cytokines NO, IL-6 and TNF-α in LPS-Induced Microglia
2.2. LA Inhibits LPS-Induced ROS Production in Microglia
2.3. LA Inhibits Phosphorylation of IκB-α and Nuclear Translocation of NF-κB p65
2.4. LA Inhibits LPS-Induced Reprogramming of Microglia Glucose Metabolism
2.5. Targeted Metabolomic Analysis of LA on LPS-Stimulated BV-2 Cells
2.6. LA’s Impact on the AMPK/mTOR Signaling Pathway
2.7. The Conditioned Medium from LA-Treated Microglia Protects Neurons
2.8. LA Protects Dopaminergic Neurons and Inhibits Activation of Microglia in MPTP-Induced Parkinson Mice
3. Discussion
4. Experimental Procedures
4.1. Animals
4.2. Drug
4.3. Cell Culture
4.4. Cell Viability Assay, Detection of Nitric Oxide and Cytokines
4.5. RNA Isolation and Quantitative PCR
4.6. Flow Cytometry
4.7. EACR and OCR
4.8. Targeted Metabolomics Analysis
4.9. The Effect of Conditioned Medium on Neurons
4.10. Western Blotting
4.11. MPTP-Induced Mouse Parkinson Model
4.12. Immunohistochemistry
4.13. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tambasco, N.; Romoli, M.; Calabresi, P. Levodopa in Parkinson’s Disease: Current Status and Future Developments. Curr. Neuropharmacol. 2018, 16, 1239–1252. [Google Scholar] [CrossRef]
- Subhramanyam, C.S.; Wang, C.; Hu, Q.; Dheen, S.T. Microglia-mediated neuroinflammation in neurodegenerative diseases. Semin. Cell Dev. Biol. 2019, 94, 112–120. [Google Scholar] [CrossRef]
- Witcher, K.G.; Bray, C.E.; Chunchai, T.; Zhao, F.; O’Neil, S.M.; Gordillo, A.J.; Campbell, W.A.; McKim, D.B.; Liu, X.; Dziabis, J.E.; et al. Traumatic Brain Injury Causes Chronic Cortical Inflammation and Neuronal Dysfunction Mediated by Microglia. J. Neurosci. 2021, 41, 1597–1616. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Yu, S.; Lu, X.; Cui, K.; Tang, X.; Xu, Y.; Liang, X. The phase changes of M1/M2 phenotype of microglia/macrophage following oxygen-induced retinopathy in mice. Inflamm. Res. 2021, 70, 183–192. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Yuan, Y.H.; Chen, N.H.; Wang, H.B. The mechanisms of NLRP3 inflammasome/pyroptosis activation and their role in Parkinson’s disease. Int. Immunopharmacol. 2019, 67, 458–464. [Google Scholar] [CrossRef] [PubMed]
- Bu, P.; Chen, K.-Y.; Xiang, K.; Johnson, C.; Crown, S.B.; Rakhilin, N.; Ai, Y.; Wang, L.; Xi, R.; Astapova, I.; et al. Aldolase B-Mediated Fructose Metabolism Drives Metabolic Reprogramming of Colon Cancer Liver Metastasis. Cell Metab. 2018, 27, 1249–1262.e1244. [Google Scholar] [CrossRef]
- Rushing, B.R.; Tilley, S.; Molina, S.; Schroder, M.; Sumner, S. Commonalities in Metabolic Reprogramming between Tobacco Use and Oral Cancer. Int. J. Environ. Res. Public Health 2022, 19, 10261. [Google Scholar] [CrossRef]
- Gong, Z.; Li, Q.; Shi, J.; Liu, E.T.; Shultz, L.D.; Ren, G. Lipid-laden lung mesenchymal cells foster breast cancer metastasis via metabolic reprogramming of tumor cells and natural killer cells. Cell Metab. 2022, 34, 1960–1976.e1969. [Google Scholar] [CrossRef] [PubMed]
- Gimeno-Bayón, J.; López-López, A.; Rodríguez, M.; Mahy, N. Glucose pathways adaptation supports acquisition of activated microglia phenotype. J. Neurosci. Res. 2014, 92, 723–731. [Google Scholar] [CrossRef]
