Pilose Antler Protein Relieves UVB-Induced HaCaT Cells and Skin Damage
Abstract
1. Introduction
2. Results
2.1. PAP Treatment Restored UVB-Induced HaCaT Cell Viability and Reduced HaCaT Cell Death
2.2. PAP Reduced Oxidative Stress in HaCaT Cells
2.3. PAP Increased Type I Collagen (ColⅠ) and Hyaluronic acid (HA) in UVB-Irradiated HaCaT Cells
2.4. PAP Regulates the Expression of MMP-1, TGF-β1, Col Ⅰ, FLG, IVL, and AQP3 to Repair Photoaging in HaCaT Cells
2.5. Effects of PAP on MAPK and TGF-β/Smad Pathways in UVB-Induced HaCaT Cells
2.6. PAP Recovered UVB-Induced Skin Damage and Collagen Degradation
2.7. PAP Increased Hydroxyproline (Hyp) Content, Decreased MMP-1 Content in Skin Tissue, and Inhibited the IL-6, IL-1β, and TNF-α Concentrations in Serum
2.8. PAP Reduced Oxidative Stress in UVB-Irradiated Mice
2.9. PAP Regulates the Expression of MMP-1, TIMP-1, Col-Ⅰ, Col-Ⅲ, and TGF-β1 to Repair Photoaging in Mice
2.10. PAP Upregulated TGF-β and p-Smad 2/3 Expression in Skin Tissues
3. Discussion
4. Materials and Methods
4.1. Materials and Reagents
4.2. Preparation of Pilose Antler Protein
4.3. Cell Culture
4.4. UVB Irradiation and Drug Therapy
4.5. ROS Assay in HaCaT Cells
4.6. Analysis of SOD, GSH-Px, CAT, and MDA Contents in HaCaT Cells
4.7. Detection of Type I Collagen and Hyaluronic Acid in HaCaT Cells
4.8. Real-Time qPCR (RT-qPCR) Analysis
4.9. Western Blotting
4.10. Animals and Treatments
4.11. Histological Analysis
4.12. Measurement of IL-6, TNF-α, and IL-1β in Serum
4.13. Measurement of Hyp and MMP-1
4.14. Analysis of SOD, GSH-Px, CAT, and MDA Contents in Mice
4.15. Real-Time qPCR (RT-qPCR) Analysis of mRNA in Skin Tissues
4.16. Western Blotting
4.17. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Strakosha, M.; Vega-Mendoza, D.; Kane, J.; Jain, A.; Sun, L.; Rockowitz, S.; Elkins, M.; Miyake, K.; Chou, J.; Karasuyama, H.; et al. Basophils Play a Protective Role in the Recovery of Skin Barrier Function from Mechanical Injury in Mice. J. Investig. Dermatol. 2024, 144, 1784–1797. [Google Scholar] [CrossRef] [Scilit]
- Quan, T. Molecular insights of human skin epidermal and dermal aging. J. Dermatol. Sci. 2023, 112, 48–53. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.; Shin, J.Y.; Kang, E.S.; Kim, J.H.; Jang, S.I.; Cho, B.O. Kushenol C from Sophora flavescens protects against UVB-induced skin damage in mice through suppression of inflammation and oxidative stress. Heliyon 2023, 9, e22804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanveer, M.A.; Rashid, H.; Tasduq, S.A. Molecular basis of skin photoaging and therapeutic interventions by plant-derived natural product ingredients: A comprehensive review. Heliyon 2023, 9, e13580. [Google Scholar] [CrossRef] [Scilit]
- Pu, S.Y.; Huang, Y.L.; Pu, C.M.; Kang, Y.N.; Hoang, K.D.; Chen, K.H.; Chen, C. Effects of Oral Collagen for Skin Anti-Aging: A Systematic Review and Meta-Analysis. Nutrients 2023, 15, 2080. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwon, K.R.; Alam, M.B.; Park, J.H.; Kim, T.H.; Lee, S.H. Attenuation of UVB-Induced Photo-Aging by Polyphenolic-Rich Spatholobus Suberectus Stem Extract Via Modulation of MAPK/AP-1/MMPs Signaling in Human Keratinocytes. Nutrients 2019, 11, 1341. [Google Scholar] [CrossRef] [Scilit]
