Design of a High-Sensitivity Dimeric G-Quadruplex/Hemin DNAzyme Biosensor for Norovirus Detection
Abstract
1. Introduction
2. Experimental Section
2.1. Materials and Reagents
2.2. Colorimetric Detection of Target ODNs
2.3. Circular Dichroism (CD) Spectroscopy
2.4. Gel Electrophoresis
2.5. Ultraviolet (UV) Spectroscopy
3. Results and Discussion
3.1. Design and Optimization of Colorimetric Buffer and Probes
3.2. diG4/Hemin DNAzyme Optimization
3.3. Detection Limitation of the diG4/Hemin DNAzyme Biosensor
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chambers, V.S.; Marsico, G.; Boutell, J.M.; Di Antonio, M.; Smith, G.P.; Balasubramanian, S. High-throughput sequencing of DNA G-quadruplex structures in the human genome. Nat. Biotechnol. 2015, 33, 877–881. [Google Scholar] [CrossRef]
- Hänsel-Hertsch, R.; Beraldi, D.; Lensing, S.V.; Marsico, G.; Zyner, K.; Parry, A.; Di Antonio, M.; Pike, J.; Kimura, H.; Narita, M.; et al. G-quadruplex structures mark human regulatory chromatin. Nat. Genet. 2016, 48, 1267–1272. [Google Scholar] [CrossRef]
- Piazza, A.; Cui, X.J.; Adrian, M.; Samazan, F.; Heddi, B.; Phan, A.T.; Nicolas, A.G. Non-Canonical G-quadruplexes cause the hCEB1 minisatellite instability in Saccharomyces cerevisiae. Elife 2017, 6, e26884. [Google Scholar] [CrossRef]
- Ida, J.; Chan, S.K.; Glökler, J.; Lim, Y.Y.; Choong, Y.S.; Lim, T.S. G-quadruplexes as an alternative recognition element in disease-related target sensing. Molecules 2019, 24, 1079. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.L.; Zhou, Y.; Liu, J.W. G-quadruplex DNA for construction of biosensors. TRAC-Trend. Anal. Chem. 2020, 132, 116060. [Google Scholar] [CrossRef]
- Kong, D.M.; Yang, W.; Wu, J.; Li, C.X.; Shen, H.X. Structure–function study of peroxidase-like G-quadruplex-hemin complexes. Analyst 2010, 135, 321–326. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Li, Y.; Liu, Z.L.; Lin, B.; Yi, H.B.; Xu, F.; Nie, Z.; Yao, S.Z. Insight into G-quadruplex-hemin DNAzyme/RNAzyme: Adjacent adenine as the intramolecular species for remarkable enhancement of enzymatic activity. Nucleic Acids Res. 2016, 44, 7373–7384. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.H.; Chen, J.L.; Cheng, M.P.; Monchaud, D.; Zhou, J.; Ju, H.X. A Thermophilic Tetramolecular G-Quadruplex/Hemin DNAzyme. Angewandte Chem. 2017, 129, 16863–16867. [Google Scholar] [CrossRef]
- Adeoye, R.I.; Osalaye, D.S.; Ralebitso-Senior, T.K.; Boddis, A.; Reid, A.J.; Fatokun, A.A.; Powell, A.K.; Malomo, S.O.; Olorunniji, F.J. Catalytic activities of multimeric G-quadruplex dnazymes. Catalysts 2019, 9, 613. [Google Scholar] [CrossRef]
- Cheng, Y.; Cheng, M.P.; Hao, J.Y.; Jia, G.Q.; Monchaud, D.; Li, C. The noncovalent dimerization of a G-quadruplex/hemin DNAzyme improves its biocatalytic properties. Chem. Sci. 2020, 11, 8846–8853. [Google Scholar] [CrossRef] [PubMed]
- Stefan, L.; Denat, F.; Monchaud, D. Deciphering the DNAzyme activity of multimeric quadruplexes: Insights into their actual role in the telomerase activity evaluation assay. J. Am. Chem. Soc. 2011, 133, 20405–20415. [Google Scholar] [CrossRef]
- Li, H.B.; Liu, M.B.; Zhao, W.H.; Pu, J.M.; Xu, J.G.; Wang, S.Q.; Yu, R.Q. Multi-channel collection of G-quadruplex transducers for amplified signaling of Pax-5 based on target-triggered split-to-intact remodeling of dual-G-rich duplex probe. Sensor. Actuat. B-Chem. 2020, 311, 127913. [Google Scholar] [CrossRef]
