Synergistic Effects of Pyrrosia lingua Caffeoylquinic Acid Compounds with Levofloxacin Against Uropathogenic Escherichia coli: Insights from Molecular Dynamics Simulations, Antibiofilm, and Antimicrobial Assessments
Abstract
1. Introduction
2. Results and Discussion
2.1. Enhanced Antibacterial Activity of Caffeoylquinic Acid Compounds Combined with Levofloxacin Hydrochloride at Various Concentrations
2.2. Synergetic Antibacterial and Antibiofilm Activities of Caffeoylquinic Acid Compounds and Levofloxacin Hydrochloride
2.3. Swimming Motility Inhibition Activities of Caffeoylquinic Acid Compounds and Levofloxacin Hydrochloride
2.4. Intracellular c-di-GMP Concentrations Regulated by Caffeoylquinic Acid Compounds and Levofloxacin Hydrochloride
2.5. Significant Reduction in YcgR Flexibility Due to Ligand Binding
2.6. The Binding Mechanism of YcgR and Caffeoylquinic Acid Compounds
2.7. The Hotspot Residues in YcgR-Ligand Binding
2.8. The Binding Mechanisms Between YcgR and Ligands
3. Materials and Methods
3.1. Molecular Docking Study
3.2. In Vitro Antibacterial Assay
3.2.1. Instruments and Chemicals
3.2.2. Disk Diffusion Method
3.2.3. Minimum Inhibitory Concentration
3.2.4. Microdilution Checkerboard Method
3.2.5. Crystal Violet Assay
3.2.6. Swimming Motility Assay
3.2.7. Extraction and Quantification of c-di-GMP
3.2.8. qRT-PCR Analysis
3.3. Molecular Dynamics Simulations
3.4. Molecular Mechanics Generalized Born Surface Area Calculation
3.5. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Naziri, Z.; Kilegolan, J.A.; Moezzi, M.S.; Derakhshandeh, A. Biofilm formation by uropathogenic Escherichia coli: A complicating factor for treatment and recurrence of urinary tract infections. J. Hosp. Infect. 2021, 117, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Boya, B.R.; Lee, J.H.; Lee, J. Antibiofilm and antimicrobial activities of chloroindoles against uropathogenic Escherichia coli. Front. Microbiol. 2022, 13, 872943. [Google Scholar] [CrossRef] [PubMed]
- Murray, B.O.; Flores, C.; Williams, C.; Flusberg, D.A.; Marr, E.E.; Kwiatkowska, K.M.; Charest, J.L.; Isenberg, B.C.; Rohn, J.L. Recurrent Urinary Tract Infection: A Mystery in Search of Better Model Systems. Front. Cell. Infect. Microbiol. 2021, 11, 691210. [Google Scholar] [CrossRef]
- Aziminia, N.; Hadjipavlou, M.; Philippou, Y.; Pandian, S.S.; Malde, S.; Hammadeh, M.Y. Vaccines for the prevention of recurrent urinary tract infections: A systematic review. BJU Int. 2019, 123, 753–768. [Google Scholar] [CrossRef] [PubMed]
- Whelan, S.; O’Grady, M.C.; Corcoran, G.D.; Finn, K.; Lucey, B. Effect of sub-inhibitory concentrations of nitrofurantoin, ciprofloxacin, and trimethoprim on in vitro biofilm formation in uropathogenic Escherichia coli (UPEC). Med. Sci. 2022, 11, 1. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Zuying, Z.; Lin, Z.; Zipeng, G.; Yueting, L.; Yang, J.; Yong, H.; Mingyan, C. Urinary tract infections caused by uropathogenic Escherichia coli: Mechanisms of infection and treatment options. Int. J. Mol. Sci. 2023, 24, 10537. [Google Scholar] [CrossRef]