- Pillai, S.; Oresajo, C.; Hayward, J. Ultraviolet radiation and skin aging: Roles of reactive oxygen species, inflammation and protease activation, and strategies for prevention of inflammation-induced matrix degradation—A review. Int. J. Cosmet. Sci. 2005, 27, 17–34. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Zheng, Y.; Cheng, X.; Meng, M.; Luo, Y.; Li, B. The anti-photoaging effect of antioxidant collagen peptides from silver carp (Hypophthalmichthys molitrix) skin is preferable to tea polyphenols and casein peptides. Food Funct. 2017, 8, 1698–1707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ibrahim, A.T. Negative impacts of ultraviolet-A radiation on antioxidant and oxidative stress biomarkers of African catfish Clarias gariepinus. Photochem. Photobiol. Sci. 2015, 14, 1337–1345. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.; Xiong, L.; Shu, X.; Chen, W.; Li, W.; Li, J.; Ma, L.; Xiao, Y.; Li, L. Antioxidant effects of bioactive compounds isolated from cordyceps and their protective effects against UVB-irradiated HaCaT cells. J. Cosmet. Dermatol. 2019, 18, 1899–1906. [Google Scholar] [CrossRef] [Scilit]
- Gu, Y.; Han, J.; Jiang, C.; Zhang, Y. Biomarkers, oxidative stress and autophagy in skin aging. Ageing Res. Rev. 2020, 59, 101036. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mei, M.; Cai, R.; Yu, Q.; Tian, R.; Zhu, W.; Song, J.; Wu, D. Salidroside alleviates UVB-induced skin damage by inhibiting keratinocytes pyroptosis via the AQP3/ROS/GSDMD-N signaling pathway. J. Funct. Foods 2023, 107, 105647. [Google Scholar] [CrossRef] [Scilit]
- Qin, H.; Zheng, X.; Zhong, X.; Shetty, A.K.; Elias, P.M.; Bollag, W.B. Aquaporin-3 in keratinocytes and skin: Its role and interaction with phospholipase D2. Arch. Biochem. Biophys. 2011, 508, 138–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, Y.; Li, C.; Wang, Q.; Gao, R.; Cai, X.; Wang, S.; Zhang, Y. The protective effect of collagen peptides from bigeye tuna (Thunnus obesus) skin and bone to attenuate UVB-induced photoaging via MAPK and TGF-β signaling pathways. J. Funct. Foods 2022, 93, 105101. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Jiang, R.; Wang, M.; Zhai, L.; Liu, J.; Xu, X.; Sun, L.; Zhao, D. Ginsenosides repair UVB-induced skin barrier damage in BALB/c hairless mice and HaCaT keratinocytes. J. Ginseng Res. 2022, 46, 115–125. [Google Scholar] [CrossRef] [Scilit]
- Orassay, A.; Sadvokassova, D.; Berdigaliyev, A.; Sagintayev, A.; Myrzagali, S.; Omarova, Z.; Toktarov, N.; Liu, D.; Xie, Y. Deer antler extract: Pharmacology, rehabilitation and sports medicine applications. Pharmacol. Res. Mod. Chin. Med. 2024, 10, 100316. [Google Scholar] [CrossRef] [Scilit]