- Zhong, W.-J.; Liu, T.; Yang, H.-H.; Duan, J.-X.; Yang, J.-T.; Guan, X.-X.; Xiong, J.-B.; Zhang, Y.-F.; Zhang, C.-Y.; Zhou, Y.; et al. TREM-1 governs NLRP3 inflammasome activation of macrophages by firing up glycolysis in acute lung injury. Int. J. Biol. Sci. 2023, 19, 242–257. [Google Scholar] [CrossRef]
- Yang, S.-Y.; Lin, Z.-X.; Xian, Y.-F.; Zhang, H.-M.; Xu, H.-X. Traditional uses, chemical compounds, pharmacological activities and clinical studies on the traditional Chinese prescription Yi-Gan San. J. Ethnopharmacol. 2023, 302 Pt A, 115859. [Google Scholar] [CrossRef]
- Zhang, K.X.; Yan, M.L.; Han, S.; Cong, L.F.; Wang, L.Y.; Zhang, L.; Sun, L.L.; Bai, H.Y.; Wei, G.H.; Du, H.; et al. Identification of Chemical Markers for the Discrimination of Radix Angelica sinensis Grown in Geoherb and Non-Geoherb Regions Using UHPLC-QTOF-MS/MS Based Metabolomics. Molecules 2019, 24, 3536. [Google Scholar] [CrossRef]
- Guo, H.; Sun, L.; Ling, S.; Xu, J.W. Levistilide A Ameliorates NLRP3 Expression Involving the Syk-p38/JNK Pathway and Peripheral Obliterans in Rats. Mediat. Inflamm. 2018, 2018, 7304096. [Google Scholar] [CrossRef]
- Ni, H.; Liao, Y.; Zhang, Y.; Lu, H.; Huang, Z.; Huang, F.; Zhang, Z.; Dong, Y.; Wang, Z.; Huang, Y. Levistilide A ameliorates neuroinflammation via inhibiting JAK2/STAT3 signaling for neuroprotection and cognitive improvement in scopolamine-induced Alzheimer’s disease mouse model. Int. Immunopharmacol. 2023, 124 Pt A, 110783. [Google Scholar] [CrossRef]
- Samii, A.; Nutt, J.G.; Ransom, B.R. Parkinson’s disease. Lancet 2004, 363, 1783–1793. [Google Scholar] [CrossRef]
- Mustapha, M.; Mat Taib, C.N. MPTP-induced mouse model of Parkinson’s disease: A promising direction of therapeutic strategies. Bosn J. Basic Med. Sci. 2021, 21, 422–433. [Google Scholar]
- Zhao, Y.; Zhang, J.; Zheng, Y.; Zhang, Y.; Zhang, X.J.; Wang, H.; Du, Y.; Guan, J.; Wang, X.; Fu, J. NAD(+) improves cognitive function and reduces neuroinflammation by ameliorating mitochondrial damage and decreasing ROS production in chronic cerebral hypoperfusion models through Sirt1/PGC-1α pathway. J. Neuroinflammation 2021, 18, 207. [Google Scholar] [CrossRef]
- Cheng, J.; Zhang, R.; Xu, Z.; Ke, Y.; Sun, R.; Yang, H.; Zhang, X.; Zhen, X.; Zheng, L.-T. Early glycolytic reprogramming controls microglial inflammatory activation. J. Neuroinflammation 2021, 18, 129. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Chang, Q.; Sun, T.; He, X.; Wen, L.; An, J.; Feng, J.; Zhao, Y. Metabolic reprogramming and polarization of microglia in Parkinson’s disease: Role of inflammasome and iron. Ageing Res. Rev. 2023, 90, 102032. [Google Scholar] [CrossRef] [PubMed]
- Rabaneda-Lombarte, N.; Blasco-Agell, L.; Serratosa, J.; Ferigle, L.; Saura, J.; Solà, C. Parkinsonian neurotoxicants impair the anti-inflammatory response induced by IL4 in glial cells: Involvement of the CD200-CD200R1 ligand-receptor pair. Sci. Rep. 2020, 10, 10650. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Pavlou, S.; Du, X.; Bhuckory, M.; Xu, H.; Chen, M. Glucose transporter 1 critically controls microglial activation through facilitating glycolysis. Mol. Neurodegener. 2019, 14, 2. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Lin, F.; Wan, T.; Chen, A.; Wang, H.; Jiang, B.; Zhao, W.; Liao, S.; Wang, S.; Li, G.; et al. ZEB1 enhances Warburg effect to facilitate tumorigenesis and metastasis of HCC by transcriptionally activating PFKM. Theranostics 2021, 11, 5926–5938. [Google Scholar] [CrossRef] [PubMed]
