Novel Pectic Polysaccharides Isolated from Immature Honey Pomelo Fruit with High Immunomodulatory Activity
Abstract
1. Introduction
2. Results and Discussion
2.1. Extraction and Purification of Pectic Polysaccharides from IPF
2.2. Analysis of the HPP-1 Structure
2.2.1. UV Scan and Molecular Mass Detection
2.2.2. FT-IR Spectrum
2.2.3. Monosaccharide Composition Assay
2.2.4. Periodate Oxidation-Smith Degradation Analysis
2.2.5. NMR Analysis
2.3. Immunomodulatory Activities of HPP-1 on RAW264.7 Cells
2.3.1. Effect of HPP-1 on RAW264.7 Cell Viability
2.3.2. Effect of HPP-1 on the Phagocytic Capacities of RAW264.7 Cells
2.3.3. Effects of HPP-1 on Macrophage NO, TNF-α, and IL-6 Production
2.3.4. Effects of HPP-1 on iNOS, TNF-α, and IL-6 mRNA Levels in Macrophages
2.4. Effect of HPP-1 on Nf-κB and MAPKs Signaling Pathways in Murine Macrophages
2.5. Pattern Recognition Receptors and Potential Molecular Mechanisms of HPP-1-Induced Macrophage Immunomodulation Activity
3. Methods and Materials
3.1. Materials and Chemicals
3.2. Extraction of HPP
3.3. Purification of Crude Pectin
3.4. Analysis of the HPP-1 Chemical Structure
3.4.1. Ultraviolet Full Wavelength Scan
3.4.2. HPGPC Molecular Mass Detection
3.4.3. Fourier Transform Infrared Spectroscopy (FT-IR) Analysis
3.4.4. Monosaccharide Composition
3.4.5. Periodic Acid Oxidation and Smith Degradation Analysis
3.4.6. NMR Analysis
3.5. Immunomodulatory Activity of HPP-1
3.5.1. Cytotoxicity Test
3.5.2. Phagocytic Ability
3.5.3. Effect of HPP-1 Components on the Secretion of NO, TNF-α, and IL-6
3.6. Immunomodulatory Mechanism of HPP-1
3.6.1. Effect of HPP-1 Components on the Expression of iNOS, TNF-α, and IL-6 mRNA
3.6.2. Western Bolt Analysis
3.6.3. Receptor of HPP-1 on RAW264.7 Cells Involving in Immunomodulation
3.7. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Van Hung, P.; Nhi, N.H.Y.; Ting, L.Y.; Phi, N.T.L. Chemical Composition and Biological Activities of Extracts from Pomelo Peel By-Products under Enzyme and Ultrasound-Assisted Extractions. J. Chem. 2020, 1, 1043251. [Google Scholar] [CrossRef] [Scilit]
- Liu, G.; Hou, T.; Guo, S.; Lin, H.; Chen, M.; Miao, J.; Liu, X.; Huang, Y.; Cao, Y.; Lan, Y.; et al. Comprehensive Utilization of Immature Honey Pomelo Fruit for the Production of Value-Added Compounds Using Novel Continuous Phase Transition Extraction Technology. Biology 2021, 10, 815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nunes, C.; Silva, L.; Fernandes, A.P.; Guiné, R.P.F.; Domingues, M.R.M.; Coimbra, M.A. Occurrence of Cellobiose Residues Directly Linked to Galacturonic Acid in Pectic Polysaccharides. Carbohydr. Polym. 2012, 87, 620–626. [Google Scholar] [CrossRef] [Scilit]
- Souto-Maior, J.F.A.; Reis, A.V.; Pedreiro, L.N.; Cavalcanti, O.A. Phosphated Crosslinked Pectin as a Potential Excipient for Specific Drug Delivery: Preparation and Physicochemical Characterization. Polym. Int. 2010, 59, 127–135. [Google Scholar] [CrossRef] [Scilit]
- Xing, X.; Cui, S.W.; Nie, S.; Phillips, G.O.; Goff, H.D.; Wang, Q. A Review of Isolation Process, Structural Characteristics, and Bioactivities of Water-Soluble Polysaccharides from Dendrobium Plants. Bioact. Carbohydr. Diet. Fibre 2013, 1, 131–147. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, S.S.; Passos, C.P.; Madureira, P.; Vilanova, M.; Coimbra, M.A. Structure–Function Relationships of Immunostimulatory Polysaccharides: A Review. Carbohydr. Polym. 2015, 132, 378–396. [Google Scholar] [CrossRef] [Scilit]