- Yao, B.; Zhang, M.; Leng, X.; Liu, M.; Liu, Y.; Hu, Y.; Zhao, D.; Zhao, Y. Antler extracts stimulate chondrocyte proliferation and possess potent anti-oxidative, anti-inflammatory, and immune-modulatory properties. Vitr. Cell. Dev. Biol. Anim. 2018, 54, 439–448. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Yang, F.; Jia, R.; Yan, P.; Ma, L. Velvet antler polypeptide prevents the disruption of hepatic tight junctions via inhibiting oxidative stress in cholestatic mice and liver cell lines. Food Funct. 2020, 11, 9752–9763. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Ma, Y.; He, G.; Ma, S.; Wang, Y.; Sun, Y. Pilose antler extract restores type I and III collagen to accelerate wound healing. Biomed. Pharmacother. 2023, 161, 114510. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.; Wang, D.; Ren, J.; Sun, H.; Li, J.; Wang, S.; Shi, L.; Wang, Z.; Yao, M.; Zhao, H.; et al. Velvet Antler Peptides Reduce Scarring via Inhibiting the TGF-β Signaling Pathway during Wound Healing. Front. Med. 2021, 8, 799789. [Google Scholar] [CrossRef] [Scilit]
- Truong, V.L.; Bae, Y.J.; Bang, J.H.; Jeong, W.S. Combination of red ginseng and velvet antler extracts prevents skin damage by enhancing the antioxidant defense system and inhibiting MAPK/AP-1/NF-κB and caspase signaling pathways in UVB-irradiated HaCaT keratinocytes and SKH-1 hairless mice. J. Ginseng Res. 2024, 48, 323–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, C.; Peng, X.; Yang, J.; Chen, K.; Liu, X.; Zhao, Y.; Zhang, S.; Sun, S.; Zhang, J.; Ding, Q.; et al. Rg3-loaded P407/CS/HA hydrogel inhibits UVB-induced oxidative stress, inflammation and apoptosis in HaCaT cells. Biomed. Pharmacother. 2023, 165, 115177. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Jiang, R.; Jing, C.; Liu, J.; Xu, X.; Sun, L.; Zhao, D. Protective effect of oligosaccharides isolated from Panax ginseng C. A. Meyer against UVB-induced skin barrier damage in BALB/c hairless mice and human keratinocytes. J. Ethnopharmacol. 2022, 283, 114677. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Z.; Yang, S.; Chen, J.; Li, C.; Zhou, C.; Hong, P.; Sun, S.; Qian, Z.-J. Trehalose against UVB-induced skin photoaging by suppressing MMP expression and enhancing procollagen I synthesis in HaCaT cells. J. Funct. Foods 2020, 74, 104198. [Google Scholar] [CrossRef] [Scilit]
- Sá, M.; Queiroz-Junior, C.M.; Souza, P.E.A.; Diniz, I.M.A.; Oliveira, M.C.M.; Grossmann, S.M.C.; Souto, G.R. Effect of photobiomodulation on inflammatory cytokines produced by HaCaT keratinocytes. J. Oral. Biol. Craniofacial Res. 2024, 14, 79–85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Fu, Y.; Dai, H.; Wang, Q.; Gao, R.; Zhang, Y. Recent progress in preventive effect of collagen peptides on photoaging skin and action mechanism. Food Sci. Hum. Wellness 2022, 11, 218–229. [Google Scholar] [CrossRef] [Scilit]
- Wacewicz-Muczyńska, M.; Moskwa, J.; Puścion-Jakubik, A.; Naliwajko, S.K.; Niczyporuk, M.; Socha, K. Antioxidant Properties of Maqui Berry Extract (Aristotelia chilensis (Mol.) Stuntz) and Its Potential Photoprotective Role on Human Skin Fibroblasts. Molecules 2023, 28, 7802. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.-M.; Liu, Y.-X.; Liu, Y.-D.; Ho, C.-K.; Tsai, Y.-T.; Wen, D.-S.; Huang, L.; Zheng, D.-N.; Gao, Y.; Zhang, Y.-F.; et al. Salvianolic acid B protects against UVB-induced skin aging via activation of NRF2. Phytomedicine 2024, 130, 155676. [Google Scholar] [CrossRef] [Scilit]
