Next Article in Journal
New Real-Time PCRs to Differentiate Rickettsia spp. and Rickettsia conorii
Next Article in Special Issue
Exopolysaccharide II Is Relevant for the Survival of Sinorhizobium meliloti under Water Deficiency and Salinity Stress
Previous Article in Journal
Three Extraction Methods in Combination with GC×GC-TOFMS for the Detailed Investigation of Volatiles in Chinese Herbaceous Aroma-Type Baijiu
Previous Article in Special Issue
Isolation and Antibacterial Activity of Indole Alkaloids from Pseudomonas aeruginosa UWI-1
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Attraction of Adults of Cyclocephala lunulata and Cyclocephala barrerai (Coleoptera: Scarabaeoidea: Melolonthidae) towards Bacteria Volatiles Isolated from Their Genital Chambers

by
Abraham Sanchez-Cruz
1,
Norma Robledo
1,*,
María Rosete-Enríquez
2 and
Angel A. Romero-López
3,*
1
Laboratorio de Ecología Química de Insectos, Centro de Desarrollo de Productos Bióticos, Instituto Politécnico Nacional. Carretera Yautepec-Jojutla, Km. 6, calle CEPROBI No. 8, Col. San Isidro, Yautepec, Morelos C.P. 62731, Mexico
2
Laboratorio de Macromoléculas, Facultad de Ciencias Biológicas, Benemérita Universidad Autónoma de Puebla, Boulevard Capitán Carlos Camacho Espíritu, Edificio 112-A, Ciudad Universitaria, Col. Jardines de San Manuel, Puebla C. P. 72570, Mexico
3
Laboratorio de Infoquímicos y Otros compuestos Bióticos, Facultad de Ciencias Biológicas, Benemérita Universidad Autónoma de Puebla, Boulevard Capitán Carlos Camacho Espíritu, Edificio 112-A, Ciudad Universitaria, Col. Jardines de San Manuel, Puebla C. P. 72570, Mexico
*
Authors to whom correspondence should be addressed.
Molecules 2020, 25(19), 4430; https://doi.org/10.3390/molecules25194430
Submission received: 31 August 2020 / Revised: 21 September 2020 / Accepted: 24 September 2020 / Published: 27 September 2020
(This article belongs to the Special Issue Microbial Natural Products)

Abstract

In the study of the chemical communication of adults of the Melolonthidae family, bacteria have been observed in the epithelium of the genital chamber; possibly, bacteria are involved in the production of sex attractants in their hosts. Therefore, it is important to identify the volatile organic compounds from bacteria (VOCsB) released by these microorganisms and study the biological activity stimulated by VOBCs in adults of Melolonthidae. In this study, bacteria were isolated from the genital chamber of Cyclocephala lunulata and Cyclocephala barrerai, from which VOCsB were extracted using static headspace solid-phase microextraction (SHS-SPME) and dynamic headspace Super Q solid-phase extraction (DHS-SPE) and analyzed using gas chromatography-mass spectrometry. The effect of VOCsB on the hosts and conspecifics was evaluated utilizing an olfactometer and electroantennography (EAG). Two species of Enterobacteria were isolated from the genital chamber of each female species, and VOCsB derived from sulfur-containing compounds, alcohols, esters, and fatty acids were identified. An attraction response was observed in olfactometry studies, and antennal responses to VOCsB were confirmed in EAG bioassays. With these results, new perspectives on the relationship between these beetles and their bacteria emerge, in addition to establishing a basis for management programs in the future.