- Venzon, S.S.; Canteri, M.H.G.; Granato, D.; Demczuk, B., Jr.; Maciel, G.M.; Stafussa, A.P.; Haminiuk, C.W.I. Physicochemical Properties of Modified Citrus Pectins Extracted from Orange Pomace. J. Food Sci. Technol. 2014, 52, 4102–4112. [Google Scholar] [CrossRef] [Scilit]
- Salman, H.; Bergman, M.; Djaldetti, M.; Orlin, J.; Bessler, H. Citrus Pectin Affects Cytokine Production by Human Peripheral Blood Mononuclear Cells. Biomed. Pharmacother. 2008, 62, 579–582. [Google Scholar] [CrossRef] [Scilit]
- Platt, D.; Raz, A. Modulation of the Lung Colonization of B16-F1 Melanoma Cells by Citrus Pectin. JNCI J. Natl. Cancer Inst. 1992, 84, 438–442. [Google Scholar] [CrossRef] [Scilit]
- Pérez Marín, A.B.; OrtuñO, J.F.; Aguilar, M.I.; Meseguer, V.F.; Sáez, J.; Lloréns, M. Use of Chemical Modification to Determine the Binding of Cd(II), Zn(II) and Cr(III) Ions by Orange Waste. Biochem. Eng. J. 2010, 53, 2–6. [Google Scholar] [CrossRef] [Scilit]
- Katav, T.; Liu, L.S.; Traitel, T.; Goldbart, R.; Wolfson, M.; Kost, J. Modified Pectin-Based Carrier for Gene Delivery: Cellular Barriers in Gene Delivery Course. J. Control. Release 2008, 130, 183–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maciel, V.; Yoshida, C.; Franco, T.T. Chitosan/Pectin Polyelectrolyte Complex as a PH Indicator. Carbohydr. Polym. 2015, 132, 537–545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Q.; Nie, S.P.; Wang, J.Q.; Yin, P.F.; Huang, D.F.; Li, W.J.; Xie, M.Y. Toll-like Receptor 4-Mediated ROS Signaling Pathway Involved in Ganoderma Atrum Polysaccharide-Induced Tumor Necrosis Factor-α Secretion during Macrophage Activation. Food Chem. Toxicol. 2014, 66, 14–22. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Yang, X.-B.; Zhao, J.-W.; Lu, C.-J.; Zhu, W. Structural Characterization and Macrophage Immunomodulatory Activity of a Novel Polysaccharide from Smilax Glabra Roxb. Carbohydr. Polym. 2017, 156, 390–402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, L.; Jiao, K.; Luo, L.; Xiang, J.; Zhu, W. Characterization and Macrophage Immunomodulatory Activity of Two Polysaccharides from the Flowers of Paeonia Suffruticosa Andr. Int. J. Biol. Macromol. 2018, 124, 955–962. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.S.; Kwon, D.S.; Lee, K.R.; Park, J.M.; Ha, S.J.; Hong, E.K. Mechanism of Macrophage Activation Induced by Polysaccharide from Cordyceps Militaris Culture Broth. Carbohydr. Polym. 2015, 120, 29–37. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Yan, H.; Zhang, X. Structure and Immuno-Stimulating Activities of a New Heteropolysaccharide from Lentinula Edodes. J. Agric. Food Chem. 2012, 60, 11560–11566. [Google Scholar] [CrossRef] [Scilit]
- Liao, W.; Luo, Z.; Liu, D.; Ning, Z.; Yang, J.; Ren, J. Structure Characterization of a Novel Polysaccharide from Dictyophora Indusiata and Its Macrophage Immunomodulatory Activities. J. Agric. Food Chem. 2015, 63, 535–544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schepetkin, I.A.; Xie, G.; Kirpotina, L.N.; Klein, R.A.; Jutila, M.A.; Quinn, M.T. Macrophage Immunomodulatory Activity of Polysaccharides Isolated from Opuntia Polyacantha. Int. Immunopharmacol. 2008, 8, 1455–1466. [Google Scholar] [CrossRef] [Scilit]
- Meng, J.; Lien, E.; Golenbock, D.T. MD-2-Mediated Ionic Interactions between Lipid A and TLR4 Are Essential for Receptor Activation. J. Biol. Chem. 2010, 285, 8695–8702. [Google Scholar] [CrossRef] [Scilit]
