iTRAQ-Based Proteomic Profiling of Skin Aging Protective Effects of Tremella fuciformis-Derived Polysaccharides on D-Galactose-Induced Aging Mice
Abstract
1. Introduction
2. Results
2.1. Structure Characteristics of NTP
2.2. The Effects of NTP on the Physiological Properties of the Skin in D-Galactose-Treated Mice
2.3. Mass Spectra Data Analysis and Protein Identification
2.4. Identification of the DEPs
2.5. GO Enrichment Analysis and KEGG Enrichment Pathway Analysis of the DEPs
2.6. Analysis of Protein–Protein Interactions
2.7. Validation of DEPs in mRNA Expression Levels by RT-qPCR
3. Discussion
4. Materials and Methods
4.1. Material Preparation
4.2. Structure Characterizations
4.3. Animal Experiment
4.4. Measurement of the Content of Hydroxyproline, Hyaluronic Acid, and MDA and the Antioxidant Enzyme Activities in the Skin Tissues
4.5. Measurement of IL-1β and TNF-α in Serum
4.6. Protein Extraction
4.7. Protein Digestion, iTRAQ Labeling, and Fractionation of Peptides
4.8. LC-MS/MS Analysis
4.9. iTRAQ Data Analysis
4.10. Bioinformatics Analysis
4.11. Validation of Proteomic Profiles by Real-Time Quantitative Reverse Transcription PCR (RT- qPCR) Analysis
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kour, H.; Kour, D.; Kour, S.; Singh, S.; Jawad Hashmi, S.A.; Yadav, A.N.; Kumar, K.; Sharma, Y.P.; Ahluwalia, A.S. Bioactive compounds from mushrooms: Emerging bioresources of food and nutraceuticals. Food Biosc. 2022, 50, 102124. [Google Scholar] [CrossRef]
- Llanaj, X.; Törős, G.; Hajdú, P.; Abdalla, N.; El-Ramady, H.; Kiss, A.; Solberg, S.Ø.; Prokisch, J. Biotechnological applications of mushrooms under the water-energy-food nexus: Crucial aspects and prospects from farm to pharmacy. Foods 2023, 12, 2671. [Google Scholar] [CrossRef]
- Ma, X.; Yang, M.; He, Y.; Zhai, C.; Li, C. A review on the production, structure, bioactivities and applications of Tremella polysaccharides. Int. J. Immunopathol. Pharmacol. 2021, 35, 20587384211000541. [Google Scholar] [CrossRef]
- Wu, Y.J.; Wei, Z.X.; Zhang, F.M.; Linhardt, R.J.; Sun, P.L.; Zhang, A.Q. Structure, bioactivities and applications of the polysaccharides from Tremella fuciformis mushroom: A review. Int. J. Biol. Macromol. 2019, 121, 1005–1010. [Google Scholar] [CrossRef]
- Mineroff, J.; Jagdeo, J. The potential cutaneous benefits of Tremella fuciformis. Arch. Dermatol. Res. 2023, 315, 1883–1886. [Google Scholar] [CrossRef]
- Yang, D.; Liu, Y.; Zhang, L. Chapter Sixteen—Tremella polysaccharide: The molecular mechanisms of its drug action. In Progress in Molecular Biology and Translational Science; Zhang, L., Ed.; Academic Press: Cambridge, MA, USA, 2019; Volume 163, pp. 383–421. [Google Scholar]
- Kehler, D.S. Age-related disease burden as a measure of population ageing. Lancet. Public. Health 2019, 4, e123–e124. [Google Scholar] [CrossRef]
- Xu, K.; Guo, Y.; Li, Z.; Wang, Z. Aging biomarkers and novel targets for anti-aging interventions. Adv. Exp. Med. Biol. 2019, 1178, 39–56. [Google Scholar] [CrossRef]
- Tobin, D.J. Introduction to skin aging. J. Tissue Viability 2017, 26, 37–46. [Google Scholar] [CrossRef]
- Brodell, L.A.; Rosenthal, K.S. Skin structure and function: The body’s primary defense against infection. Infect. Dis. Clin. Pract. 2008, 16, 113–117. [Google Scholar] [CrossRef]
- Chambers, E.S.; Vukmanovic-Stejic, M. Skin barrier immunity and ageing. Immunology 2020, 160, 116–125. [Google Scholar] [CrossRef]
- Zhang, Z.; Sun, D.; Xu, M.; Tian, H.; Pan, J. Study on the antioxidation effect of Tremella polysaccharide. Food Research and Development 2014, 35, 10–15, (In Chinese with English abstract). [Google Scholar]
- Wen, L.; Gao, Q.; Ma, C.-w.; Ge, Y.; You, L.; Liu, R.H.; Fu, X.; Liu, D. Effect of polysaccharides from Tremella fuciformis on UV-induced photoaging. J. Funct. Foods 2016, 20, 400–410. [Google Scholar] [CrossRef]