Graphical Abstract

1. Introduction

Several genera of the Melolonthidae family as phytophages are pests of various crops [1,2]; among these is the genus Cyclocephala [3], which has been the less-studied of the family. Members of this genus are widely distributed across the Americas [4], and species such as Cyclocephala lunulata and Cyclocephala barrerai are important pests of diverse plant species like strawberry, guava, and ornamental pastures [2,5,6]. For the monitoring and management of these beetle species, studies have been carried out to take advantage of the substances involved in intraspecific interactions [7,8,9,10], focusing on volatile organic compounds involved in attracting a partner for copulation, such as sex pheromones [11,12]. Bacteria have been observed in the reproductive system of females of Melolonthidae, specifically in the accessory glands and the genital chamber-structures associated with sex pheromones production [10,11,12,13,14]. Based on this evidence, it has been suggested that bacteria participate in the production of these chemicals, such as in the case of Morganella morganii found in the accessory glands of female individuals of melolonthid Costelytra zealandica beetles. These microorganisms produce volatile organic compounds from bacteria (VOCsB) such as phenol, which has been reported as a component of the sex pheromone of C. zealandica [15,16]. The presence of the enterobacteria Klebsiella oxytoca and Klebsiella michiganensis have also been recorded in the genital chamber of Phyllophaga obsoleta, where a similar relationship may occur [17]. These relationships have not been studied in Cyclocephala (Coleoptera: Scarabaeoidea: Melolonthidae) [3].
Bacterial growth conditions, such as culture media, influence VOCsB diversity and abundance, so it is not appropriate to use general culture media to carry out studies of the production of VOCsB. Bacteria must be cultivated in specific culture media [18,19,20] containing 10% glucose and sulfur compounds, as the triple-sugar medium iron (TSI) allows the synthesis of a greater diversity of VOCsB [21]. In the extraction of VOCsB, static headspace solid-phase microextraction (SHS-SPME) has been used to capture these compounds; due to the sensitivity and how they adapt to the bacterial culture, the fibers that have been used in various studies are those of polydimethylsiloxane (PDMS), polyacrylate (PA), and/or divinylbenzene (DVB) for VOCsB of Enterobacteriaceae [22,23,24]. However, SHS-SPME is a destructive test, which limits its use in bioassays, so dynamic headspace Super Q solid-phase extraction (DHS-SPE) [25,26] is an alternative to obtain samples that can be tested in attraction bioassays; the two forms of extraction are followed by VOCsB identification by gas chromatographic mass-spectrometry (GC-MS) [19,24].
VOCsB, emitted by insect bacteria, play an important role in host chemical communication [27,28,29]. VOCsB identified in these interactions are hydrocarbons, ketones, alcohols, derivatives with nitrogen or sulfur, and terpenes [19,20]; these are involved in the chemical communication of various groups of insects [30,31]. In bioassays (olfactometer and flight tunnel), it has been observed that VOCsB may attract a single sex (sex attractant) or males and females (aggregation attractant) [32,33,34,35,36,37,38,39,40]. Even though the attraction tests have served to know the biological response of insects to VOCsB, the antennal response they have towards VOCsB is unknown; tests such as electroantennography (EAG) are fundamental to link the behavioral response with the stimulation of the olfactory receptors [38,40,41].
Therefore, this study aimed at isolating and identifying bacteria from the genital chamber of female individuals of C. lunulata and C. barrerai to capture and identify the VOCsB they emit, in addition to studying the biological activity of these compounds in the insect hosts. This knowledge could contribute to the future management of these pests where VOCsB may be an important element.