- Xu, S.; Sun, X.; Zhu, Z.; Xin, Y.; Chen, C.; Luo, J. The extract of buds of Chrysanthemum morifolium ramat alleviated UVB-induced skin photoaging by regulating MAPK and Nrf2/ARE pathways. J. Ethnopharmacol. 2024, 332, 118352. [Google Scholar] [CrossRef] [Scilit]
- Keet, L.; Magcwebeba, T.; Abel, S.; Louw, A.; Gelderblom, W.; Lilly, M. Modulation of UVB-induced oxidative stress and inflammation in skin keratinocytes (HaCaT) utilising unfermented rooibos and honeybush aqueous extracts. J. Photochem. Photobiol. 2024, 22, 100242. [Google Scholar] [CrossRef] [Scilit]
- Ge, Y.; Li, M.; Bai, S.; Chen, C.; Zhang, S.; Cheng, J.; Wang, X. Doxercalciferol alleviates UVB-induced HaCaT cell senescence and skin photoaging. Int. Immunopharmacol. 2024, 127, 111357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Divya, S.P.; Wang, X.; Pratheeshkumar, P.; Son, Y.-O.; Roy, R.V.; Kim, D.; Dai, J.; Hitron, J.A.; Wang, L.; Asha, P.; et al. Blackberry extract inhibits UVB-induced oxidative damage and inflammation through MAP kinases and NF-κB signaling pathways in SKH-1 mice skin. Toxicol. Appl. Pharmacol. 2015, 284, 92–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, X.; Wu, T.; Liu, T.; Yang, H.; Ding, X.; Chen, Y.; Mu, Y. Vicenin-2 ameliorates oxidative damage and photoaging via modulation of MAPKs and MMPs signaling in UVB radiation exposed human skin cells. J. Photochem. Photobiol. B Biol. 2019, 190, 76–85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, L.; Bowman, L.; Meighan, T.G.; Pratheeshkumar, P.; Shi, X.; Ding, M. Induction of miR-21-PDCD4 signaling by UVB in JB6 cells involves ROS-mediated MAPK pathways. Exp. Toxicol. Pathol. 2013, 65, 1145–1148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, M.S.; Yoo, M.S.; Son, D.J.; Jung, H.Y.; Lee, S.H.; Jung, J.K.; Lee, B.C.; Yun, Y.P.; Pyo, H.B.; Hong, J.T. Increase of collagen synthesis by obovatol through stimulation of the TGF-β signaling and inhibition of matrix metalloproteinase in UVB-irradiated human fibroblast. J. Dermatol. Sci. 2007, 46, 127–137. [Google Scholar] [CrossRef] [Scilit]
- Lioi, M.; Tengattini, S.; Gotti, R.; Bagatin, F.; Galliani, S.; Massolini, G.; Daly, S.; Temporini, C. Chromatographic separation by RPLC-ESI-MS of all hydroxyproline isomers for the characterization of collagens from different sources. J. Chromatogr. A 2024, 1720, 464771. [Google Scholar] [CrossRef] [Scilit]
- Xing, H.; Pan, X.; Hu, Y.; Yang, Y.; Zhao, Z.; Peng, H.; Wang, J.; Li, S.; Hu, Y.; Li, G.; et al. High molecular weight hyaluronic acid-liposome delivery system for efficient transdermal treatment of acute and chronic skin photodamage. Acta Biomater. 2024, 182, 171–187. [Google Scholar] [CrossRef] [Scilit]
- Filatov, V.; Sokolova, A.; Savitskaya, N.; Olkhovskaya, M.; Varava, A.; Ilin, E.; Patronova, E. Synergetic Effects of Aloe Vera Extract with Trimethylglycine for Targeted Aquaporin 3 Regulation and Long-Term Skin Hydration. Molecules 2024, 29, 1540. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.M.; Chung, K.S.; Yoon, Y.S.; Jang, S.Y.; Heo, S.W.; Park, G.; Jang, Y.P.; Ahn, H.S.; Shin, Y.K.; Lee, S.H.; et al. Dieckol Isolated from Eisenia bicyclis Ameliorates Wrinkling and Improves Skin Hydration via MAPK/AP-1 and TGF-β/Smad Signaling Pathways in UVB-Irradiated Hairless Mice. Mar. Drugs 2022, 20, 779. [Google Scholar] [CrossRef] [Scilit]