- Zheng, P.; Fan, W.; Wang, S.; Hao, P.; Wang, Y.; Wan, H.; Hao, Z.; Liu, J.; Zhao, X. Characterization of Polysaccharides Extracted from Platycodon Grandiflorus (Jacq.) A. DC. Affecting Activation of Chicken Peritoneal Macrophages. Int. J. Biol. Macromol. 2017, 96, 775–785. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, B.; Jiang, Y.; Zhao, M.; Chen, F.; Wang, R.; Chen, Y.; Zhang, D. Structural Characterisation of Polysaccharides Purified from Longan (Dimocarpus Longan Lour.) Fruit Pericarp. Food Chem. 2009, 115, 609–614. [Google Scholar] [CrossRef] [Scilit]
- Maxwell, E.G.; Belshaw, N.J.; Waldron, K.W.; Morris, V.J. Pectin—An Emerging New Bioactive Food Polysaccharide. Trends Food Sci. Technol. 2012, 24, 64–73. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Liu, Y.; Qiang, M.; Wang, J. Structural Elucidation of a Pectin–Type Polysaccharide from Hovenia Dulcis Peduncles and Its Proliferative Activity on RAW264.7 Cells. Int. J. Biol. Macromol. 2017, 104, 1246–1253. [Google Scholar] [CrossRef] [Scilit]
- Min, B.; Lim, J.; Ko, S.; Lee, K.-G.; Lee, S.H.; Lee, S. Environmentally Friendly Preparation of Pectins from Agricultural Byproducts and Their Structural/Rheological Characterization. Bioresour. Technol. 2011, 102, 3855–3860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, J.; Shi, S.; Wang, H.; Liu, R.; Li, N.; Chen, Y.; Wang, S. Neutral Monosaccharide Composition Analysis of Plant-Derived Oligo- and Polysaccharides by High Performance Liquid Chromatography. Carbohydr. Polym. 2016, 136, 1273–1280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, F.; Zhou, C.; Zhou, D.; Ou, S.; Huang, H. Structural Characterization of a Novel Polysaccharide Fraction from Hericium Erinaceus and Its Signaling Pathways Involved in Macrophage Immunomodulatory Activity. J. Funct. Foods 2017, 37, 574–585. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Ge, B.; Li, Z.; Guan, F.; Li, F. Structural Analysis and Immunoregulation Activity Comparison of Five Polysaccharides from Angelica Sinensis. Carbohydr. Polym. 2016, 140, 6–12. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J. Structural Analysis of Pumpkin Acidic Polysaccharides and Their Interactions with Functional Protein. Ph.D. Thesis, China Agricultural University, Beijing, China, 2017. [Google Scholar]
- Liu, J.; Zhao, Y.; Wu, Q.; John, A.; Jiang, Y.; Yang, J.; Liu, H.; Yang, B. Structure Characterisation of Polysaccharides in Vegetable “Okra” and Evaluation of Hypoglycemic Activity. Food Chem. 2018, 242, 211–216. [Google Scholar] [CrossRef] [Scilit]
- Yu, Y.; Shen, M.; Song, Q.; Xie, J. Biological Activities and Pharmaceutical Applications of Polysaccharide from Natural Resources: A Review. Carbohydr. Polym. 2018, 183, 91–101. [Google Scholar] [CrossRef] [Scilit]
- Yin, M.; Zhang, Y.; Li, H. Advances in Research on Immunoregulation of Macrophages by Plant Polysaccharides. Front. Immunol. 2019, 10, 145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trakoolpolpruek, T.; Moonmangmee, S.; Chanput, W. Structure-Dependent Immune Modulating Activity of Okra Polysaccharide on THP-1 Macrophages. Bioact. Carbohydr. Diet. Fibre 2019, 17, 100173. [Google Scholar] [CrossRef] [Scilit]