2. Results and Discussion

2.1. Bacteria Isolated from the Genital Chamber of Cyclocephala

Two culturable bacterial strains were isolated from the genital chamber of C. lunulata that were identified as the Klebsiella sp. (GenBank accession number MT239565) and M. morganii (GenBank accession number MT239566). Two strains identified as K. oxytoca (GenBank accession number MG652605) and Citrobacter freundii (GenBank accession number MG652606) were isolated from the females of C. barrerai; the strains that demonstrated the closest matches with the NCBI database are presented in Table 1.
These bacteria grow in aerobic conditions using an enriched medium Luria Bertani (LB); the colonies are morphologically similar (Table 2) but show differences in the color and reflected light. Regarding individual characteristics, all are Gram-negative bacillus.
This is the first study of the activity of VOCsB in members of Melolonthidae from Mexico in terms of the isolation of bacteria from the genital chamber, identification of VOCsB emitted from it, and the confirmation of biological activity. The isolation and identification of microorganisms in these species of Cyclocephala are the first recorded for this genus and the third report for Melolonthidae [16,17]; thus, this work provides more information on the diversity of microorganisms associated with the reproductive system of these beetles. The bacterial diversity of the genital chamber of C. lunulata and C. barrerai are like each other and to that reported in other insect species [29,34,42]. The hypothesis is that bacteria can be acquired through food mainly during the larval state, and upon reaching the genital epithelium, they adapt, as that provides them with the conditions for their survival [34,36]. The host does not depend on a sole bacterial species for chemical communication, and thus, in case of losing a member of the bacterial community, the host can replace it [35]. Concerning the VOCsB produced by the genus Klebsiella colonies, the emission of indole is characteristic [43,44]. The genome of K. oxytoca suggests that this microorganism may emit short-chain alcohols [45]; the emission of 3-methyl butane-1-ol in K. oxytoca is the first report with an amino acid-rich culture medium [24].

2.2. Identification of VOCsB

VOCsB recovered by SHS-SPME (Table 3), the total ion chromatogram representative of the four bacteria, are shown in Figure 1; the peaks are numbered relative to those indicated in Table 3. For both Klebsiella sp. and M. morganii bacterial strains isolated from C. lunulata, they were comprised of similar VOCsB derived from sulfur and large-chain alcohols, in addition to aromatic alcohols and indole, with the only difference that Klebsiella sp. emitted 2-tridecanone and M. morganii emitted 1-undecanol. For the bacterial strains isolated from C. barrerai, short-chain alcohol, aromatic alcohol, indole, and two fatty acid esters were recorded in K. oxytoca; this was the species that emitted the least number of VOCsB, in contrast to Ci. Freundii, where thirteen compounds were identified —three derived from sulfur, two large-chain alcohols, two aromatic alcohols, a carboxylic acid, and three fatty acid esters. Aromatic and sulfur-derived alcohols were identified in the compounds captured by DHS-SPE from C. lunulata, Klebsiella sp., and C. barrerai; however, the K. oxytoca strain was distinct, since only 2-phenyl ethanol was identified.
The genome of K. oxytoca suggests that this microorganism may emit short-chain alcohols [45]. The emission of aromatic alcohols is common in bacteria of the family Enterobacteriaceae [18] to which Cyclocephala bacteria belong, as well as the bacteria isolated from other Melolonthidae previously studied [16,17]. The emission of 3-methyl butane-1-ol in K. oxytoca is the first report with an amino acid-rich culture medium [24]. These aromatic alcohols, in general, are very attractive to insects in behavioral bioassays [42,55]. There is a relationship between the species that can metabolize compounds derived from sulfur and phenol; VOCsB that contain sulfur are related to the bacterial metabolism of phenol [21], such as in the case of K. oxytoca that did not produce phenol nor sulfur derivatives. The production of phenol is related to the attraction of conspecifics to the insects harboring the emitting bacteria; this compound is present in the pheromones of several Melolonthidae [10,41,56,57,58], including Cyclocephala sp. [59]