- Matsuura, Y.; Shimizu-Albergine, M.; Barnhart, S.; Kramer, F.; Hsu, C.-C.; Kothari, V.; Tang, J.; Gharib, S.A.; Kanter, J.E.; Abel, E.D.; et al. Diabetes Suppresses Glucose Uptake and Glycolysis in Macrophages. Circ. Res. 2022, 130, 779–781. [Google Scholar] [CrossRef] [PubMed]
- Benito, A.; Hajji, N.; O’Neill, K.; Keun, H.C.; Syed, N. β-Hydroxybutyrate Oxidation Promotes the Accumulation of Immunometabolites in Activated Microglia Cells. Metabolites 2020, 10, 346. [Google Scholar] [CrossRef] [PubMed]
- Tannahill, G.M.; Curtis, A.M.; Adamik, J.; Palsson-McDermott, E.M.; McGettrick, A.F.; Goel, G.; Frezza, C.; Bernard, N.J.; Kelly, B.; Foley, N.H.; et al. Succinate is an inflammatory signal that induces IL-1β through HIF-1α. Nature 2013, 496, 238–242. [Google Scholar] [CrossRef]
- Stepanov, Y.V.; Golovynska, I.; Zhang, R.; Golovynskyi, S.; Stepanova, L.I.; Gorbach, O.; Dovbynchuk, T.; Garmanchuk, L.V.; Ohulchanskyy, T.Y.; Qu, J. Near-infrared light reduces β-amyloid-stimulated microglial toxicity and enhances survival of neurons: Mechanisms of light therapy for Alzheimer’s disease. Alzheimer’s Res. Ther. 2022, 14, 84. [Google Scholar] [CrossRef]
- Ding, Y.; Niu, W.; Zhang, T.; Wang, J.; Cao, J.; Chen, H.; Wang, R.; An, H. Levistolide A synergistically enhances doxorubicin-induced apoptosis of k562/dox cells by decreasing MDR1 expression through the ubiquitin pathway. Oncol. Rep. 2019, 41, 1198–1208. [Google Scholar] [CrossRef]
- Yang, Y.; Zhang, Y.; Wang, L.; Lee, S. Levistolide A Induces Apoptosis via ROS-Mediated ER Stress Pathway in Colon Cancer Cells. Cell. Physiol. Biochem. 2017, 42, 929–938. [Google Scholar] [CrossRef] [PubMed]
- Qu, X.; Guan, P.; Han, L.; Wang, Z.; Huang, X. Levistolide A Attenuates Alzheimer’s Pathology Through Activation of the PPARγ Pathway. Neurotherapeutics 2021, 18, 326–339. [Google Scholar] [CrossRef]
- Noda, T.; Shiga, H.; Yamada, K.; Harita, M.; Nakamura, Y.; Ishikura, T.; Kumai, M.; Kawakami, Z.; Kaneko, A.; Hatta, T.; et al. Effects of Tokishakuyakusan on Regeneration of Murine Olfactory Neurons In Vivo and In Vitro. Chem. Senses 2019, 44, 327–338. [Google Scholar] [CrossRef] [PubMed]
- Simon, D.K.; Tanner, C.M.; Brundin, P. Parkinson Disease Epidemiology, Pathology, Genetics, and Pathophysiology. Clin. Geriatr. Med. 2020, 36, 1–12. [Google Scholar] [CrossRef]
- Mor, D.E.; Sohrabi, S.; Kaletsky, R.; Keyes, W.; Tartici, A.; Kalia, V.; Miller, G.W.; Murphy, C.T. Metformin rescues Parkinson’s disease phenotypes caused by hyperactive mitochondria. Proc. Natl. Acad. Sci. USA 2020, 117, 26438–26447. [Google Scholar] [CrossRef]
- Nayak, D.; Roth, T.L.; McGavern, D.B. Microglia development and function. Annu. Rev. Immunol. 2014, 32, 367–402. [Google Scholar] [CrossRef]
- Wolf, S.A.; Boddeke, H.W.G.M.; Kettenmann, H. Microglia in Physiology and Disease. Annu. Rev. Physiol. 2017, 79, 619–643. [Google Scholar] [CrossRef] [PubMed]