- Xu, X.; Zhong, X.; Zhao, M.; He, R. Research on the improvement effects of collagen peptides and Tremella fuciformis polysaccharides on the skin texture of aging mice and its mechanism. Sci. Technol. Food Ind. 2022, 43, 357–364. [Google Scholar]
- Hulme, C.H.; Wilson, E.L.; Fuller, H.R.; Roberts, S.; Richardson, J.B.; Gallacher, P.; Peffers, M.J.; Shirran, S.L.; Botting, C.H.; Wright, K.T. Two independent proteomic approaches provide a comprehensive analysis of the synovial fluid proteome response to autologous chondrocyte implantation. Arthritis Res. Ther. 2018, 20, 87. [Google Scholar] [CrossRef]
- Katsarou, E.I.; Billinis, C.; Galamatis, D.; Fthenakis, G.C.; Tsangaris, G.T.; Katsafadou, A.I. Applied proteomics in 'One Health'. Proteomes 2021, 9. [Google Scholar] [CrossRef]
- Liu, X.; Yu, X.; Xu, X.; Zhang, X.; Zhang, X. The protective effects of Poria cocos-derived polysaccharide CMP33 against IBD in mice and its molecular mechanism. Food Funct. 2018, 9, 5936–5949. [Google Scholar] [CrossRef]
- Ma, G.; Kimatu, B.M.; Zhao, L.; Yang, W.; Pei, F.; Hu, Q. Impacts of dietary Pleurotus eryngii polysaccharide on nutrient digestion, metabolism, and immune response of the small intestine and colon-an iTRAQ-based proteomic analysis. Proteomics 2018, 18, e1700443. [Google Scholar] [CrossRef]
- Luo, D.; Liu, X.; Guan, J.; Jang, G.; Hua, Y.; Zhang, X.; Xu, X. Effects of Tremella fuciformis-derived polysaccharides with different molecular weight on d-Galactose-induced aging of mice. Pol. J. Food Nutr. Sci. 2023, 73, 163–174. [Google Scholar] [CrossRef]
- Umbayev, B.; Askarova, S.; Almabayeva, A.; Saliev, T.; Masoud, A.R.; Bulanin, D. Galactose-induced skin aging: The role of oxidative stress. Oxid. Med. Cell. Longev. 2020, 2020, 7145656. [Google Scholar] [CrossRef]
- Shin, J.W.; Kwon, S.H.; Choi, J.Y.; Na, J.I.; Huh, C.H.; Choi, H.R.; Park, K.C. Molecular mechanisms of dermal aging and antiaging approaches. Int. J. Mol. Sci. 2019, 20, 2126. [Google Scholar] [CrossRef]
- Kammeyer, A.; Luiten, R.M. Oxidation events and skin aging. Ageing Res. Rev. 2015, 21, 16–29. [Google Scholar] [CrossRef]
- Zitka, O.; Kukacka, J.; Krizkova, S.; Huska, D.; Adam, V.; Masarik, M.; Prusa, R.; Kizek, R. Matrix metalloproteinases. Curr. Med. Chem. 2010, 17, 3751–3768. [Google Scholar] [CrossRef]
- Zhang, S.; Duan, E. Fighting against skin aging: The way from bench to bedside. Cell Transplant. 2018, 27, 729–738. [Google Scholar] [CrossRef]
- Ben-Hur, T.; Ben-Yosef, Y.; Mizrachi-Kol, R.; Ben-Menachem, O.; Miller, A. Cytokine-mediated modulation of MMPs and TIMPs in multipotential neural precursor cells. J. Neuroimmunol. 2006, 175, 12–18. [Google Scholar] [CrossRef]
- Castelo-Branco, C.; Pons, F.; Gratacós, E.; Fortuny, A.; Vanrell, J.A.; González-Merlo, J. Relationship between skin collagen and bone changes during aging. Maturitas 1994, 18, 199–206. [Google Scholar] [CrossRef]
- Papakonstantinou, E.; Roth, M.; Karakiulakis, G. Hyaluronic acid: A key molecule in skin aging. Dermato-endocrinol. 2012, 4, 253–258. [Google Scholar] [CrossRef]
- Valgimigli, L.; Sapone, A.; Canistro, D.; Broccoli, M.; Gatta, L.; Soleti, A.; Paolini, M. Oxidative stress and aging: A non-invasive EPR investigation in human volunteers. Aging Clin. Exp. Res. 2015, 27, 235–238. [Google Scholar] [CrossRef]
- Ferrucci, L.; Fabbri, E. Inflammageing: Chronic inflammation in ageing, cardiovascular disease, and frailty. Nat. Rev. Cardiol. 2018, 15, 505–522. [Google Scholar] [CrossRef]
- Forman, H.J.; Davies, K.J.A.; Ursini, F. How do nutritional antioxidants really work: Nucleophilic tone and para-hormesis versus free radical scavenging in vivo. Free Radic. Biol. Med. 2014, 66, 24–35. [Google Scholar] [CrossRef]