- Liu, Z.M.; Yao, C.H.; Wang, Y.M.; Yang, C.Y. A G-quadruplex DNAzyme-based LAMP biosensing platform for a novel colorimetric detection of Listeria monocytogenes. Anal. Methods 2018, 10, 848–854. [Google Scholar] [CrossRef]
- Li, H.B.; Wu, Z.S.; Qiu, L.P.; Liu, J.W.; Wang, C.; Shen, G.L.; Yu, R.Q. Ultrasensitive label-free amplified colorimetric detection of p53 based on G-quadruplex MBzymes. Biosens. Bioelectron. 2013, 50, 180–185. [Google Scholar] [CrossRef] [PubMed]
- Li, H.B.; Wang, S.Q.; Wu, Z.S.; Xu, J.G.; Shen, G.L.; Yu, R.Q. New function of exonuclease and highly sensitive label-free colorimetric DNA detection. Biosens. Bioelectron. 2016, 77, 879–885. [Google Scholar] [CrossRef] [PubMed]
- Xiao, M.; Zhao, W.H.; Li, H.B.; Pu, J.M.; Liu, M.B.; Wang, S.Q.; Xu, J.G.; Yu, R.Q. Facile strategy to enhance the specificity and sensitivity of hairpin molecular devices for detecting pax-5a gene by an integration probe and the specific function of exonuclease Ⅲ. Sens. Actuat. B-Chem. 2020, 322, 128495. [Google Scholar] [CrossRef]
- Bányai, K.; Estes, M.K.; Martella, V.; Parashar, U.D. Viral gastroenteritis. Lancet 2018, 392, 175–186. [Google Scholar] [CrossRef]
- Shah, M.P.; Hall, A.J. Norovirus Illnesses in Children and Adolescents. Infect. Dis. Clin. N. Am. 2018, 32, 103–118. [Google Scholar] [CrossRef] [PubMed]
- Bartsch, S.M.; Lopman, B.A.; Ozawa, S.; Hall, A.J.; Lee, B.Y. Global Economic Burden of Norovirus Gastroenteritis. PLoS ONE 2016, 11, e0151219. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Guan, Z.; Huang, C.; Jiang, D.; Liu, X.; Zhou, Y.; Yan, D.; Zhang, X.; Zhou, Y.; Ding, C.; et al. Epidemiological Trends and Hotspots of Other Infectious Diarrhea (OID) in Mainland China: A Population-Based Surveillance Study From 2004 to 2017. Front. Public Health 2021, 9, 679853. [Google Scholar] [CrossRef]
- Vinjé, J. Advances in laboratory methods for detection and typing of norovirus. J. Clin. Microbiol. 2015, 53, 373–381. [Google Scholar] [CrossRef] [PubMed]
- De Bruin, E.; Duizer, E.; Vennema, H.; Koopmans, M.P. Diagnosis of Norovirus outbreaks by commercial ELISA or RT-PCR. J. Virol. Methods 2006, 137, 259–264. [Google Scholar] [CrossRef] [PubMed]
- Doerflinger, S.Y.; Tabatabai, J.; Schnitzler, P.; Farah, C.; Rameil, S.; Sander, P.; Koromyslova, A.; Hansman, G.S. Development of a Nanobody-Based Lateral Flow Immunoassay for Detection of Human Norovirus. mSphere 2016, 1, e00219-16. [Google Scholar] [CrossRef] [PubMed]
- Fischer, A.E.; Wu, S.K.; Proescher, J.B.; Rotem, A.; Chang, C.B.; Zhang, H.; Tao, Y.; Mehoke, T.S.; Thielen, P.M.; Kolawole, A.O. A high-throughput drop microfluidic system for virus culture and analysis. J. Virol. Methods 2015, 213, 111–117. [Google Scholar] [CrossRef]
- Batule, B.S.; Kim, S.U.; Mun, H.; Choi, C.; Shim, W.B.; Kim, M.G. Colorimetric Detection of Norovirus in Oyster Samples through DNAzyme as a Signaling Probe. J. Agric. Food Chem. 2018, 66, 3003–3008. [Google Scholar] [CrossRef] [PubMed]
- Hardy, M.E.; Estes, M.K. Completion of the Norwalk virus genome sequence. Virus Genes 1996, 12, 287–290. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Wang, E.; Dong, S. Potassium-lead-switched G-quadruplexes: A new class of DNA logic gates. J. Am. Chem. Soc. 2009, 131, 15082–15083. [Google Scholar] [CrossRef]
- Owczarzy, R.; Moreira, B.G.; You, Y.; Behlke, M.A.; Walder, J.A. Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry 2008, 47, 5336–5353. [Google Scholar] [CrossRef] [PubMed]
- Seo, J.; Hong, E.S.; Yoon, H.-J.; Shin, S.K. Specific and nonspecific bindings of alkaline-earth metal ions to guanine-quadruplex thrombin-binding aptamer DNA. Int. J. Mass Spectrom. 2012, 330–332, 262–270. [Google Scholar] [CrossRef]