- Fang, X.; Gomelsky, M. A post-translational, c-di-gmp-dependent mechanism regulating flagellar motility. Mol. Microbiol. 2010, 76, 1295–1305. [Google Scholar] [CrossRef]
- Han, Q.; Wang, S.F.; Qian, X.X.; Guo, L.; Shi, Y.F.; He, R.; Yuan, J.H.; Hou, Y.J.; Li, D.F. Flagellar brake protein ycgr interacts with motor proteins mota and flig to regulate the flagellar rotation speed and direction. Front. Microbiol. 2023, 14, 1159974. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Liu, M.; Yu, C.; Li, J.; Zhou, X. Biofilm formation: Mechanistic insights and therapeutic targets. Mol. Biomed. 2023, 4, 49. [Google Scholar] [CrossRef] [PubMed]
- Hou, Y.J.; Yang, W.S.; Hong, Y.; Zhang, Y.; Wang, D.C.; Li, D.F. Structural insights into the mechanism of c-di-gmp-bound ycgr regulating flagellar motility in Escherichia coli. J. Biol. Chem. 2020, 295, 808–821. [Google Scholar] [CrossRef] [PubMed]
- Topa, S.H.; Subramoni, S.; Palombo, E.A.; Kingshott, P.; Rice, S.A.; Blackall, L.L. Cinnamaldehyde disrupts biofilm formation and swarming motility of Pseudomonas aeruginosa. Microbiology 2018, 164, 1087–1097. [Google Scholar] [CrossRef]
- Rasamiravaka, T.; Labtani, Q.; Duez, P.; El, J.M. The formation of biofilms by Pseudomonas aeruginosa: A review of the natural and synthetic compounds interfering with control mechanisms. Biomed. Res. Int. 2015, 2015, 759348. [Google Scholar] [CrossRef] [PubMed]
- Hultqvist, L.D.; Andersen, J.B.; Nilsson, C.M.; Jansen, C.U.; Rybtke, M.; Jakobsen, T.H.; Nielsen, T.E.; Qvortrup, K.; Moser, C.; Graz, M.; et al. High efficacy treatment of murine Pseudomonas aeruginosa catheter-associated urinary tract infections using the c-di-gmp modulating anti-biofilm compound disperazol in combination with ciprofloxacin. Antimicrob. Agents Chemother. 2024, 68, e0148123. [Google Scholar] [CrossRef]
- Qin, T.; Chen, K.; Xi, B.; Pan, L.; Xie, J.; Lu, L.; Liu, K. In vitro antibiofilm activity of resveratrol against Aeromonas hydrophila. Antibiotics 2023, 12, 4. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.S.; Ham, S.Y.; Ryoo, H.S.; Kim, D.H.; Yun, E.T.; Park, H.D.; Park, J.H. Inhibiting bacterial biofilm formation by stimulating c-di-gmp regulation using citrus peel extract from Jeju Island. Sci. Total Environ. 2023, 872, 162180. [Google Scholar] [CrossRef]
- van Wietmarschen, H.; van Steenbergen, N.; van der Werf, E.; Baars, E. Effectiveness of herbal medicines to prevent and control symptoms of urinary tract infections and to reduce antibiotic use: A literature review. Integr. Med. Res. 2022, 11, 100892. [Google Scholar] [CrossRef] [PubMed]
- Zuvairiya, A.; Lydia, M.A.; Gayathri, J.; Gayathri, N.; Kasipandi, M.; Saikumar, S.; Parimelazhagan, T. Evaluation of an edible polyherbal formulation against urinary tract infection pathogens, its antioxidant and anti-inflammatory potential. Biocatal. Agric. Biotechnol. 2021, 35, 102104. [Google Scholar]