| Group | UVB Radiation | Drug Concentration |
|---|---|---|
| Control | 0 | 0 |
| Model | 40 mJ/cm2 | 0 |
| SP | 40 mJ/cm2 | 100 μg/mL |
| SP | 40 mJ/cm2 | 200 μg/mL |
| SP | 40 mJ/cm2 | 300 μg/mL |
| HP | 40 mJ/cm2 | 100 μg/mL |
| HP | 40 mJ/cm2 | 200 μg/mL |
| HP | 40 mJ/cm2 | 300 μg/mL |
| Primer Name | Sequence | Length |
|---|---|---|
| IVL-F | TTCCTCCTCCAGTCAATACCCATC | 24 |
| IVL-R | GCAGTCCCTTTACAGCAGTCATG | 23 |
| FLG-F | CTCATCACAGCCACACCACATC | 22 |
| FLG-R | GCCATCTCCTGATTGTTCCTTGTC | 24 |
| ColI-F | GGCAAAGAAGGCGGCAAAGG | 20 |
| ColI-R | GGAGCACCAGCAGGACCATC | 20 |
| TGF-β1-F | GCAACAATTCCTGGCGATACCTC | 23 |
| TGFβ1-R | CCTCCACGGCTCAACCACTG | 20 |
| MMP1-F | TTACACGCCAGATTTGCCAAGAG | 23 |
| MMP1-R | TCAGAGGTGTGACATTACTCCAGAG | 25 |
| AQP3-F | TGTGCTTCCTGGCTCGTGAG | 20 |
| AQP3-R | GCTGGTTGTCGGCGAAGTG | 19 |
| GAPDH-F | ACCCACTCCTCCACCTTTGAC | 21 |
| GAPDH-R | TCTACCACCCTGTTGCTGTAG | 21 |
| Name | Company |
|---|---|
| Rabbit Anti-JNK, ERK, P38 Monoclonal Antibody | Cell Signaling Technology (Danvers, MA, USA) |
| Rabbit anti-phosphorylated JNK, ERK, P38 polyclonal antibody | Cell Signaling Technology |
| Rabbit anti-β-actin polyclonal antibody | Cell Signaling Technology |
| Rabbit anti-GAPDH monoclonal antibody | Cell Signaling Technology |
| Mouse Anti-TGF-β1 Monoclonal Antibody | Abcam (Cambridge, UK) |
| Rabbit anti-p-SMAD2/3 polyclonal antibody | Abcam |
| Mouse secondary antibody, rabbit secondary antibody | Thermo Scientific (Waltham, MA, USA) |
| Primer Name | Sequence | Length |
|---|---|---|
| TIMP1-F | GGCATCTGGCATCCTCTTGTTG | 22 |
| TIMP1-R | AAGGTGGTCTCGTTG ATTTCTGG | 23 |
| Col3-F | GACAACTGATGGTGCTACTCTGAG | 24 |
| Col3-R | AGTGGGATGAAGAAGGGTGAGAAG | 24 |
| Col1-F | CTGACTGGAAGAGCGGAGAGTAC | 23 |
| Col1-R | AGTAGGGAACACACAGGTCTGAC | 23 |
| TGFβ1-F | AGCAACAATTCCTGGCGTTACC | 22 |
| TGFβ1-R | GTATTCCGTCTCCTTGGTTCAGC | 23 |
| MMP1-F | CCAAATCCCATCCAGCCAACAG | 22 |
| MMP1-R | CCCGAATGTAGAACCTGCCTTTG | 23 |
| GAPDH-F | GCAAATTCAACGGCACAGTCAAG | 23 |
| GAPDH-R | ACACCAGTAGACTCCACGACATAC | 24 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, K.; Zhao, C.; Zhang, K.; Yang, X.; Feng, R.; Zong, Y.; He, Z.; Zhao, Y.; Du, R. Pilose Antler Protein Relieves UVB-Induced HaCaT Cells and Skin Damage. Molecules 2024, 29, 4060. https://doi.org/10.3390/molecules29174060
Liu K, Zhao C, Zhang K, Yang X, Feng R, Zong Y, He Z, Zhao Y, Du R. Pilose Antler Protein Relieves UVB-Induced HaCaT Cells and Skin Damage. Molecules. 2024; 29(17):4060. https://doi.org/10.3390/molecules29174060
Chicago/Turabian StyleLiu, Kaiyue, Chenxu Zhao, Ke Zhang, Xiaoyue Yang, Ruyi Feng, Ying Zong, Zhongmei He, Yan Zhao, and Rui Du. 2024. "Pilose Antler Protein Relieves UVB-Induced HaCaT Cells and Skin Damage" Molecules 29, no. 17: 4060. https://doi.org/10.3390/molecules29174060
APA StyleLiu, K., Zhao, C., Zhang, K., Yang, X., Feng, R., Zong, Y., He, Z., Zhao, Y., & Du, R. (2024). Pilose Antler Protein Relieves UVB-Induced HaCaT Cells and Skin Damage. Molecules, 29(17), 4060. https://doi.org/10.3390/molecules29174060