- Forman, H.J.; Zhang, H. Targeting oxidative stress in disease: Promise and limitations of antioxidant therapy. Nat. Rev. Drug Discov. 2021, 20, 689–709. [Google Scholar] [CrossRef]
- Liu, Y.; Liu, Y.; Zhang, M.; Li, C.; Zhang, Z.; Liu, A.; Wu, Y.; Wu, H.; Chen, H.; Hu, X.; et al. Structural characterization of a polysaccharide from Suillellus luridus and its antidiabetic activity via Nrf2/HO-1 and NF-κB pathways. Int. J. Biol. Macromol. 2020, 162, 935–945. [Google Scholar] [CrossRef]
- Chen, N.; Hu, M.; Jiang, T.; Xiao, P.; Duan, J.-a. Insights into the molecular mechanisms, structure-activity relationships and application prospects of polysaccharides by regulating Nrf2-mediated antioxidant response. Carbohydr. Polym. 2024, 333, 122003. [Google Scholar] [CrossRef]
- Xu, Y.; Xie, L.; Zhang, Z.; Zhang, W.; Tang, J.; He, X.; Zhou, J.; Peng, W. Tremella fuciformis polysaccharides inhibited colonic inflammation in dextran sulfate sodium-treated mice via foxp3+ T cells, gut microbiota, and bacterial metabolites. Front. Immunol. 2021, 12, 648162. [Google Scholar] [CrossRef]
- Xiao, H.; Li, H.; Wen, Y.; Jiang, D.; Zhu, S.; He, X.; Xiong, Q.; Gao, J.; Hou, S.; Huang, S.; et al. Tremella fuciformis polysaccharides ameliorated ulcerative colitis via inhibiting inflammation and enhancing intestinal epithelial barrier function. Int. J. Biol. Macromol. 2021, 180, 633–642. [Google Scholar] [CrossRef]
- De Pessemier, B.; Grine, L.; Debaere, M.; Maes, A.; Paetzold, B.; Callewaert, C. Gut-skin axis: Current knowledge of the interrelationship between microbial dysbiosis and skin conditions. Microorganisms 2021, 9. [Google Scholar] [CrossRef]
- Mahmud, M.R.; Akter, S.; Tamanna, S.K.; Mazumder, L.; Esti, I.Z.; Banerjee, S.; Akter, S.; Hasan, M.R.; Acharjee, M.; Hossain, M.S.; et al. Impact of gut microbiome on skin health: Gut-skin axis observed through the lenses of therapeutics and skin diseases. Gut Microbes 2022, 14, 2096995. [Google Scholar] [CrossRef]
- Huang, R.; Zhang, J.; Xu, X.; Sun, M.; Xu, L.; Kuang, H.; Xu, C.; Guo, L. The multiple benefits of bioactive polysaccharides: From the gut to overall health. Trends Food Sci. Technol. 2024, 152, 104677. [Google Scholar] [CrossRef]
- Barzilai, N.; Huffman, D.M.; Muzumdar, R.H.; Bartke, A. The critical role of metabolic pathways in aging. Diabetes 2012, 61, 1315–1322. [Google Scholar] [CrossRef]
- Furuhashi, M. New insights into purine metabolism in metabolic diseases: Role of xanthine oxidoreductase activity. Am. J. Physiol. Endoc. M. 2020, 319, e827–e834. [Google Scholar] [CrossRef]
- Díaz-Casado, M.E.; Quiles, J.L.; Barriocanal-Casado, E.; González-García, P.; Battino, M.; López, L.C.; Varela-López, A. The paradox of coenzyme Q(10) in aging. Nutrients 2019, 11. [Google Scholar] [CrossRef]
- Zhang, C.S.; Hawley, S.A.; Zong, Y.; Li, M.; Wang, Z.; Gray, A.; Ma, T.; Cui, J.; Feng, J.W.; Zhu, M.; et al. Fructose-1,6-bisphosphate and aldolase mediate glucose sensing by AMPK. Nature 2017, 548, 112–116. [Google Scholar] [CrossRef]
- Bradshaw, P.C. Acetyl-CoA metabolism and histone acetylation in the regulation of aging and lifespan. Antioxidants 2021, 10. [Google Scholar] [CrossRef]
- Hagopian, K.; Ramsey, J.J.; Weindruch, R. Caloric restriction increases gluconeogenic and transaminase enzyme activities in mouse liver. Exp. Gerontol. 2003, 38, 267–278. [Google Scholar] [CrossRef]
- Giller, K.; Huebbe, P.; Doering, F.; Pallauf, K.; Rimbach, G. Major urinary protein 5, a scent communication protein, is regulated by dietary restriction and subsequent re-feeding in mice. Proc. Biol. Sci. 2013, 280, 20130101. [Google Scholar] [CrossRef]
