Phenolic Compounds from Sonchus arvensis Linn. and Hemerocallis citrina Baroni. Inhibit Sucrose and Stearic Acid Induced Damage in Caenorhabditis elegans
Abstract
1. Introduction
2. Results
2.1. Extraction and Component Analysis of SAP and HCP
2.2. Effects of SAP and HCP on the Body Length, Progeny Production and Lifespan of C. elegans
2.3. Effects of SAP and HCP on the Body Length, Progeny Production and Lifespan of Sucrose-incubated C. elegans
2.4. Effects of SAP and HCP on the Body Length, Progeny Production and Lifespan of Stearic Acid-Incubated C. elegans
2.5. Effects of SAP and HCP on Gene Expressions in C. elegans
3. Materials and Methods
3.1. Reagents
3.2. Preparation of Phenolic Compunds from Sonchus arvensis Linn. or Hemerocallis citrina Baroni
3.3. Phenolic Compositions Analysis of SAP and HCP
3.4. C. elegans Culture and Treatment
3.5. Body Length, Progeny Production and Lifespan Assay
3.6. Quantitative Reverse Transcription-PCR
3.7. Statistical Analysis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Yeh, S.H.-H.; Shie, F.-S.; Liu, H.-K.; Yao, H.-H.; Kao, P.-C.; Lee, Y.-H.; Chen, L.-M.; Hsu, S.-M.; Chao, L.-J.; Wu, K.-W.; et al. A high-sucrose diet aggravates Alzheimer’s disease pathology, attenuates hypothalamic leptin signaling, and impairs food-anticipatory activity in APPswe/PS1dE9 mice. Neurobiol. Aging 2019, 90, 60–74. [Google Scholar] [CrossRef] [Scilit]
- Oshio, L.T.; Andreazzi, A.E.; Lopes, J.F.; de Sá, J.P.; Bolotari, M.; Costa, V.M.G.; Guerra, M.D.O.; Peters, V.M. A paternal hypercaloric diet affects the metabolism and fertility of F1 and F2 Wistar rat generations. J. Dev. Orig. Health Dis. 2020, 11, 653–663. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Zwieten, P.A.; Mancia, G. Background and Treatment of Metabolic Syndrome: A Therapeutic Challenge. Semin. Cardiothorac. Vasc. Anesthesia 2006, 10, 206–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, D.-Z.; Yu, X.-F.; Zhu, Z.-Y.; Zou, Z.-D. Antioxidant and antibacterial activity of six edible wild plants (Sonchus spp.) in China. Nat. Prod. Res. 2011, 25, 1893–1901. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Torres-González, L.; Cienfuegos-Pecina, E.; Perales-Quintana, M.M.; Alarcon-Galvan, G.; Muñoz-Espinosa, L.E.; Pérez-Rodríguez, E.; Cordero-Pérez, P. Nephroprotective Effect of Sonchus oleraceus Extract against Kidney Injury Induced by Ischemia-Reperfusion in Wistar Rats. Oxidative Med. Cell. Longev. 2018, 2018, 9572803. [Google Scholar] [CrossRef] [Scilit]
- Yuan, T.; Wu, D.; Sun, K.; Tan, X.; Wang, J.; Zhao, T.; Ren, B.; Zhao, B.; Liu, Z.; Liu, X. Anti-Fatigue Activity of Aqueous Extracts of Sonchus arvensis L. in Exercise Trained Mice. Molecules 2019, 24, 1168. [Google Scholar] [CrossRef] [Scilit]
- Khan, R.A. Evaluation of flavonoids and diverse antioxidant activities of Sonchus arvensis. Chem. Cent. J. 2012, 6, 126. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.M.; Yim, M.-J.; Choi, G.; Lee, M.S.; Park, Y.G.; Lee, D.-S. Antioxidant and Anti-inflammatory Activity of Six Halophytes in Korea. Nat. Prod. Sci. 2018, 24, 40–46. [Google Scholar] [CrossRef] [Scilit]