2.3. Insect Attraction to VOCsB

In C. lunulata (Figure 2a), 90% of males and 73.6% of females selected the VOCsB emitted by M. morganii rather than those from the control; both results were statistically significant: χ2 = 6.40, p = 0.01, degrees of freedom (df) = 9, n = 10, and χ2 = 4.36, p = 0.03, df = 18, n = 19, respectively. This demonstrates that the VOCsB from M. morganii attract both sexes. The results regarding attraction to the VOCsB obtained from Klebsiella sp. were inconclusive, and therefore, studies are still in progress. In C. barrerai (Figure 2b), 77.7% of males significantly preferred the compounds emitted by Ci. freundii rather than those of the control (χ2 = 5.56, p = 0.01, df = 17, n = 18). In regard to the VOCsB emitted by K. oxytoca, 61% of male individuals preferred these over the control; however, this result was not statistically significant (χ2 = 0.89, p = 0.34, df = 17, n = 18). There were no attraction tests for females of this species due to the low number of female insects captured.
In tests on the attraction of C. lunulata to bacteria from C. barrerai (Figure 3), 77.7% of males selected the VOCsB emitted by Ci. freundii rather than those from the control (χ2 = 5.56, p = 0.01, df = 17, n = 18), 61% of males selected the VOCsB emitted by K. oxytoca rather than those from the control (χ2 = 0.89, p = 0.34, df = 17, n = 18). For the females of C. lunulata, 77.7% selected the VOCsB emitted by Ci. freundii rather than those from the control (χ2 = 5.56, p = 0.01, df = 17, n = 18), and 73% of females selected the VOCsB emitted by K. oxytoca; however, this result was not statistically significant (χ2 = 3.56, p = 0.59, df = 17, n = 18).
Although is not possible the compounds are part of the pheromones, our results confirm that VOCsB act as attractants [7], because adults of C. lunulata responded to VOCsB obtained from the bacteria isolated from C. barrerai; in particular, to those that had 2-phenyl ethanol, phenol, and sulfur derivatives. In this work, it was observed that C. lunulata and C. barrerai display attraction behaviors to VOCsB in the bioassays, walking against the wind towards the source of emission [60,61].

2.4. Test of EAG

In the EAG bioassays, the antennae of female individuals of C. lunulata to the VOCsB of M. morganii (Figure 4) presented a statistically significant greater response to VOCsB than to the control (t = 2.80, n = 11, p = 0.01).
From the antennal response to VOCsB of Ci. freundii and K. oxytoca (Figure 5), the antennae of male C. barrerai presented a statistically significant greater response to VOCsB than to the control (F = 7.19, df = 9, p < 0.01). In C. lunulata, the females presented a statistically significant greater response to VOCsB than to the control (F = 5.272, df = 11, p = 0.01) and males (F = 4.022, df = 10, p = 0.03).
In view of the above, the EAG tests revealed that those compounds produced antennal responses where phenol showed the greatest effects. EAG tests are important to ensure that the insect recognizes the substance to which it is exposed [62]. The attraction of beetles to VOCsB has been widely studied; however, the study of the antennal response has not, whereas EAG studies have been carried out for pheromones, allowing to relate attraction and recognition in the insect [7]. In this study, it was observed that VOCsB caused antennal depolarization, particularly those containing aromatic alcohols, such as phenol and 2-phenylethanol.
The attraction of both male and female individuals of C. lunulata towards several of the VOCsB indicates that these are aggregation attractants [62,63]. Aggregation has been cited for species from Dynastinae; although the production of these chemical substances has been primarily associated with males [37,39,64,65,66,67,68,69], there are reports of female beetles emitting this type of pheromone as well [70,71]. In this study, the females of Cyclocephala produced the compounds, possibly with the assistance of bacteria associated with their genital chamber, and this coincides with other studies reporting that VOCsB act as aggregation attractants for their insect hosts [35,36]. In other studies, the VOCsB of Bactrocera zonata Saunders attract a greater number of females [18], and the VOCsB from the intestinal microbiota of Dendroctonus ponderosae Hopkins provoke aggregation for the mass invasion of trees [72].
The emission of alcohols by bacteria from the genital chamber of C. lunulata could also serve a defensive role against pathogenic microorganisms, in addition to their function in insect chemical communication. Alcohol derivatives such as phenol and, particularly, long-chain alcohols are usually produced by members of Enterobacteriaceae [25], and they inhibit the growth and development of Gram-positive bacteria, fungi [2,73], and the most representative species of insect pathogens [74]. This could explain why, until now, all bacteria isolated from the female reproductive apparatus of Melolonthidae beetles belonged to Enterobacteriaceae. For instance, the intestinal bacteria of Schistocerca gregaria [35] act primarily as a form of defense and participate in the synthesis of food and secondarily function in the chemical communication of the host. Therefore, bacteria from different species are metabolically similar and emit similar compounds [18].