- Zusso, M.; Lunardi, V.; Franceschini, D.; Pagetta, A.; Lo, R.; Stifani, S.; Frigo, A.C.; Giusti, P.; Moro, S. Ciprofloxacin and levofloxacin attenuate microglia inflammatory response via TLR4/NF-kB pathway. J. Neuroinflammation 2019, 16, 148. [Google Scholar] [CrossRef] [PubMed]
- Liao, S.; Wu, J.; Liu, R.; Wang, S.; Luo, J.; Yang, Y.; Qin, Y.; Li, T.; Zheng, X.; Song, J.; et al. A novel compound DBZ ameliorates neuroinflammation in LPS-stimulated microglia and ischemic stroke rats: Role of Akt(Ser473)/GSK3β(Ser9)-mediated Nrf2 activation. Redox Biol. 2020, 36, 101644. [Google Scholar] [CrossRef] [PubMed]
- Block, M.L.; Hong, J.-S. Microglia and inflammation-mediated neurodegeneration: Multiple triggers with a common mechanism. Prog. Neurobiol. 2005, 76, 77–98. [Google Scholar] [CrossRef]
- Neumann, J.; Sauerzweig, S.; Rönicke, R.; Gunzer, F.; Dinkel, K.; Ullrich, O.; Gunzer, M.; Reymann, K.G. Microglia cells protect neurons by direct engulfment of invading neutrophil granulocytes: A new mechanism of CNS immune privilege. J. Neurosci. 2008, 28, 5965–5975. [Google Scholar] [CrossRef]
- Chen, J.; Mao, K.; Yu, H.; Wen, Y.; She, H.; Zhang, H.; Liu, L.; Li, M.; Li, W.; Zou, F. p38-TFEB pathways promote microglia activation through inhibiting CMA-mediated NLRP3 degradation in Parkinson’s disease. J. Neuroinflammation 2021, 18, 295. [Google Scholar] [CrossRef]
- Korshoj, L.E.; Kielian, T. Neuroimmune metabolism: Uncovering the role of metabolic reprogramming in central nervous system disease. J. Neurochem. 2021, 158, 8–13. [Google Scholar] [CrossRef]
- Luo, G.; Wang, X.; Cui, Y.; Cao, Y.; Zhao, Z.; Zhang, J. Metabolic reprogramming mediates hippocampal microglial M1 polarization in response to surgical trauma causing perioperative neurocognitive disorders. J. Neuroinflammation 2021, 18, 267. [Google Scholar] [CrossRef]
- Gu, R.; Zhang, F.; Chen, G.; Han, C.; Liu, J.; Ren, Z.; Zhu, Y.; Waddington, J.L.; Zheng, L.T.; Zhen, X. Clk1 deficiency promotes neuroinflammation and subsequent dopaminergic cell death through regulation of microglial metabolic reprogramming. Brain Behav. Immun. 2017, 60, 206–219. [Google Scholar] [CrossRef] [PubMed]
- Sur, S.; Nakanishi, H.; Flaveny, C.; Ippolito, J.E.; McHowat, J.; Ford, D.A.; Ray, R.B. Inhibition of the key metabolic pathways, glycolysis and lipogenesis, of oral cancer by bitter melon extract. Cell Commun. Signal. 2019, 17, 131. [Google Scholar] [CrossRef] [PubMed]
- Barisciano, G.; Colangelo, T.; Rosato, V.; Muccillo, L.; Taddei, M.L.; Ippolito, L.; Chiarugi, P.; Galgani, M.; Bruzzaniti, S.; Matarese, G.; et al. miR-27a is a master regulator of metabolic reprogramming and chemoresistance in colorectal cancer. Br. J. Cancer 2020, 122, 1354–1366. [Google Scholar] [CrossRef]
- Brás, J.P.; Bravo, J.; Freitas, J.; Barbosa, M.A.; Santos, S.G.; Summavielle, T.; Almeida, M.I. TNF-alpha-induced microglia activation requires miR-342: Impact on NF-kB signaling and neurotoxicity. Cell Death Dis. 2020, 11, 415. [Google Scholar] [CrossRef] [PubMed]
- Yan, A.; Liu, Z.; Song, L.; Wang, X.; Zhang, Y.; Wu, N.; Lin, J.; Liu, Y.; Liu, Z. Idebenone Alleviates Neuroinflammation and Modulates Microglial Polarization in LPS-Stimulated BV2 Cells and MPTP-Induced Parkinson’s Disease Mice. Front. Cell Neurosci. 2018, 12, 529. [Google Scholar] [CrossRef]