- Hou, F.; Li, S.; Wang, J.; Kang, X.; Weng, Y.; Xing, G. Identification and validation of reference genes for quantitative real-time PCR studies in long yellow daylily, Hemerocallis citrina Borani. PLoS ONE 2017, 12, e0174933. [Google Scholar] [CrossRef] [Scilit]
- Yang, R.-F.; Geng, L.-L.; Lu, H.-Q.; Fan, X.-D. Ultrasound-synergized electrostatic field extraction of total flavonoids from Hemerocallis citrina Baroni. Ultrason. Sonochemistry 2017, 34, 571–579. [Google Scholar] [CrossRef] [Scilit]
- Li, C.-F.; Chen, X.-Q.; Chen, S.-M.; Geng, D.; Liu, Q.; Yi, L.-T. Evaluation of the toxicological properties and anti-inflammatory mechanism of Hemerocallis citrina in LPS-induced depressive-like mice. Biomed. Pharmacother. 2017, 91, 167–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mori, S.; Takizawa, M.; Satou, M.; Sakasai, M.; Kusuoku, H.; Nojiri, H.; Yoshizuka, N.; Hotta, M.; Kitahara, T.; Hase, T.; et al. Enhancement of Lipolytic Responsiveness of Adipocytes by Novel Plant Extract in Rat. Exp. Biol. Med. 2009, 234, 1445–1449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, M.; He, Z.; Zhao, Y.; Yang, J.; Mao, L. Antioxidant properties and involved compounds of daylily flowers in relation to maturity. Food Chem. 2009, 114, 1192–1197. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Hu, D.; Hou, J.; Li, S.; Wang, W.; Li, J.; Bai, J. Ethyl Acetate Fraction of Hemerocallis citrina Baroni Decreases Tert-butyl Hydroperoxide-Induced Oxidative Stress Damage in BRL-3A Cells. Oxidative Med. Cell. Longev. 2018, 2018, 1526125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hao, Z.; Liang, L.; Liu, H.; Yan, Y.; Zhang, Y. Exploring the Extraction Methods of Phenolic Compounds in Daylily (Hemerocallis citrina Baroni) and Its Antioxidant Activity. Molecules 2022, 27, 2964. [Google Scholar] [CrossRef] [Scilit]
- Shen, P.Y.; Yue, Y.R.; Zheng, J.; Park, Y. Caenorhabditis elegans: A convenient in vivo model for assessing the impact of food bioactive compounds on obesity, aging, and Alzheimer’s disease. Annu. Rev. Food Sci. Technol. 2018, 9, 1–22. [Google Scholar] [CrossRef] [Scilit]
- Zheng, J.; Greenway, F.L. Caenorhabditis elegans as a model for obesity research. Int. J. Obes. 2012, 36, 186–194. [Google Scholar] [CrossRef] [Scilit]
- Martorell, P.; Llopis, S.; González, N.; Montón, F.; Ortiz, P.; Genovés, S.; Ramón, D. Caenorhabditis elegans as a Model to Study the Effectiveness and Metabolic Targets of Dietary Supplements Used for Obesity Treatment: The Specific Case of a Conjugated Linoleic Acid Mixture (Tonalin). J. Agric. Food Chem. 2012, 60, 11071–11079. [Google Scholar] [CrossRef] [Scilit]
- Gumienny, T.; Savage-Dunn, C. TGF-beta signaling in C. elegans. Wormbook 2013, 1–34. [Google Scholar] [CrossRef] [Scilit]