- Barrett, P.; Flower, A.; Lo, V. What’s past is prologue: Chinese medicine and the treatment of recurrent urinary tract infections. J. Ethnopharmacol. 2015, 167, 86–96. [Google Scholar] [CrossRef] [PubMed]
- Chang, J.; Sui, Y.; Sun, W.J.; He, H.J.; Hu, S.Y.; Tong, P.Z.; Yi, X.; Yang, W.D.; Long, Y. Effective Components and Mechanism of Miao Medicine Herb Pyrrosia petiolosa (Christ) Ching in Lowering Blood Glucose. Pharmacol. Clin. Chin. Mater. Medica 2023, 39, 75–81. [Google Scholar]
- Hu, Y.; Chen, F.; Long, Y.; Yu, X.; Wu, J.; Luo, G.; Yang, W. Chemical Constituents from Promoting Diuresis and Relieving Stranguria Effective Part of Pyrrosia petiolosa in Guizhou (II). J. Chin. Med. Mater. 2021, 44, 1386–1391. [Google Scholar]
- Xi, L.; Mu, T.; Sun, H. Progresses in the Research of Chlorogenic Acids. J. Nucl. Agric. Sci. 2014, 28, 292–301. [Google Scholar]
- Gupta, A.; Atanasov, A.G.; Li, Y.; Kumar, N.; Bishayee, A. Chlorogenic acid for cancer prevention and therapy: Current status on efficacy and mechanisms of action. Pharmacol. Res. 2022, 186, 106505. [Google Scholar] [CrossRef] [PubMed]
- Bai, P.; Zhang, C.; Xu, M.; Li, Y. Biological function of chlorogenic acid compounds and its application in animal husbandry production. Feed Res. 2022, 45, 127–130. [Google Scholar]
- Chai, B.; Jiang, W.; Hu, M.; Wu, Y.; Si, H. In vitro synergistic interactions of protocatechuic acid and chlorogenic acid in combination with antibiotics against animal pathogens. Synergy 2019, 9, 100055. [Google Scholar] [CrossRef]
- Chai, B.; Jiang, W.; Wang, L.; Hu, M.; Zhao, Y.; Wu, Y.; Si, H. Antibacterial effects of protocatechuic acid and chlorogenic acid combined with antibiotics against fish-source Streptococcus. J. South. Agric. 2018, 49, 580–585. [Google Scholar]
- Chen, F.; Luo, G.; Yang, W. Chemical Constituents from Promoting Diuresis and Relieving Stranguria Effective Part of Pyrrosia petiolosa in Guizhou. J. Chin. Med. Mater. 2019, 42, 2822–2826. [Google Scholar]
- Wu, X.; Hu, Y.; Zhang, Y.; Long, Y.; Wu, J.; Luo, G.; Yang, W. Chemical Constituents of the Effective Part of Promoting Diuresis and Relieving Stranguria of Pyrrosia petiolosa in Guizhou (III). J. Chin. Med. Mater. 2022, 45, 1861–1865. [Google Scholar]
- Sastry, G.M.; Adzhigirey, M.; Day, T.; Annabhimoju, R.; Sherman, W. Protein and ligand preparation: Parameters, protocols, and influence on virtual screening enrichments. J. Comput. Aided. Mol. Des. 2013, 27, 221–234. [Google Scholar] [CrossRef] [PubMed]
- Kaminski, G.A.; Friesner, R.A.; Tirado-Rives, J.; Jorgensen, W.L. Evaluation and reparametrization of the opls-aa force field for proteins via comparison with accurate quantum chemical calculations on peptides. J. Phys. Chem. B 2001, 105, 6474–6487. [Google Scholar] [CrossRef]
- Ngamsurach, P.; Praipipat, P. Comparative antibacterial activities of Garcinia cowa and Piper sarmentosum extracts against Staphylococcus aureus and Escherichia coli with studying on disc diffusion assay, material characterizations, and batch experiments. Heliyon 2022, 8, e11704. [Google Scholar] [CrossRef]