- Tung, Y.T.; Chen, Y.J.; Chuang, H.L.; Huang, W.C.; Lo, C.T.; Liao, C.C.; Huang, C.C. Characterization of the serum and liver proteomes in gut-microbiota-lacking mice. In.J. Med. Sci. 2017, 14, 257–267. [Google Scholar] [CrossRef]
- Wang, H.; Chen, M.H.; Chen, W.; Zhang, J.G.; Qin, S.C. Roles and mechanisms of phospholipid transfer protein in the development of Alzheimer’s disease. Psychogeriatrics 2021, 21, 659–667. [Google Scholar] [CrossRef]
- Nguyen, M.; Gautier, T.; Reocreux, G.; Pallot, G.; Maquart, G.; Bahr, P.A.; Tavernier, A.; Grober, J.; Masson, D.; Bouhemad, B.; et al. Increased Phospholipid transfer protein activity is associated with markers of enhanced lipopolysaccharide clearance in human during cardiopulmonary bypass. Front. Cardiovasc. Med. 2021, 8, 756269. [Google Scholar] [CrossRef]
- Engin, A.B.; Engin, A. Aging and protein kinases. Adv. Exp. Med. Biol. 2021, 1275, 35–69. [Google Scholar] [CrossRef]
- Roufayel, R.; Murshid, N. CDK5: Key Regulator of apoptosis and cell survival. Biomedicines 2019, 7. [Google Scholar] [CrossRef]
- Guo, D.; Xie, W.; Xiong, P.; Li, H.; Wang, S.; Chen, G.; Gao, Y.; Zhou, J.; Zhang, Y.; Bu, G.; et al. Cyclin-dependent kinase 5-mediated phosphorylation of chloride intracellular channel 4 promotes oxidative stress-induced neuronal death. Cell Death Dis. 2018, 9, 951. [Google Scholar] [CrossRef]
- Bai, B.; Liang, Y.; Xu, C.; Lee, M.Y.; Xu, A.; Wu, D.; Vanhoutte, P.M.; Wang, Y. Cyclin-dependent kinase 5-mediated hyperphosphorylation of sirtuin-1 contributes to the development of endothelial senescence and atherosclerosis. Circulation 2012, 126, 729–740. [Google Scholar] [CrossRef]
- Tung, Y.T.; Pan, C.H.; Chien, Y.W.; Huang, H.Y. Edible mushrooms: Novel medicinal agents to combat metabolic syndrome and associated diseases. Curr. Pharm. Des. 2020, 26, 4970–4981. [Google Scholar] [CrossRef]
- Sukoyan, G.; Tsivtsivadze, E.; Golovach, V.; Kezeli, T.; Demina, N. Anti-aging effect of Cynara cardunculus L. var. Cynara scolymus L. extract in d-Galactose-induced skin aging model in rats . Pharmacol. Pharm. 2018, 9, 428–439. [Google Scholar] [CrossRef]
- Hunt, J.M.; Tuder, R. Alpha 1 anti-trypsin: One protein, many functions. Curr. Mol. Med. 2012, 12, 827–835. [Google Scholar] [CrossRef]
- Scholar, E.M.; Rashidian, M.; Heidrick, M.L. Adenosine deaminase and purine nucleoside phosphorylase activity in spleen cells of aged mice. Mech. Ageing Dev. 1980, 12, 323–329. [Google Scholar] [CrossRef]
- Kurashige, S.; Akuzawa, Y.; Yoshida, T.; Teshima, C.; Kodama, K.; Mitsuhashi, S. Purine metabolic enzymes in lymphocytes. II. Adenosine deaminase and purine nucleoside phosphorylase activities in the immune response. Microbiol. Immunol. 1982, 26, 87–92. [Google Scholar] [CrossRef]
- Stadion, M.; Schwerbel, K.; Graja, A.; Baumeier, C.; Rödiger, M.; Jonas, W.; Wolfrum, C.; Staiger, H.; Fritsche, A.; Häring, H.U.; et al. Increased Ifi202b/IFI16 expression stimulates adipogenesis in mice and humans. Diabetologia 2018, 61, 1167–1179. [Google Scholar] [CrossRef]
- Li, D.; Mukai, K.; Suzuki, T.; Suzuki, R.; Yamashita, S.; Mitani, F.; Suematsu, M. Adrenocortical zonation factor 1 is a novel matricellular protein promoting integrin-mediated adhesion of adrenocortical and vascular smooth muscle cells. FEBS J 2007, 274, 2506–2522. [Google Scholar] [CrossRef]
- Lee, G.; Han, S.B.; Kim, D.H. Cell-ECM contact-guided intracellular polarization is mediated via lamin A/C dependent nucleus-cytoskeletal connection. Biomaterials 2021, 268, 120548. [Google Scholar] [CrossRef]
- Titus, M.A. Myosin-driven intracellular transport. Cold Spring Harb. Perspect. Biol. 2018, 10. [Google Scholar] [CrossRef]