- Murphy, C.T.; Hu, P.J. Insulin/insulin-like growth factor signaling in C. elegans. Wormbook Online Rev. C. Elegans Biol. 2013, 1–43. [Google Scholar] [CrossRef] [Scilit]
- Hua, Q.-X.; Nakagawa, S.H.; Wilken, J.; Ramos, R.R.; Jia, W.; Bass, J.; Weiss, M.A. A divergent INS protein in Caenorhabditis elegans structurally resembles human insulin and activates the human insulin receptor. Genes Dev. 2003, 17, 826–831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Liu, X.; Wang, D.; Su, L.; Zhao, T.; Li, Z.; Lin, C.; Zhang, Y.; Huang, B.; Lu, J.; et al. O-GlcNAcylation of SKN-1 modulates the lifespan and oxidative stress resistance in Caenorhabditis elegans. Sci. Rep. 2017, 7, 43601. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyase, T.; Fukusgima, S. Studies on sesquiterpene glycosides from Sonchus oleraceus. Chem. Pharm. Bull. 1987, 35, 2869–2874. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Zhong, X.; Jiang, Y.; Yu, L.; Huang, X.; Dong, Z.; Yang, S.; He, W.; Zeng, J.; Qing, Z. Systematic identification metabolites of Hemerocallis citrina Borani by high-performance liquid chromatography/quadrupole-time-of-flight mass spectrometry combined with a screening method. J. Pharm. Biomed. Anal. 2020, 186, 113314. [Google Scholar] [CrossRef] [Scilit]
- Oliveira, R.P.; Abate, J.P.; Dilks, K.; Landis, J.; Ashraf, J.; Murphy, C.T.; Blackwell, T.K. Condition-adapted stress and longevity gene regulation by Caenorhabditis elegans SKN-1/Nrf. Aging Cell 2009, 8, 524–541. [Google Scholar] [CrossRef] [Scilit]
- Savage-Dunn, C.; Yu, L.; Gill, K.; Awan, M.; Fernando, T. Non-stringent tissue-source requirements for BMP ligand expression in regulation of body size in Caenorhabditis elegans. Genet. Res. 2011, 93, 427–432. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.J.; Tokarz, R.; Savage-Dunn, C. The expression of tgf beta signal transducers in the hypodermis regulates body size in C. elegans. Development 2002, 129, 4989–4998. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Zhang, L.; Zhang, L.; Wang, W.; Wei, S.; Wang, J.; Che, H.; Zhang, Y. Effects of excess sugars and lipids on the growth and development of Caenorhabditis elegans. Genes Nutr. 2020, 15, 11. [Google Scholar] [CrossRef] [Scilit]
- Meng, S.; Cao, J.; Feng, Q.; Peng, J.; Hu, Y. Roles of Chlorogenic Acid on Regulating Glucose and Lipids Metabolism: A Review. Evid. Based Complement. Altern. Med. 2013, 2013, 801457. [Google Scholar] [CrossRef] [Scilit]
- Rice-Evans, C.A.; Miller, N.J. Antioxidant activities of flavonoids as bioactive components of food. Biochem. Soc. Trans. 1996, 24, 790–795. [Google Scholar] [CrossRef] [Scilit]
- Heitman, E.; Ingram, D.K. Cognitive and neuroprotective effects of chlorogenic acid. Nutr. Neurosci. 2017, 20, 32–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cordeiro, L.M.; Soares, M.V.; da Silva, A.F.; Machado, M.L.; Baptista, F.B.O.; da Silveira, T.L.; Arantes, L.P.; Soares, F.A.A. Neuroprotective effects of rutin on ASH neurons in Caenorhabditis elegans model of Huntington’s disease. Nutr. Neurosci. 2021, 25, 1–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, X.; Wang, W.; Chu, W. Antioxidant and reducing lipid accumulation effects of rutin in Caenorhabditis elegans. BioFactors 2021, 47, 686–693. [Google Scholar] [CrossRef] [Scilit]