- Lazou, T.P.; Chaintoutis, S.C. Comparison of disk diffusion and broth microdilution methods for antimicrobial susceptibility testing of campylobacter isolates of meat origin. J. Microbiol. Methods 2023, 204, 106649. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, G.M.; Silva, B.A.; Xavier, R.; Zanon, I.P.; Vilela, E.G.; Nicolino, R.R.; Tavares, G.C.; Silva, R. Evaluation of disk diffusion method for testing the rifampicin, erythromycin, and tetracycline susceptibility of Clostridioides (prev. Clostridium) difficile. Anaerobe 2023, 80, 102720. [Google Scholar] [CrossRef] [PubMed]
- Cordovana, M.; Ambretti, S. Antibiotic susceptibility testing of anaerobic bacteria by broth microdilution method using the micronaut-s anaerobes mic plates. Anaerobe 2020, 63, 102217. [Google Scholar] [CrossRef]
- Lin, H.; Liang, Y.; Kaliaperumal, K.; Xiong, Q.; Duan, S.; Jiang, Y.; Zhang, J. Linoleic acid from the endophytic fungus Diaporthe sp. Ht-79 inhibits the growth of Xanthomonas citri subsp. citri by destructing the cell membrane and producing reactive oxygen species (ros). Pest. Biochem. Physiol. 2023, 192, 105423. [Google Scholar]
- Yu, W.; Shen, P.; Bao, Z.; Zhou, K.; Zheng, B.; Ji, J.; Guo, L.; Huang, C.; Xiao, Y. In vitro antibacterial activity of fosfomycin combined with other antimicrobials against kpc-producing Klebsiella pneumoniae. Int. J. Antimicrob. Agents 2017, 50, 237–241. [Google Scholar] [CrossRef] [PubMed]
- European Committee for Antimicrobial Susceptibility Testing (EUCAST) of the European Society of Clinical Microbiology and Infectious Diseases (ESCMID). Terminology Relating to Methods for the Determination of Susceptibility of Bacteria to Antimicrobial Agents. Clin. Microbiol. Infect. 2000, 6, 503–508. [Google Scholar] [CrossRef]
- Bai, J.-R.; Zhong, K.; Wu, Y.-P.; Grosu, E.; Gao, H. Antibiofilm activity of shikimic acid against Staphylococcus aureus. Food Control 2019, 95, 327–333. [Google Scholar] [CrossRef]
- Ashkezari, S.; Abtahi, M.S.; Sattari, Z.; Yaraki, M.T.; Hosseini, F.; Salehi, R.I.; Afzali, E.; Hajihosseini, S.; Mousavi-Niri, N. Antibiotic and inorganic nanoparticles co-loaded into carboxymethyl chitosan-functionalized niosome: Synergistic enhanced antibacterial and anti-biofilm activities. J. Drug Deliv. Sci. Technol. 2023, 83, 104386. [Google Scholar] [CrossRef]
- Tan, Y.; Leonhard, M.; Moser, D.; Schneider-Stickler, B. Inhibition activity of lactobacilli supernatant against fungal-bacterial multispecies biofilms on silicone. Microb. Pathog. 2017, 113, 197–201. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.; Ma, L.; Qin, Q.; Qiu, Y.; Zhang, J.; Li, J.; Lou, J.; Diao, B.; Zhao, H.; Shi, Q.; et al. Fur represses vibrio cholerae biofilm formation via direct regulation of viesab, cdgd, vpsu, and vpsa-k transcription. Front. Microbiol. 2020, 11, 587159. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Cai, L.; Luo, X.; Li, X.; Zhang, T.; Wu, F.; Zhang, Y.; Lu, R. Effect of sublethal dose of chloramphenicol on biofilm formation and virulence in Vibrio parahaemolyticus. Front. Microbiol. 2023, 14, 1275441. [Google Scholar] [CrossRef]