- Thompson, L.V.; Durand, D.; Fugere, N.A.; Ferrington, D.A. Myosin and actin expression and oxidation in aging muscle. J. Appl. Physiol. (Bethesda, Md.: 1985) 2006, 101, 1581–1587. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Yang, J.; Ning, Z.; Zhang, X. Proteomic analysis of intestinal tissues from mice fed with Lentinula edodes-derived polysaccharides. Food Funct. 2016, 7, 250–261. [Google Scholar] [CrossRef] [PubMed]
- Qu, C.; Li, Q.-P.; Su, Z.-R.; Ip, S.-P.; Yuan, Q.-J.; Xie, Y.-L.; Xu, Q.-Q.; Yang, W.; Huang, Y.-F.; Xian, Y.F.; et al. Nano-honokiol ameliorates the cognitive deficits in TgCRND8 mice of Alzheimer’s disease via inhibiting neuropathology and modulating gut microbiota. J. Adv. Res. 2022, 35, 231–243. [Google Scholar] [CrossRef] [PubMed]
- Qu, C.; Xu, Q.Q.; Yang, W.; Zhong, M.; Yuan, Q.; Xian, Y.F.; Lin, Z.X. Gut dysbiosis aggravates cognitive deficits, amyloid pathology and lipid metabolism dysregulation in a transgenic mouse model of Alzheimer’s disease. J. Pharm. Anal. 2023, 13, 1526–1547. [Google Scholar] [CrossRef] [PubMed]
- Han, X.; Shen, L.; Wang, Q.; Cen, X.; Wang, J.; Wu, M.; Li, P.; Zhao, W.; Zhang, Y.; Zhao, G. Cyclic AMP inhibits the activity and promotes the acetylation of acetyl-CoA synthetase through competitive binding to the ATP/AMP pocket. J. Biol. Chem. 2017, 292, 1374–1384. [Google Scholar] [CrossRef]
- Li, Y.; Yan, M.; Zhang, M.; Zhang, B.; Xu, B.; Ding, X.; Wang, J.; Wang, Z. Scutellarin alleviated ulcerative colitis through gut microbiota-mediated cAMP/PKA/NF-κB pathway. Biochem. Bioph. Res. Co. 2024, 735, 150837. [Google Scholar] [CrossRef]
- Wu, D.; Yang, S.; Yuan, C.; Zhang, K.; Tan, J.; Guan, K.; Zeng, H.; Huang, C. Targeting purine metabolism-related enzymes for therapeutic intervention: A review from molecular mechanism to therapeutic breakthrough. Int. J. Biol. Macromol. 2024, 282, 136828. [Google Scholar] [CrossRef]
- Xu, X.; Liu, X.; Liu, L.; Chen, J.; Guan, J.; Luo, D. Metagenomic and transcriptomic profiling of the hypoglycemic and hypotriglyceridemic actions of Tremella fuciformis-derived polysaccharides in high-fat-diet- and streptozotocin-treated mice. Food Funct. 2024. [Google Scholar] [CrossRef]
- Azman, K.F.; Zakaria, R. d-Galactose-induced accelerated aging model: An overview. Biogerontology 2019, 20, 763–782. [Google Scholar] [CrossRef]
- Masson, S.W.C.; Cutler, H.B.; James, D.E. Unlocking metabolic insights with mouse genetic diversity. EMBO J. 2024. [Google Scholar] [CrossRef]
- Arunachalam, K.; Sreeja, P.S.; Yang, X. The antioxidant properties of mushroom polysaccharides can potentially mitigate oxidative stress, beta-cell dysfunction and insulin resistance. Front. Pharmacol. 2022, 13, 874474. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Luo, D.; Guan, J.; Chen, J.; Xu, X. Mushroom polysaccharides with potential in anti-diabetes: Biological mechanisms, extraction, and future perspectives: A review. Front. Nutr. 2022, 9, 1087826. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Ganesan, K.; Xu, B. Unlocking the power: New insights into the anti-aging properties of mushrooms. J. Fungi 2024, 10, 215. [Google Scholar] [CrossRef] [PubMed]
- Angelini, P.; Girometta, C.E.; Venanzoni, R.; Bertuzzi, G. Anti-aging properties of medicinal mushrooms in systemic aesthetic medicine. In Biology, Cultivation and Applications of Mushrooms; Arya, A., Rusevska, K., Eds.; Springer Singapore: Singapore, 2022; pp. 185–202. [Google Scholar]
- Kaur, D.; Rasane, P.; Singh, J.; Kaur, S.; Kumar, V.; Mahato, D.K.; Dey, A.; Dhawan, K.; Kumar, S. Nutritional interventions for elderly and considerations for the development of geriatric foods. Curr. Aging Sci. 2019, 12, 15–27. [Google Scholar] [CrossRef] [PubMed]
- Smith, P.K.; Krohn, R.I.; Hermanson, G.T.; Mallia, A.K.; Gartner, F.H.; Provenzano, M.D.; Fujimoto, E.K.; Goeke, N.M.; Olson, B.J.; Klenk, D.C. Measurement of protein using bicinchoninic acid. Anal. Biochem. 1985, 150, 76–85. [Google Scholar] [CrossRef]