- Chen, Z.; Luo, F.L.; Li, L.; Li, C.Y.; Zhu, Y.Y.; Sun, X.M. Use of Tris-NH4Cl in modified G4/hemin DNAzyme assay with duplexed probes extends life of colorized radical product. Sens. Actuat. B-Chem. 2020, 321, 128559. [Google Scholar] [CrossRef]
- Kypr, J.; Kejnovská, I.; Renciuk, D.; Vorlícková, M. Circular dichroism and conformational polymorphism of DNA. Nucleic Acids Res. 2009, 37, 1713–1725. [Google Scholar] [CrossRef]
- Vorlíčková, M.; Kejnovská, I.; Sagi, J.; Renčiuk, D.; Bednářová, K.; Motlová, J.; Kypr, J. Circular dichroism and guanine quadruplexes. Methods 2012, 57, 64–75. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.; Wu, Z.; Wong, K.Y.; Liu, Z. Hairpin DNA probes based on target-induced in situ generation of luminescent silver nanoclusters. Chem. Commun. 2014, 50, 4849–4852. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Limongelli, V.; De Tito, S.; Cerofolini, L.; Fragai, M.; Pagano, B.; Trotta, R.; Cosconati, S.; Marinelli, L.; Novellino, E.; Bertini, I.; et al. The G-triplex DNA. Angew. Chem. Int. Ed. Engl. 2013, 52, 2269–2273. [Google Scholar] [CrossRef] [PubMed]
- Charnley, G.; Kelman, I.; Gaythorpe, K.; Murray, K.A. Traits and risk factors of post-disaster infectious disease outbreaks: A systematic review. Sci. Rep. 2021, 11, 5616. [Google Scholar] [CrossRef] [PubMed]
- Ida, J.; Kuzuya, A.; Choong, Y.S.; Lim, T.S. An intermolecular-split G-quadruplex DNAzyme sensor for dengue virus detection. RSC Adv. 2020, 10, 33040–33051. [Google Scholar] [CrossRef]







| Name | Sequences (5′-3′) |
|---|---|
| Target (T-DL6) | tcatcatttacgaattcgggcagaagatcgcgatctcctgtccacaatccgaggtcatgg |
| T1 | tcatcatttacgaattcgggcagaagatcgcga |
| T2 | tcgcgatctcctgtccacaatccgaggtcatgg |
| P1-5 | GGGTAGGGCGGGTTGGGtcttctgcccgaattcgtaaatgCCCAA |
| P2-5 | TACCCgacctcggattgtggacaggagaGGGTAGGGCGGGTTGGG |
| P1-6 | GGGTAGGGCGGGTTGGGtcttctgcccgaattcgtaaatgCCCAAC |
| P2-6 | CTACCCgacctcggattgtggacaggagaGGGTAGGGCGGGTTGGG |
| P1-7 | GGGTAGGGCGGGTTGGGtcttctgcccgaattcgtaaatgCCCAACC |
| P2-7 | CCTACCCgacctcggattgtggacaggagaGGGTAGGGCGGGTTGGG |
| T-DL5 | tcatcatttacgaattcgggcagaagatcgcgtctcctgtccacaatccgaggtcatgg |
| T-DL4 | tcatcatttacgaattcgggcagaagatcgctctcctgtccacaatccgaggtcatgg |
| T-DL3 | tcatcatttacgaattcgggcagaagatcgtctcctgtccacaatccgaggtcatgg |
| T-DL2 | tcatcatttacgaattcgggcagaagatctctcctgtccacaatccgaggtcatgg |
| T-DL1 | tcatcatttacgaattcgggcagaagattctcctgtccacaatccgaggtcatgg |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Ma, X.; Zhang, J.; Luo, F.; Wang, W.; Cui, X. Design of a High-Sensitivity Dimeric G-Quadruplex/Hemin DNAzyme Biosensor for Norovirus Detection. Molecules 2021, 26, 7352. https://doi.org/10.3390/molecules26237352
Zhang Y, Ma X, Zhang J, Luo F, Wang W, Cui X. Design of a High-Sensitivity Dimeric G-Quadruplex/Hemin DNAzyme Biosensor for Norovirus Detection. Molecules. 2021; 26(23):7352. https://doi.org/10.3390/molecules26237352
Chicago/Turabian StyleZhang, Yun, Xinao Ma, Jingtian Zhang, Feixian Luo, Wenshu Wang, and Xiaojie Cui. 2021. "Design of a High-Sensitivity Dimeric G-Quadruplex/Hemin DNAzyme Biosensor for Norovirus Detection" Molecules 26, no. 23: 7352. https://doi.org/10.3390/molecules26237352
APA StyleZhang, Y., Ma, X., Zhang, J., Luo, F., Wang, W., & Cui, X. (2021). Design of a High-Sensitivity Dimeric G-Quadruplex/Hemin DNAzyme Biosensor for Norovirus Detection. Molecules, 26(23), 7352. https://doi.org/10.3390/molecules26237352