- Yu, L.; Zhang, S.; Xu, Y.; Mi, X.; Xing, T.; Li, J.; Zhang, L.; Gao, F.; Jiang, Y. Acid resistance of E. coli o157:h7 and o26:h11 exposure to lactic acid revealed by transcriptomic analysis. LWT Food Sci. Technol. 2021, 136 Pt 2, 110352. [Google Scholar] [CrossRef]
- Case, D.A.; Aktulga, H.M.; Belfon, K.; Ben-Shalom, I.; Brozell, S.R.; Cerutti, D.S.; Cheatham, T.E., III; Cruzeiro, V.W.D.; Darden, T.A.; Duke, R.E.; et al. Amber 2021; University of California: San Francisco, CA, USA, 2021. [Google Scholar]
- Maier, J.A.; Martinez, C.; Kasavajhala, K.; Wickstrom, L.; Hauser, K.E.; Simmerling, C. Ff14sb: Improving the accuracy of protein side chain and backbone parameters from ff99sb. J. Chem. Theory Comput. 2015, 11, 3696–3713. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Wolf, R.M.; Caldwell, J.W.; Kollman, P.A.; Case, D.A. Development and testing of a general amber force field. J. Comput. Chem. 2004, 25, 1157–1174. [Google Scholar] [CrossRef] [PubMed]
- Jorgensen, W.L.; Chandrasekhar, J.; Madura, J.D.; Impey, R.W.; Klein, M.L. Comparison of simple potential functions for simulating liquid water. J. Chem. Phys. 1983, 79, 926–935. [Google Scholar] [CrossRef]
- Essmann, U.; Perera, L.; Berkowitz, M.L.; Darden, T.; Lee, H.; Pedersen, L.G. A smooth particle mesh ewald method. J. Chem. Phys. 1995, 103, 8577–8593. [Google Scholar] [CrossRef]
- Ryckaert, J.; Ciccotti, G.; Berendsen, H.J. Numerical integration of the cartesian equations of motion of a system with constraints: Molecular dynamics of n-alkanes. J. Comput. Phys. 1977, 23, 327–341. [Google Scholar] [CrossRef]
- Genheden, S.; Ryde, U. The mm/pbsa and mm/gbsa methods to estimate ligand-binding affinities. Expert Opin. Drug Discov. 2015, 10, 449–461. [Google Scholar] [CrossRef] [PubMed]
Concentration (μg/mL) | Inhibition Zone Diameters (mm) a | ||||||
---|---|---|---|---|---|---|---|
CGA | Si-A5 | CAM | LEV | LEV + CGA | LEV + Si-A5 | LEV + CAM | |
25 b | - | - | - | 15.5 ± 0.1 | 17.1 ± 0.5 ** | 16.6 ± 0.2 ** | 16.4 ± 0.2 ** |
50 | - | - | - | 16.5 ± 0.4 | 19.3 ± 0.8 ** | 19.7 ± 0.4 ** | 17.0 ± 0.2 |
100 | - | - | - | 20.4 ± 0.5 | 23.6 ± 0.2 ** | 23.4 ± 0.2 ** | 24.7 ± 0.7 ** |
200 | - | - | - | 26.3 ± 0.3 | 27.7 ± 0.3 * | 27.0 ± 0.3 | 27.8 ± 1.1 * |
400 | - | - | - | 27.7 ± 0.2 | 29.3 ± 0.1 | 30.6 ± 1.8 ** | 29.6 ± 0.5 * |
MIC c | - | - | - | 16.3 ± 0.4 | 16.4 ± 0.4 | 17.9 ± 0.7 * | 19.2 ± 0.7 ** |
Strain | MIC (μg/mL) | FIC | MIC (μg/mL) | FIC | MIC (μg/mL) | FIC | ||||
---|---|---|---|---|---|---|---|---|---|---|
LEV | CGA | LEV + CGA | Si-A5 | LEV + Si-A5 | CAM | LEV + CAM | ||||
E. coli ATCC 10389 | 6.25 | 250 | 0.78 + 62.50 | 0.38 | 250 | 0.78 + 31.25 | 0.25 | 250 | 0.78 + 31.25 | 0.25 |
E. coli 64222 | 31.25 | ≥1000 | 15.63 + 125 | 0.63 | ≥1000 | 3.91 + 125 | 0.38 | 1000 | 7.81 + 62.50 | 0.31 |