- Filisetti-Cozzi, T.M.; Carpita, N.C. Measurement of uronic acids without interference from neutral sugars. Anal. Biochem. 1991, 197, 157–162. [Google Scholar] [CrossRef]
- Liu, X.; Wang, X.; Xu, X.; Zhang, X. Purification, antitumor and anti-inflammation activities of an alkali-soluble and carboxymethyl polysaccharide CMP33 from Poria cocos. Int. J. Biol. Macromol. 2019, 127, 39–47. [Google Scholar] [CrossRef]
- Zhao, X.; Yi, R.; Zhou, X.; Mu, J.; Long, X.; Pan, Y.; Song, J.L.; Park, K.-Y. Preventive effect of Lactobacillus plantarum KSFY02 isolated from naturally fermented yogurt from Xinjiang, China, on d-Galactose–induced oxidative aging in mice. J. Dairy Sci. 2019, 102, 5899–5912. [Google Scholar] [CrossRef]
- Wiśniewski, J.R.; Zougman, A.; Nagaraj, N.; Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 2009, 6, 359–362. [Google Scholar] [CrossRef]
- Gillette, M.A.; Satpathy, S.; Cao, S.; Dhanasekaran, S.M.; Vasaikar, S.V.; Krug, K.; Petralia, F.; Li, Y.; Liang, W.W.; Reva, B.; et al. Proteogenomic characterization reveals therapeutic vulnerabilities in lung adenocarcinoma. Cell 2020, 182, 200–225.e235. [Google Scholar] [CrossRef]
- Zhao, C.; Fan, J.; Liu, Y.; Guo, W.; Cao, H.; Xiao, J.; Wang, Y.; Liu, B. Hepatoprotective activity of Ganoderma lucidum triterpenoids in alcohol-induced liver injury in mice, an iTRAQ-based proteomic analysis. Food Chem. 2019, 271, 148–156. [Google Scholar] [CrossRef]
- Wang, H.; Zhu, X.; Shen, J.; Zhao, E.F.; He, D.; Shen, H.; Liu, H.; Zhou, Y. Quantitative iTRAQ-based proteomic analysis of differentially expressed proteins in aging in human and monkey. BMC Genom. 2019, 20, 725. [Google Scholar] [CrossRef]
- Mi, H.; Ebert, D.; Muruganujan, A.; Mills, C.; Albou, L.-P.; Mushayamaha, T.; Thomas, P.D. PANTHER version 16: A revised family classification, tree-based classification tool, enhancer regions and extensive API. Nucleic Acids Res. 2020, 49, D394–D403. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. Omics 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Accession | Protein Name | Gene Name | Coverage a % | Peptides b | Score c | Fold Change d | p Value |
---|---|---|---|---|---|---|---|
Immune system response | |||||||
G3UZP7 | H-2 class I histocompatibility antigen | H2-D1 | 24 | 8 | 53.36 | 1.47 | 1.4 × 10−5 |
Q6PIP8 | Igh protein | Igh | 25 | 8 | 196.85 | 1.75 | 0.027 |
A0A0B4J1P4 | Immunoglobulin heavy variable 5–16 | Ighv5-16 | 23 | 2 | 26.73 | 1.59 | 0.0038 |
L0HCN1 | Ifi202b | Ifi202b | 4 | 2 | 1.81 | 0.65 | 0.010 |
A0A679F8Q6 | Single-chain Fv | scFv-A36 | 5 | 1 | 2.97 | 1.59 | 0.028 |
A0A0A0MQA3 | Alpha-1-antitrypsin 1-1 | Serpina1a | 25 | 9 | 232.24 | 1.3 | 0.016 |
Cellular and metabolic regulation | |||||||
Q91VM9 | Inorganic pyrophosphatase 2 | Ppa2 | 12 | 3 | 10.09 | 1.32 | 0.0029 |
Q69Z91 | Acetyl-coenzyme A synthetase | Acss1 | 3 | 2 | 1.72 | 0.26 | 0.0054 |
Q3TDX2 | Vesicle-fusing ATPase | Vps4a | 5 | 2 | 8.77 | 0.37 | 0.0073 |
Q8R1S0 | Ubiquinone biosynthesis monooxygenase COQ6 | Coq6 | 5 | 2 | 2.52 | 1.37 | 0.022 |
A2AI87 | Phosphorylase kinase regulatory subunit b | Phka1 | 4 | 5 | 4.36 | 1.34 | 0.015 |
Q3TJ66 | Fructose-bisphosphate aldolase | Aldob | 19 | 4 | 53.11 | 0.69 | 0.016 |
P23492 | Purine nucleoside phosphorylase | Pnp | 44 | 9 | 63.44 | 1.82 | 0.0082 |
Q3V1D3 | AMP deaminase 1 | Ampd1 | 7 | 4 | 11.45 | 1.3 | 0.039 |
Q9CX56 | 26S proteasome non-ATPase regulatory subunit 8 | Psmd8 | 14 | 5 | 12.24 | 0.75 | 0.034 |
P49615 | Cyclin-dependent kinase 5 | Cdk5 | 11 | 3 | 4.43 | 0.14 | 0.010 |
Q8VCS3 | Glycosaminoglycan xylosylkinase | Fam20b | 5 | 1 | 2.16 | 0.42 | 0.025 |
O88592 | Superoxide dismutase | Sod3 | 16 | 2 | 49.81 | 1.36 | 0.014 |