- An, J.H.; Vranas, K.; Lucke, M.; Inoue, H.; Hisamoto, N.; Matsumoto, K.; Blackwell, T.K. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proc. Natl. Acad. Sci. USA 2005, 102, 16275–16280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fuse, Y.; Kobayashi, M. Conservation of the Keap1-Nrf2 System: An Evolutionary Journey through Stressful Space and Time. Molecules 2017, 22, 436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, S.-Q.; Huang, X.-B.; Xing, T.-K.; Ding, A.-J.; Wu, G.-S.; Luo, H.-R. Chlorogenic Acid Extends the Lifespan of Caenorhabditis elegans via Insulin/IGF-1 Signaling Pathway. J. Gerontol. Ser. A 2017, 72, 464–472. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Zhang, R.; Wang, D. Response of DBL-1/TGF-β signaling-mediated neuron-intestine communication to nanopolystyrene in nematode Caenorhabditis elegans. Sci. Total. Environ. 2020, 745, 141047. [Google Scholar] [CrossRef] [Scilit]
- Miyazono, K. Tgf-beta/smad signaling and its involvement in tumor progression. Biol. Pharm. Bull. 2000, 23, 1125–1130. [Google Scholar] [CrossRef] [Scilit]
- Yoshida, S.; Morita, K.; Mochii, M.; Ueno, N. Hypodermal Expression of Caenorhabditis elegans TGF-β Type I Receptor SMA-6 Is Essential for the Growth and Maintenance of Body Length. Dev. Biol. 2001, 240, 32–45. [Google Scholar] [CrossRef] [Scilit]






| SAP | HCP | ||
|---|---|---|---|
| Composition | Content (μg/g Dry Material) | Composition | Content (μg/g Dry Material) |
| Chlorogenic acid | 1061.01 ± 1.12 | Rutin | 5721.11 ± 10.63 |
| Hyperin | 7.87 ± 0.006 | Chlorogenic acid | 73.62 ± 0.39 |
| Rutin | 3.90 ± 0.09 | Quercetin | 13.02 ± 0.14 |
| Apigenin | 1.70 ± 0.012 | Caffeic acid | 9.35 ± 0.053 |
| Quercetin | 0.15 ± 0.04 | Protocatechin | 3.02 ± 0.02 |
| Scopoletin | 0.15 ± 0.0003 | Isorhamnetin | 1.50 ± 0.12 |
| Chrysoeriol | 0.08 ± 0.00003 | Taxifolin | 0.79 ± 0.003 |
| Gentisic acid | 0.34 ± 0.0008 | ||
| SAP (μg/mL) | Average Life (Days) | Relative Life Rate of Change (%) | HCP (μg/mL) | Average Life (Days) | Relative Life Rate of Change (%) |
|---|---|---|---|---|---|
| 0 | 8.43 ± 0.18 b | 0 | 8.43 ± 0.13 a | ||
| 500 | 10.38 ± 0.39 a | +23.14 | 400 | 9.13 ± 0.63 a | +8.31 |
| 1000 | 10.38 ± 0.81 a | +23.14 | 800 | 8.9 ± 0.15 a | +5.64 |
| 2000 | 9.23 ± 0.67 ab | +10.09 | 1200 | 8.1 ± 0.75 a | −3.86 |
| Group | Average Life (Days) | Relative Life Rate of Change (%) | Group | Average Life (Days) | Relative Life Rate of Change (%) |
|---|---|---|---|---|---|
| Control | 8.43 ± 0.13 c | Control | 8.43 ± 0.13 b | ||
| Sucrose (100 mM) | 7.45 ± 0.00 d | −11.57 | Sucrose (100 mM) | 7.45 ± 0.00 c | −11.57 |