E. coli 55758 | 31.25 | ≥1000 | 15.63 + 62.50 | 0.56 | ≥1000 | 15.63 + 125 | 0.63 | ≥1000 | 15.63 + 250 | 0.75 |
Contribution | YcgR-CAM | YcgR-CGA | YcgR-Si-A5 |
---|---|---|---|
ΔEvdw | −30.29 ± 2.69 | −26.57 ± 0.63 | −40.46 ± 2.57 |
ΔEele | −67.49 ± 4.92 | −217.26 ± 5.85 | −110.06 ± 31.49 |
ΔGpol,sol | 72.99 ± 3.73 | 216.30 ± 5.39 | 115.10 ± 27.97 |
ΔGnpol,sol | −4.80 ± 0.34 | −4.35 ± 0.08 | −7.06 ± 0.36 |
ΔEMM | −97.77 ± 7.11 | −243.82 ± 5.23 | −150.52 ± 29.20 |
ΔGsol | 68.19 ± 3.41 | 211.95 ± 5.44 | 108.04 ± 27.76 |
ΔGMM/GBSA | −29.59± 3.70 | −31.87 ± 0.49 | −42.48 ± 1.45 |
Contribution | YcgR-CDG-PilZ | YcgR-CDG-N Domain | YcgR-CDG-dual-PilZ | YcgR-CDG-dual-N Domain |
---|---|---|---|---|
ΔEvdw | −55.25 ± 3.57 | −43.13 ± 5.82 | −58.16 ± 0.85 | −44.58 ± 0.47 |
ΔEele | −103.98 ± 36.09 | −140.00 ± 28.44 | −134.06 ± 1.04 | −166.02 ± 7.96 |
ΔGpol,sol | 121.10 ± 33.93 | 155.29 ± 29.87 | 143.18 ± 1.97 | 176.22 ± 5.26 |
ΔGnpol,sol | −5.99 ± 0.41 | −5.45 ± 0.58 | −6.39 ± 0.03 | −6.14 ± 0.03 |
ΔEMM | −159.23 ± 39.27 | −183.13 ± 28.71 | −192.67 ± 1.11 | −210.60 ± 8.38 |
ΔGsol | 115.11 ± 33.62 | 149.83 ± 29.48 | 136.79 ± 1.98 | 170.08 ± 5.24 |
ΔGMM/GBSA | −44.12 ± 5.97 | −33.30 ± 1.50 | −55.89 ± 1.04 | −40.52 ± 3.20 |
Primer Name | Sequence (5′-3′) | Reference |
---|---|---|
16SrRNA | F:GGCTGAAAAGCTGCATTACC | [42] |
R:CATCAGGCCGATGTTACCTT | ||
YcgR-1 | F:GCGCATTACTGGAAACAGC | This study |
R:TTCATTCTTGCCATCAATCACT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Jiao, F.; Zeng, D.; Yu, X.; Zhou, Y.; Xue, J.; Yang, W.; Guo, J. Synergistic Effects of Pyrrosia lingua Caffeoylquinic Acid Compounds with Levofloxacin Against Uropathogenic Escherichia coli: Insights from Molecular Dynamics Simulations, Antibiofilm, and Antimicrobial Assessments. Molecules 2024, 29, 5679. https://doi.org/10.3390/molecules29235679
Zhang Y, Jiao F, Zeng D, Yu X, Zhou Y, Xue J, Yang W, Guo J. Synergistic Effects of Pyrrosia lingua Caffeoylquinic Acid Compounds with Levofloxacin Against Uropathogenic Escherichia coli: Insights from Molecular Dynamics Simulations, Antibiofilm, and Antimicrobial Assessments. Molecules. 2024; 29(23):5679. https://doi.org/10.3390/molecules29235679
Chicago/Turabian StyleZhang, Yan, Fangfang Jiao, Derong Zeng, Xiang Yu, Yongqiang Zhou, Juan Xue, Wude Yang, and Jingjing Guo. 2024. "Synergistic Effects of Pyrrosia lingua Caffeoylquinic Acid Compounds with Levofloxacin Against Uropathogenic Escherichia coli: Insights from Molecular Dynamics Simulations, Antibiofilm, and Antimicrobial Assessments" Molecules 29, no. 23: 5679. https://doi.org/10.3390/molecules29235679
APA StyleZhang, Y., Jiao, F., Zeng, D., Yu, X., Zhou, Y., Xue, J., Yang, W., & Guo, J. (2024). Synergistic Effects of Pyrrosia lingua Caffeoylquinic Acid Compounds with Levofloxacin Against Uropathogenic Escherichia coli: Insights from Molecular Dynamics Simulations, Antibiofilm, and Antimicrobial Assessments. Molecules, 29(23), 5679. https://doi.org/10.3390/molecules29235679