3. Materials and Methods

3.1. Insects

The collection of adult specimens was conducted during the periods April-June 2017, April-June 2018, and March-July 2019. The C. lunulata adults were collected in green spaces within the municipalities of Yautepec (18°53′10.5″ N 99°04′17.9″ W and Cuautla, Morelos (18°49′51.5″ N 98°56′40.1″ W), Mexico between 23:00 and 24:00 h, and the adults of C. barrerai were collected in the green spaces of the ″Benemérita Universidad Autónoma de Puebla″ (BUAP) (19°00′17.1″ N 98°12′08.5″ W) and in “La Presa” Park (18°58’26.0″ N, 98°14’46.4″ W), Puebla, Mexico between 20:00 and 21:00 h. Insects were identified using the keys created by Morón [75]. Each species was separated according to sex, and groups of ten individuals were placed in 1-L bottles with 50% soil and organic material; every third day, the beetles were fed on Psidium sp. fruit, and the soil was moistened with water. The beetles were left for at least five days without copulation for the subsequent experiments.

3.2. Microorganisms of the Female Reproductive System

Based on the technique proposed by Rosete-Enríquez and Romero-López [17], bacteria were extracted from the genital chamber of 10 females of C. lunulata and C. barrerai. The colony-forming units of each bacterial strain were cultivated to describe their colonial morphology and identifying bacterial morphology using Gram staining.
Genomic DNA was extracted and purified according to the Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA). The amplification of two segments of the 16S rRNA gene was performed by a polymerase chain reaction (PCR) based on the protocol proposed by Rosete-Enríquez and Romero-López [17]. Briefly, two reactions carried out using 10 ng of genomic DNA, 200-μM deoxynucleotide solution mix (dNTPs), 1 μM of each pair of upper and lower primers, 2 or 1.5-mM MgCl2, 1.25 units of PlatimunTM Taq DNA polymerase, 1X PCR buffer (Invitrogen, Carlsbad, CA, USA), and DNase free water to make 20 μL. The sequence of primers for the first reaction was 8F 5′ AGAGTTTGATCCTGGCTCAG 3′ and 907R 5′ CCGTCAATTCM TTTRAGTTT 3′. The second reaction was conducted with primers 533F 5′ GTGCCAGCAGCCGCGGTAA 3′ and 1496R 5′ GGTTAC.CTTGTTACGACTT 3′. Amplifications were performed in a Techne 412 thermocycler (Bibby Scientific, Staffordshire, UK) with the following cycling program: initial denaturation for 5 min at 94 °C, 35 or 30 cycles for 45 s at 94 °C, 55°C or 56 °C for 1 min, 72 °C for 1.5 min, and a final extension at 72 °C for 10 min. The molecular weight of the amplicons was determined by comparison with the migration of the 100-bp molecular marker. The PCR amplicons were purified from band cutting following the instructions of the QIAquick Gel Extraction kit (Qiagen). Once the amplicon concentration was verified, sequencing was performed using the Sanger method in the sequencing unit of the Institute of Biology of BUAP, Mexico. The sequences were edited and assembled with the free distribution software Bioedit 7.0 [76]. Genus and species identification were carried out using BLAST in the database of the National Center for Biotechnology Information (NCBI, https://blast.ncbi.nlm.nih.gov/Blast.cgi), comparing the sequence obtained from the rRNA 16s gene with reference sequences recorded in the database. The analysis of the sequences was performed by CLUSTALW method [77] alignment, followed by a calculation of genetic pairwise distances using the neighbor-joining method [78]. Estimation of variance was performed by Bootstrap with 10,000 resamples, with a model of nucleotide substitution using the Kimura 2 parameters analysis [79] and gamma distribution pattern. The matrix of the genetic distances was completed using the freely distributed software MEGA 7 (1.0 version, State College, PA, USA) [80].