- Wada, M.; Ang, M.J.; Weerasinghe-Mudiyanselage, P.D.E.; Kim, S.H.; Kim, J.C.; Shin, T.; Moon, C. Behavioral characterization in MPTP/p mouse model of Parkinson’s disease. J. Integr. Neurosci. 2021, 20, 307–320. [Google Scholar] [CrossRef]
- Guo, T.; Liu, Z.-L.; Zhao, Q.; Zhao, Z.-M.; Liu, C.-H. A combination of astragaloside I, levistilide A and calycosin exerts anti-liver fibrosis effects in vitro and in vivo. Acta Pharmacol. Sin. 2018, 39, 1483–1492. [Google Scholar] [CrossRef]
Gene | Primer Pair (5′-3′) | Accession ID |
---|---|---|
GAPDH | F: CTTCACCACCATGGAGAAGGC R: GGCATGGACTGTGGTCATGAG | XM_001476707.5 |
iNOS | F: GGCAGCCTGTGAGACCTTTG R: GCATTGGAAGTGAAGCGTTTC | XM_006532446.3 |
TNF-α | F: CGGGGTGATCGGTCCCCAAAG R: GGAGGGCGTTGGCGCGCTGG | NM_001278601.1 |
IL-6 | F: CCAGAGATACAAAGAAATGATGG R: ACTCCAGAAGACCAGAGGAAA | NM_001314054.1 |
IL-1β | F: CGCAGCAGCACATCAACAAGAGC R: TGTCCTCATCCTGGAAGGTCCACG | XM_006498795.3 |
IL-1Ra | F: AAGCCTTCAGAATCTGGGATAC R: TCATCTCCAGACTTGGCACA | NM_001159562.1 |
Ym1 | F:TCACTTACACACATGAGCAAGAC R: CGGTTCTGAGGAGTAGAGACCA | NM_009892.3 |
Arg1 | F: GGAAGACAGCAGAGGAGGTG R: TATGGTTACCCTCCCGTTGA | NM_007482.3 |
IL-10 | F: GCTCTTACTGACTGGCATGAG R: CGCAGCTCTAGGAGCATGTG | NM_010548.2 |
β-actin | F: AGAGGGAAATCGTGCGTGACATCAA R: ATACCCAAGAAGGAAGGCTGGAAAA | NM_007393.5 |
HK1 | F: TGCCATGCGGCTCTCTGATG R: CTTGACGGAGGCCGTTGGGTT | NM_010438.3 |
PKM2 | F: AGGATGCCGTGCTGAATG R: TAGAAGAGGGGCTCCAGAGG | NM_011099.4 |
HK2 | F: TCATTGTTGGCACTGGAAGC R: TTGCCAGGGTTGAGAGAGAG | NM_013820.3 |
GLUT-1 | F: CAGTTCGGCTATAACACTGGTG R: GCCCCCGACAGAGAAGATG | NM_011400.3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, M.; Duan, C.; Lin, W.; Wu, H.; Chen, L.; Guo, H.; Yu, M.; Liu, Q.; Nie, Y.; Wang, H.; et al. Levistilide A Exerts a Neuroprotective Effect by Suppressing Glucose Metabolism Reprogramming and Preventing Microglia Polarization Shift: Implications for Parkinson’s Disease. Molecules 2024, 29, 912. https://doi.org/10.3390/molecules29040912
Zhang M, Duan C, Lin W, Wu H, Chen L, Guo H, Yu M, Liu Q, Nie Y, Wang H, et al. Levistilide A Exerts a Neuroprotective Effect by Suppressing Glucose Metabolism Reprogramming and Preventing Microglia Polarization Shift: Implications for Parkinson’s Disease. Molecules. 2024; 29(4):912. https://doi.org/10.3390/molecules29040912
Chicago/Turabian StyleZhang, Mingjie, Congyan Duan, Weifang Lin, Honghua Wu, Lu Chen, Hong Guo, Minyu Yu, Qi Liu, Yaling Nie, Hong Wang, and et al. 2024. "Levistilide A Exerts a Neuroprotective Effect by Suppressing Glucose Metabolism Reprogramming and Preventing Microglia Polarization Shift: Implications for Parkinson’s Disease" Molecules 29, no. 4: 912. https://doi.org/10.3390/molecules29040912
APA StyleZhang, M., Duan, C., Lin, W., Wu, H., Chen, L., Guo, H., Yu, M., Liu, Q., Nie, Y., Wang, H., & Wang, S. (2024). Levistilide A Exerts a Neuroprotective Effect by Suppressing Glucose Metabolism Reprogramming and Preventing Microglia Polarization Shift: Implications for Parkinson’s Disease. Molecules, 29(4), 912. https://doi.org/10.3390/molecules29040912