- Sun, S.; Li, K.; Xiao, L.; Lei, Z.; Zhang, Z. Characterization of Polysaccharide from Helicteres Angustifolia L. and Its Immunomodulatory Activities on Macrophages RAW264.7. Biomed. Pharmacother. 2019, 109, 262–270. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.-R.; Han, A.-R.; Lim, T.-G.; Kang, J.-H.; Hong, H.-D. Discrimination of Structural and Immunological Features of Polysaccharides from Persimmon Leaves at Different Maturity Stages. Molecules 2019, 24, 356. [Google Scholar] [CrossRef] [Scilit]
- Huang, L.; Zhao, J.; Wei, Y.; Yu, G.; Li, F.; Li, Q. Structural Characterization and Mechanisms of Macrophage Immunomodulatory Activity of a Pectic Polysaccharide from Cucurbita Moschata Duch. Carbohydr. Polym. 2021, 269, 118288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Zhou, B.P. TNF-α/NF-ΚB/Snail Pathway in Cancer Cell Migration and Invasion. Br. J. Cancer 2010, 102, 639–644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balkwill, F. Tumour Necrosis Factor and Cancer. Nat. Rev. Cancer 2009, 9, 361–371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hotamisligil, G.S.; Peraldi, P.; Budavari, A.; Ellis, R.; White, M.F.; Spiegelman, B.M. IRS-1-Mediated Inhibition of Insulin Receptor Tyrosine Kinase Activity in TNF-α- and Obesity-Induced Insulin Resistance. Science 1996, 271, 665–670. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Chen, Q.; Lü, X. Pectin Extracted from Apple Pomace and Citrus Peel by Subcritical Water. Food Hydrocoll. 2014, 38, 129–137. [Google Scholar] [CrossRef] [Scilit]
- Du, Y.-Q.; Liu, Y.; Wang, J.-H. Polysaccharides from Umbilicaria Esculenta Cultivated in Huangshan Mountain and Immunomodulatory Activity. Int. J. Biol. Macromol. 2015, 72, 1272–1276. [Google Scholar] [CrossRef] [Scilit]
- Dumitru, C.D.; Ceci, J.D.; Tsatsanis, C.; Kontoyiannis, D.; Stamatakis, K.; Lin, J.-H.; Patriotis, C.; Jenkins, N.A.; Copeland, N.G.; Kollias, G.; et al. TNF-α Induction by LPS Is Regulated Posttranscriptionally via a Tpl2/ERK-Dependent Pathway. Cell 2000, 103, 1071–1083. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tili, E.; Michaille, J.-J.; Cimino, A.; Costinean, S.; Dumitru, C.D.; Adair, B.; Fabbri, M.; Alder, H.; Liu, C.G.; Calin, G.A.; et al. Modulation of MiR-155 and MiR-125b Levels Following Lipopolysaccharide/TNF-α Stimulation and Their Possible Roles in Regulating the Response to Endotoxin Shock. J. Immunol. 2007, 179, 5082–5089. [Google Scholar] [CrossRef] [Scilit]
- Ahmadi Gavlighi, H.; Tabarsa, M.; You, S.; Surayot, U.; Ghaderi-Ghahfarokhi, M. Extraction, Characterization and Immunomodulatory Property of Pectic Polysaccharide from Pomegranate Peels: Enzymatic vs. Conventional Approach. Int. J. Biol. Macromol. 2018, 116, 698–706. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Q.; Nie, S.-P.; Wang, J.-Q.; Huang, D.-F.; Li, W.-J.; Xie, M.-Y. Signaling Pathway Involved in the Immunomodulatory Effect of Ganoderma Atrum Polysaccharide in Spleen Lymphocytes. J. Agric. Food Chem. 2015, 63, 2734–2740. [Google Scholar] [CrossRef] [Scilit]
- Beinke, S.; Ley, S.C. Functions of NF-KappaB1 and NF-KappaB2 in Immune Cell Biology. Biochem. J. 2004, 382, 393–409. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Zou, Y.; Li, Q.; Mao, R.; Shao, X.; Jin, D.; Zheng, D.; Zhao, T.; Zhu, H.; Zhang, L.; et al. Immunomodulatory Effects of a Polysaccharide Purified from Lepidium Meyenii Walp. on Macrophages. Process Biochem. 2016, 51, 542–553. [Google Scholar] [CrossRef] [Scilit]