3.3. Extraction and Identification of VOCsB

The bacterial strains were cultivated in round, glass flasks containing 50 mL of triple-sugar iron (TSI) sterile culture. The bottles were pressure-sealed using an aluminum top with a silicon septa in its center. The system was incubated 8 h at 30 °C:
  • VOCsB were captured by SHS-SPME, inserting a 65-μM PDMS/DVB fiber (Supelco, Inc., Bellefonte, PA, USA) into the bottle and maintaining the system for 16 h at 30 °C. After removing the fiber, the sample was analyzed by GC-MS. Ten repetitions were carried out for each bacterial strain in TSI; the control was a sterile TSI medium without bacteria.
  • The capture of VOCsB by DHS-SPE was performed under the aforementioned conditions for bacterial growth in the TSI medium; cultures were incubated for a period of 8 h at 30 °C. Pasteur pipette with 125 mg of Super Q 80/100 (Alltech Assoc, Inc., Deerfield, IL, USA) was connected to the upper part of the flask through the silicone septa. Once the Pasteur pipette was inserted, the experiment was maintained for 16 h at 30 °C.
The end of the incubation period, the culture system was removed, and the end of the Pasteur pipette was connected to a Welch USA double-flow pump with a constant suction flow of 500 mL/min for 1 h at 27 °C. The compounds were diluted in 2 mL of hexane (HPLC, JT Barker®, Chemical company, NJ, USA) and reconcentrated to 200 μL with a nitrogen current. An GC-MS (7890A-5975C, Agilent, Santa Clara, CA, USA), with an HP-5MS column (19091S-433, Agilent, Santa Clara, NJ, USA) (30 m, 0.250-μm internal diameter, and 0.25-μm thickness) was used for the identification of the VOCsB captured by both extraction methods. Aliquots (2 μL) of the extracts were analyzed by GC-MS; oven start temperature of 50 °C for 2 min, increased to 220 °C by 8 °C/min, and maintained for 2 min; the injection port functioned in the splitless 1:10 mode at a temperature of 250 °C [24]; the flow was 2 mL/min of hydrogen as a carrier gas. The mass spectrometer worked with electronic ionization (70 EV) in SCAN mode and a mass range of 35 to 550 Atomic Mass Unit AMU. Only the compounds that were present in at least 90% of the test samples and absent in the control were identified by their retention times, Kovats Retention Index [81], and through comparison of their mass spectra with the spectral library NIST/EPA/NIH (Software Version 2.0, Gaithersburg, MD, USA). The chemical structure is made with the software ADC/ChemSketch Freeware 2020, Canada.