| Sucrose (100 mM) + SAP (500 μg/mL) | 9.60 ± 0.20 a | +28.86 | Sucrose (100 mM) + HCP (400 μg/mL) | 8.68 ± 0.08 b | +16.44 |
| Sucrose (100 mM) + SAP (1000 μg/mL) | 9.13 ± 0.08 b | +22.48 | Sucrose (100 mM) + HCP (800 μg/mL) | 10.48 ± 0.08 a | +40.60 |
| Sucrose (100 mM) + SAP (2000 μg/mL) | 9.80 ± 0.15 a | +31.54 | Sucrose (100 mM) + HCP (1200 μg/mL) | 10.23 ± 0.23 a | +37.25 |
| Group | Average Life (Days) | Relative Life Rate of Change (%) | Group | Average Life (Days) | Relative Life Rate of Change (%) |
|---|---|---|---|---|---|
| Control | 8.43 ± 0.13 bc | Control | 8.43 ± 0.13 b | ||
| Stearic acid (352 mM) | 8.25 ± 0.10 c | −2.08 | Stearic acid (352 mM) | 8.25 ± 0.10 b | −2.08 |
| Stearic acid (352 mM) + SAP (500 μg/mL) | 9.88 ± 0.93 ab | +19.70 | Stearic acid (352 mM) + HCP (400 μg/mL) | 9.38 ± 0.18 b | +13.64 |
| Stearic acid (352 mM) + SAP (1000 μg/mL) | 11.08 ± 0.03 a | +34.24 | Stearic acid (352 mM) + HCP (800 μg/mL) | 12.15 ± 0.45 a | +47.27 |
| Stearic acid (352 mM) + SAP (2000 μg/mL) | 9.13 ± 0.03 bc | +10.61 | Stearic acid(352 mM) + HCP(1200 μg/mL) | 11.08 ± 0.73 a | +34.24 |
| Gene Name | Function | Ref. |
|---|---|---|
| skn-1 | promote oxidative stress resistance; anti-aging | [22,25] |
| daf-7 | enhance stress resistance | [19] |
| dbl-1 | the signaling ligand of TGF beta-related pathway; promote growth | [26] |
| sma-4 | regulate body size | [27] |
| Genes | Primer Sequences | Product Sizes | |
|---|---|---|---|
| Forward (5′-3′) | Reverse (5′-3′) | ||
| act-1 | ACTCTGGAGATGGTGTCA | CGTCAGGAAGTTCGTAGG | 273 |
| daf-7 | CGAGAAGAACGAGGATGG | TTGCCTTGACGAAGATACC | 152 |
| skn-1 | ATCCACCAGCATCTCCAT | CTTCTCCATAGCACATCAATC | 121 |
| dbl-1 | TCCGCTTATTGTGTTCAGT | GGTGCCATAATCCAGTCTT | 201 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
An, Q.; Zhang, L.; Qin, X.; Wang, X.; Wang, W.; Meng, Q.; Zhang, Y. Phenolic Compounds from Sonchus arvensis Linn. and Hemerocallis citrina Baroni. Inhibit Sucrose and Stearic Acid Induced Damage in Caenorhabditis elegans. Molecules 2023, 28, 1707. https://doi.org/10.3390/molecules28041707
An Q, Zhang L, Qin X, Wang X, Wang W, Meng Q, Zhang Y. Phenolic Compounds from Sonchus arvensis Linn. and Hemerocallis citrina Baroni. Inhibit Sucrose and Stearic Acid Induced Damage in Caenorhabditis elegans. Molecules. 2023; 28(4):1707. https://doi.org/10.3390/molecules28041707
Chicago/Turabian StyleAn, Qin, Lei Zhang, Xiyue Qin, Xiong Wang, Wenli Wang, Qingyong Meng, and Yali Zhang. 2023. "Phenolic Compounds from Sonchus arvensis Linn. and Hemerocallis citrina Baroni. Inhibit Sucrose and Stearic Acid Induced Damage in Caenorhabditis elegans" Molecules 28, no. 4: 1707. https://doi.org/10.3390/molecules28041707
APA StyleAn, Q., Zhang, L., Qin, X., Wang, X., Wang, W., Meng, Q., & Zhang, Y. (2023). Phenolic Compounds from Sonchus arvensis Linn. and Hemerocallis citrina Baroni. Inhibit Sucrose and Stearic Acid Induced Damage in Caenorhabditis elegans. Molecules, 28(4), 1707. https://doi.org/10.3390/molecules28041707