Q8BYJ6 | TBC1 domain family member 4 | Tbc1d4 | 2 | 2 | 1.27 | 1.46 | 0.037 |
Q541Z2 | Farnesyltransferase | Fnta | 19 | 6 | 12.42 | 0.76 | 0.038 |
Q9Z0L0 | Trophoblast glycoprotein | Tpbg | 6 | 2 | 6.13 | 0.61 | 0.0023 |
A2AKN8 | Major urinary protein 5 | Mup8 | 56 | 8 | 83.46 | 1.74 | 0.0031 |
Q3TJ28 | Charged multivesicular body protein 1B | Chmp1b | 8 | 2 | 1.88 | 1.46 | 0.0034 |
Q3TIH8 | Zinc finger protein 259 | Zpr1 | 7 | 3 | 2.15 | 0.7 | 0.015 |
Q3USH5 | Splicing factor, suppressor of white-apricot homolog | Q3USH5 | 2 | 2 | 2.00 | 0.73 | 0.040 |
Q3UFS5 | Phospholipid transfer protein | Pltp | 19 | 7 | 25.35 | 1.39 | 0.042 |
P54731 | FAS-associated factor 1 | Faf1 | 2 | 1 | 1.05 | 0.65 | 0.021 |
Q9CRD0 | OCIA domain-containing protein 1 | Ociad1 | 7 | 1 | 2.70 | 0.4 | 0.014 |
Structural component | |||||||
Q5SX39 | Myosin-4 | Myh4 | 32 | 64 | 1435.55 | 1.33 | 0.0057 |
Q3TAQ2 | Hexabrachion-like protein | Tnxb | 26 | 27 | 202.12 | 1.76 | 0.014 |
Q9CQ89 | Protein cut A | Cuta | 8 | 1 | 13.92 | 0.39 | 0.0037 |
Q925H6 | Keratin-associated protein 19-3 | Krtap19-3 | 16 | 1 | 19.39 | 0.76 | 0.0089 |
O08640 | Keratin-associated protein 14 | Krtap14 | 21 | 2 | 14.22 | 0.67 | 0.0093 |
Q925I0 | Keratin-associated protein 19-2 | Krtap19-2 | 9 | 1 | 8.21 | 0.68 | 0.013 |
B2RTP7 | Krt2 protein | Krt2 | 3 | 2 | 12.69 | 1.5 | 0.018 |
Q925H7 | Keratin-associated protein 19-4 | Krtap19-4 | 17 | 1 | 2.52 | 0.69 | 0.020 |
Q8R5C5 | Beta-centractin | Actr1b | 28 | 7 | 29.52 | 1.37 | 0.024 |
A2AM97 | Ribosomal protein 10 | RP23-436K3.4-001 | 30 | 9 | 49.94 | 0.75 | 0.011 |
P28481 | Collagen alpha-1(II) chain | Col2a1 | 5 | 5 | 40.46 | 1.39 | 0.013 |
E9Q043 | Fibronectin type III domain-containing 1 | Fndc1 | 3 | 3 | 8.86 | 1.49 | 0.030 |
Q9QZU5 | Keratin-associated protein 15-1 | Krtap15-1 | 38 | 3 | 35.46 | 0.76 | 0.045 |
D3YYY1 | Secretoglobin | Scgb2b7 | 7 | 1 | 2.18 | 1.57 | 0.00016 |
Q99JR5 | Bulointerstitial nephritis antigen-like protein | Tinagl1 | 9 | 3 | 10.44 | 1.37 | 0.045 |
ID | Description | Gene Ratio | Bg Ratio | p Value | p Adjusted | q Value | Gene ID | Count |
---|---|---|---|---|---|---|---|---|
mmu00010 | Glycolysis/gluconeogenesis | 2/21 | 67/8979 | 0.0105 | 0.2179 | 0.1922 | Aldob/Acss1 | 2 |
mmu01232 | Nucleotide metabolism | 2/21 | 84/8979 | 0.0162 | 0.2179 | 0.1922 | Ampd1/Pnp | 2 |
mmu04512 | ECM–receptor interaction | 2/21 | 88/8979 | 0.0177 | 0.2179 | 0.1922 | Tnxb/Col2a1 | 2 |
mmu00130 | Ubiquinone and other terpenoid-quinone biosynthesis | 1/21 | 11/8979 | 0.0254 | 0.2353 | 0.2075 | Coq6 | 1 |
mmu01200 | Carbon metabolism | 2/21 | 121/8979 | 0.0320 | 0.2368 | 0.2088 | Aldob/Acss1 | 2 |
mmu00230 | Purine metabolism | 2/21 | 134/8979 | 0.0386 | 0.2379 | 0.2098 | Ampd1/Pnp | 2 |
mmu00900 | Terpenoid backbone biosynthesis | 1/21 | 23/8979 | 0.0525 | 0.2513 | 0.2216 | Fnta | 1 |
mmu00640 | Propanoate metabolism | 1/21 | 31/8979 | 0.0701 | 0.2513 | 0.2216 | Acss1 | 1 |
mmu00630 | Glyoxylate and dicarboxylate metabolism | 1/21 | 32/8979 | 0.0723 | 0.2513 | 0.2216 | Acss1 | 1 |
mmu00030 | Pentose phosphate pathway | 1/21 | 33/8979 | 0.0745 | 0.2513 | 0.2216 | Aldob | 1 |
mmu00051 | Fructose and mannose metabolism | 1/21 | 36/8979 | 0.0810 | 0.2513 | 0.2216 | Aldob | 1 |
mmu00760 | Nicotinate and nicotinamide metabolism | 1/21 | 41/8979 | 0.0917 | 0.2513 | 0.2216 | Pnp | 1 |
mmu00620 | Pyruvate metabolism | 1/21 | 44/8979 | 0.0981 | 0.2513 | 0.2216 | Acss1 | 1 |
mmu03050 | Proteasome | 1/21 | 47/8979 | 0.1045 | 0.2513 | 0.2216 | Psmd8 | 1 |
mmu05030 | Cocaine addiction | 1/21 | 48/8979 | 0.1066 | 0.2513 | 0.2216 | Cdk5 | 1 |
mmu04979 | Cholesterol metabolism | 1/21 | 49/8979 | 0.1087 | 0.2513 | 0.2216 | Pltp | 1 |
mmu03250 | Viral life cycle—HIV-1 | 1/21 | 61/8979 | 0.1335 | 0.2545 | 0.2244 | Vps4a | 1 |