- Campillo-Gimenez, L.; Renaudin, F.; Jalabert, M.; Gras, P.; Gosset, M.; Rey, C.; Sarda, S.; Collet, C.; Cohen-Solal, M.; Combes, C.; et al. Inflammatory Potential of Four Different Phases of Calcium Pyrophosphate Relies on NF-ΚB Activation and MAPK Pathways. Front. Immunol. 2018, 9, 2248. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.-P.; Zhang, X.; Tan, Q.-L.; Xu, W.-X.; Zhou, C.-Y.; Luo, M.; Li, X.; Huang, R.-Y.; Zeng, X. NF-ΚB Pathways Are Involved in M1 Polarization of RAW 264.7 Macrophage by Polyporus Polysaccharide in the Tumor Microenvironment. PLoS ONE 2017, 12, e0188317. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.-Q.; Mao, J.-B.; Zhou, M.-Q.; Jin, Y.-W.; Lou, C.-H.; Dong, Y.; Shou, D.; Hu, Y.; Yang, B.; Jin, C.-Y.; et al. Polysaccharide from Phellinus Igniarius Activates TLR4-Mediated Signaling Pathways in Macrophages and Shows Immune Adjuvant Activity in Mice. Int. J. Biol. Macromol. 2019, 123, 157–166. [Google Scholar] [CrossRef] [Scilit]
- Prabhudas, M.; Bowdish, D.; Drickamer, K.; Febbraio, M.; Herz, J.; Kobzik, L.; Krieger, M.; Loike, J.; Means, T.K.; Moestrup, S.K.; et al. Standardizing Scavenger Receptor Nomenclature. J. Immunol. 2014, 192, 1997–2006. [Google Scholar] [CrossRef] [Scilit]
- Legentil, L.; Paris, F.; Ballet, C.; Trouvelot, S.; Daire, X.; Vetvicka, V.; Ferrières, V. Molecular Interactions of β-(1→3)-Glucans with Their Receptors. Molecules 2015, 20, 9745–9766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iwabuchi, K.; Masuda, H.; Kaga, N.; Nakayama, H.; Matsumoto, R.; Iwahara, C.; Yoshizaki, F.; Tamaki, Y.; Kobayashi, T.; Hayakawa, T.; et al. Properties and Functions of Lactosylceramide from Mouse Neutrophils. Glycobiology 2015, 25, 655–668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Batbayar, S.; Lee, D.H.; Kim, H.W. Immunomodulation of Fungal β-Glucan in Host Defense Signaling by Dectin-1. Biomol. Ther. 2012, 20, 433–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brown, G.D.; Taylor, P.R.; Reid, D.M.; Willment, J.A.; Williams, D.L.; Martinez-Pomares, L.; Wong, S.Y.C.; Gordon, S. Dectin-1 Is a Major Beta-Glucan Receptor on Macrophages. J. Exp. Med. 2002, 196, 407–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Czop, J.K.; Austen, K.F. A Beta-Glucan Inhibitable Receptor on Human Monocytes: Its Identity with the Phagocytic Receptor for Particulate Activators of the Alternative Complement Pathway. J. Immunol. 1985, 134, 2588–2593. [Google Scholar] [PubMed]
- Cao, Y.; DAI, W.; LIU, H.; Zhang, Y.; Guan, X.; Xu, H.; Liu, F. Multifunctional Continuous Phase Transition Extraction Apparatus. U.S. Patent 10,016,700, 10 July 2018. [Google Scholar]
- Zhang, M.; Wu, W.; Ren, Y.; Li, X.; Tang, Y.; Min, T.; Lai, F.; Wu, H. Structural Characterization of a Novel Polysaccharide from Lepidium Meyenii (Maca) and Analysis of Its Regulatory Function in Macrophage Polarization in Vitro. J. Agric. Food Chem. 2017, 65, 1146–1157. [Google Scholar] [CrossRef] [Scilit]
- Yang, B.; Jiang, Y.; Zhao, M.; Shi, J.; Wang, L. Effects of Ultrasonic Extraction on the Physical and Chemical Properties of Polysaccharides from Longan Fruit Pericarp. Polym. Degrad. Stab. 2008, 93, 268–272. [Google Scholar] [CrossRef] [Scilit]
- Potthast, A.; Radosta, S.; Saake, B.; Lebioda, S.; Heinze, T.; Henniges, U.; Isogai, A.; Koschella, A.; Kosma, P.; Rosenau, T.; et al. Comparison Testing of Methods for Gel Permeation Chromatography of Cellulose: Coming Closer to a Standard Protocol. Cellulose 2015, 22, 1591–1613. [Google Scholar] [CrossRef] [Scilit]
- Meng, M.; Cheng, D.; Han, L.; Chen, Y.; Wang, C. Isolation, Purification, Structural Analysis and Immunostimulatory Activity of Water-Soluble Polysaccharides from Grifola Frondosa Fruiting Body. Carbohydr. Polym. 2017, 157, 1134–1143. [Google Scholar] [CrossRef] [Scilit]
- Jing, Y.; Huang, L.; Lv, W.; Tong, H.; Song, L.; Hu, X.; Yu, R. Structural Characterization of a Novel Polysaccharide from Pulp Tissues of Litchi Chinensis and Its Immunomodulatory Activity. J. Agric. Food Chem. 2014, 62, 902–911. [Google Scholar] [CrossRef] [Scilit]
- Lai, P.K.-K.; Chan, J.Y.-W.; Wu, S.-B.; Cheng, L.; Ho, G.K.-W.; Lau, C.-P.; Kennelly, E.J.; Leung, P.-C.; Fung, K.-P.; Lau, C.B.-S. Anti-Inflammatory Activities of an Active Fraction Isolated from the Root of Astragalus Membranaceus in RAW 264.7 Macrophages. Phytother. Res. 2014, 28, 395–404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Liu, X.; Wang, Y.; Jiang, P.; Quek, S. Antibacterial Activity and Mechanism of Cinnamon Essential Oil against Escherichia Coli and Staphylococcus Aureus. Food Control. 2016, 59, 282–289. [Google Scholar] [CrossRef] [Scilit]
- Ren, Y.; Zheng, G.; You, L.; Wen, L.; Li, C.; Fu, X.; Zhou, L. Structural Characterization and Macrophage Immunomodulatory Activity of a Polysaccharide Isolated from Gracilaria Lemaneiformis. J. Funct. Foods 2017, 33, 286–296. [Google Scholar] [CrossRef] [Scilit]
- Cheng, A.; Wan, F.; Wang, J.; Jin, Z.; Xu, X. Macrophage Immunomodulatory Activity of Polysaccharides Isolated from Glycyrrhiza Uralensis Fish. Int. Immunopharmacol. 2008, 8, 43–50. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Z.; Liao, W.; Ren, J. Physicochemical Characterization of a Polysaccharide Fraction from Platycladus Orientalis (L.) Franco and Its Macrophage Immunomodulatory and Anti-Hepatitis B Virus Activities. J. Agric. Food Chem. 2016, 64, 5813–5823. [Google Scholar] [CrossRef] [Scilit]
- Xiao, C.; Anderson, C.T. Roles of Pectin in Biomass Yield and Processing for Biofuels. Front. Plant Sci. 2013, 4, 67. [Google Scholar] [CrossRef] [Scilit]







| Primers | Sequences (5′——3′) | |
|---|---|---|
| GAPDH | Forward | AGGTCGGTGTGAACGGATTTG |
| Reverse | GGGGTCGTTGATGGCAACA | |
| TNF-α | Forward | CAGGCGGTGCCTATGTCTC |
| Reverse | CGATCACCCCGAAGTTCAGTAG | |
| IL-6 | Forward | CTGCAAGAGACTTCCATCCAG |
| Reverse | AGTGGTATAGACAGGTCTGTTGG | |
| iNOS | Forward | GTTCTCAGCCCAACAATACAAGA |
| Reverse | GTGGACGGGTCGATGTCAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hou, T.; Guo, S.; Liu, Z.; Lin, H.; Song, Y.; Li, Q.; Mao, X.; Wang, W.; Cao, Y.; Liu, G. Novel Pectic Polysaccharides Isolated from Immature Honey Pomelo Fruit with High Immunomodulatory Activity. Molecules 2022, 27, 8573. https://doi.org/10.3390/molecules27238573
Hou T, Guo S, Liu Z, Lin H, Song Y, Li Q, Mao X, Wang W, Cao Y, Liu G. Novel Pectic Polysaccharides Isolated from Immature Honey Pomelo Fruit with High Immunomodulatory Activity. Molecules. 2022; 27(23):8573. https://doi.org/10.3390/molecules27238573
Chicago/Turabian StyleHou, Tao, Shenglan Guo, Zhuokun Liu, Hongyu Lin, Yu Song, Qiqi Li, Xin Mao, Wencan Wang, Yong Cao, and Guo Liu. 2022. "Novel Pectic Polysaccharides Isolated from Immature Honey Pomelo Fruit with High Immunomodulatory Activity" Molecules 27, no. 23: 8573. https://doi.org/10.3390/molecules27238573
APA StyleHou, T., Guo, S., Liu, Z., Lin, H., Song, Y., Li, Q., Mao, X., Wang, W., Cao, Y., & Liu, G. (2022). Novel Pectic Polysaccharides Isolated from Immature Honey Pomelo Fruit with High Immunomodulatory Activity. Molecules, 27(23), 8573. https://doi.org/10.3390/molecules27238573