mmu04623 | Cytosolic DNA-sensing pathway | 1/21 | 63/8979 | 0.1376 | 0.2545 | 0.2244 | Ifi202b | 1 |
mmu05330 | Allograft rejection | 1/21 | 63/8979 | 0.1376 | 0.2545 | 0.2244 | H2-D1 | 1 |
mmu05332 | Graft-versus-host disease | 1/21 | 63/8979 | 0.1376 | 0.2545 | 0.2244 | H2-D1 | 1 |
mmu04940 | Type I diabetes mellitus | 1/21 | 70/8979 | 0.1517 | 0.2673 | 0.2357 | H2-D1 | 1 |
mmu01230 | Biosynthesis of amino acids | 1/21 | 79/8979 | 0.1695 | 0.2693 | 0.2375 | Aldob | 1 |
mmu05320 | Autoimmune thyroid disease | 1/21 | 79/8979 | 0.1696 | 0.2693 | 0.2375 | H2-D1 | 1 |
mmu05416 | Viral myocarditis | 1/21 | 88/8979 | 0.1870 | 0.2693 | 0.2375 | H2-D1 | 1 |
mmu03320 | PPAR signaling pathway | 1/21 | 89/8979 | 0.1889 | 0.2693 | 0.2375 | Pltp | 1 |
mmu04612 | Antigen processing and presentation | 1/21 | 90/8979 | 0.1909 | 0.2693 | 0.2375 | H2-D1 | 1 |
mmu04610 | Complement and coagulation cascades | 1/21 | 93/8979 | 0.1966 | 0.2693 | 0.2375 | Serpina1a | 1 |
mmu04922 | Glucagon signaling pathway | 1/21 | 104/8979 | 0.2172 | 0.2782 | 0.2453 | Phka1 | 1 |
mmu04974 | Protein digestion and absorption | 1/21 | 108/8979 | 0.2246 | 0.2782 | 0.2453 | Col2a1 | 1 |
mmu04931 | Insulin resistance | 1/21 | 110/8979 | 0.2283 | 0.2782 | 0.2453 | Tbc1d4 | 1 |
mmu04066 | HIF-1 signaling pathway | 1/21 | 114/8979 | 0.2356 | 0.2782 | 0.2453 | Aldob | 1 |
mmu04919 | Thyroid hormone signaling pathway | 1/21 | 120/8979 | 0.2464 | 0.2782 | 0.2453 | Tbc1d4 | 1 |
mmu04650 | Natural killer cell-mediated cytotoxicity | 1/21 | 121/8979 | 0.2482 | 0.2782 | 0.2453 | H2-D1 | 1 |
mmu00190 | Oxidative phosphorylation | 1/21 | 135/8979 | 0.2728 | 0.2909 | 0.2565 | Ppa2 | 1 |
mmu04910 | Insulin signaling pathway | 1/21 | 139/8979 | 0.2796 | 0.2909 | 0.2565 | Phka1 | 1 |
mmu05017 | Spinocerebellar ataxia | 1/21 | 141/8979 | 0.2831 | 0.2909 | 0.2565 | Psmd8 | 1 |
mmu01240 | Biosynthesis of cofactors | 1/21 | 152/8979 | 0.3016 | 0.3015 | 0.2659 | Coq6 | 1 |
Gene Name | Forward Primer (5’-3’) | Reverse Primer (5’-3’) |
---|---|---|
Pnp | AGAGAGTCGTCTGCTAAAGATG | GGAGACAAACCTTTCCAATGTC |
Tnxb | TGACTGGTGTGACTCAAAACTC | CCGTAGAGTAGCAGCTTATACC |
Serpina1a | GACACTCACACGCAGATCCTAGAG | GGAGGAGGTGTTGGAAGGACTTG |
Myh4 | GGCAAACAAGCATTTACACAAC | ATCCGTCTCATATTTCGTCCTC |
Mup8 | CCTGAGCCTCCAGTGTTGAGTG | GGGATGCTGTATGGATAGGAAGGG |
Cdk5 | CAATGTACCCAGCTACAACATC | CTTCAATAGGTTCTGCAACAGG |
Acss1 | CAGGCAGGCTATCTACTGTATG | AACTGGTTGATCTTTAGCCTCT |
Vps4a | ATTCAGCCATCAGGAGGAGGTTTG | AGCATCTGTGAGGTTGTGAGGTG |
Ociad1 | CTGCCACAAGTATGCTGATTAC | CTTCTTGAACTTCTCTTGGCAC |
Gapdh | AGAAGGTGGTGAAGCAGGCATC | CGAAGGTGGAAGAGTGGGAGTTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Y.; Liu, X.; Guan, J.; Chen, J.; Xu, X. iTRAQ-Based Proteomic Profiling of Skin Aging Protective Effects of Tremella fuciformis-Derived Polysaccharides on D-Galactose-Induced Aging Mice. Molecules 2024, 29, 5191. https://doi.org/10.3390/molecules29215191
Xu Y, Liu X, Guan J, Chen J, Xu X. iTRAQ-Based Proteomic Profiling of Skin Aging Protective Effects of Tremella fuciformis-Derived Polysaccharides on D-Galactose-Induced Aging Mice. Molecules. 2024; 29(21):5191. https://doi.org/10.3390/molecules29215191
Chicago/Turabian StyleXu, Yuanyuan, Xiaofei Liu, Jingjing Guan, Jin Chen, and Xiaofei Xu. 2024. "iTRAQ-Based Proteomic Profiling of Skin Aging Protective Effects of Tremella fuciformis-Derived Polysaccharides on D-Galactose-Induced Aging Mice" Molecules 29, no. 21: 5191. https://doi.org/10.3390/molecules29215191
APA StyleXu, Y., Liu, X., Guan, J., Chen, J., & Xu, X. (2024). iTRAQ-Based Proteomic Profiling of Skin Aging Protective Effects of Tremella fuciformis-Derived Polysaccharides on D-Galactose-Induced Aging Mice. Molecules, 29(21), 5191. https://doi.org/10.3390/molecules29215191