3.4. Bioassays

3.4.1. Olfactometer

A glass Y-tube olfactometer consisting of a central 14-cm-long tube and two 13-cm-long arms with an internal diameter of 1.5 cm was used. Each arm was connected to a 6.5-cm-long and 2.5-cm-internal diameter glass chamber, where the stimulants were placed. For the stimulus impulse, a wind flow of 500 mL/min provided by a double-flow pump (2522B-01, WELCH, Niles, IL, USA) was used, regulated by a flowmeter (Cole-Palmer, Chicago, IL, USA), at 1 L/min in the central tube. The bioassays were conducted between 20:30 h–21:30 h for C. barrerai and 23:00 h–1:00 h for C. lunulata under controlled conditions of 27 ± 1°C, 50% relative humidity, and illuminated by a 15-W red light (Philips, Shenzhen, China). The bacterial extracts were used as stimuli and the sterile medium as the control. To the stimuli, 2 μL were added on a piece of 5 × 2-mm filter paper (Whatman No. 1® 2V, Merck KGaA, Darmstadt, Germany), which were placed inside each end of the olfactometer and left for 20 s to allow the volatilization of the stimulus. The test was conducted with female and male beetles that did not copulate during the previous 5-7 days. The behavior of the adults was filmed using a camera (WB800F, Samsung, Daegu, South Korea), and the response of everyone to each stimulus was recorded. A positive response was considered as an individual reaching at least halfway along the glass arm and remaining at the side that was selected for over 30 s [60]. There was a pause of 5 min between each test during which a flow of air cleaned the system to ensure any volatile remnants were removed. The arm where the stimuli were placed was alternated randomly, and only one sex was analyzed per day. Before each bioassay, the olfactometers were washed and rinsed with hexane and dried at 100 °C. The data were analyzed using a χ2 test and presented as the total percentage of repetitions. The video recordings were revised, and photos were obtained that were used to chart the behavior patterns presented by the individual beetles before, and then, they selected a stimulus.

3.4.2. Electroantennography

EAG responses were conducted using EAG equipment (Syntech, Kirchzarten, Germany). A recently dissected antenna of each adult was mounted between 2 silver electrodes using conductor gel (Sigma gel, SYNTECH, Spectra 360, Parker, Orange, NJ, USA). The signal generated by the antenna was transmitted to an IDAC-2 amplifier, recorded, and analyzed with software (SYNTECH EAG PRO 2.0, 2005, SYNTECH, Hilversum, The Netherlands). A constant flow of humidified pure air (0.5 L/min) provided by a pump (stimulus controller SC-55) was directed onto the antenna through a glass tube (diameter 10 mm). To present a stimulus, a pipette tip containing the stimulus of 2 μL of VOCsB extract headspace was placed on filter paper (5 × 2 mm, Whatman No. 1) was inserted through a side hole located at the midpoint of the glass tube. The outlet of the glass tube was positioned approximately 2 cm from the antenna. Humidified pure air flowed at 0.5 L/min through the pipette during stimulation. For stimulus application, 2 μL of stimuli were placed on filter paper (5 × 2 mm, Whatman No. 1). A dilution of standard eucalyptol (50 μL/mL) was used as an entrance and exit stimulus for C. lunulata and linalool (50 μL/mL) for C. barrerai to verify the basal state of the antenna. All the standards were provided by Sigma Aldrich® (Toluca, Mexico). The stimuli were the VOCsB extracts and the control (extract of TSI); they were randomly placed in the arms of the olfactometer. In each experiment, the solvent was left to evaporate for 20 s, and the time interval between each stimulus was 60 s. In these bioassays, the antennal depolarization response to the solvent was subtracted from the response to the stimuli before analysis. Once obtained, the antennal responses were analyzed with the software; the data were normalized, calculating the EAG values as a relative percentage to the entrance and exit stimuli to eliminate the error caused by a loss of sensibility in the antenna.

3.5. Statistical Analysis

Olfactometry bioassays behavior was analyzed using χ2. EAG data were log-transformed and analyzed by a paired t-test and ANOVA Repeat Measures (RM), SigmaPlot 12.0, SYSTAT Software, Chicago, IL, USA.

4. Conclusions

Female C. lunulata and C. barrerai possess bacteria in their genital chamber, C. lunulata possesses the bacteria M. morganii and Klebsiella sp., and female C. barrerai possess the bacteria K. oxytoca and Ci. freundii. Klebsiella sp. and M. morganii emit VOCsB derived from sulfur; alcohols; and aromatic alcohols such as methyltrisulfanyl methane, decan-1-ol, and phenol. VOCsB of M. morganii cause attraction responses and antenatal responses in females and males of C. lunulata, functioning as aggregation attractants. Klebsiella oxytoca emits VOCsB such as aromatic compounds and aliphatic and aromatic alcohols, including decan-1-ol and 2-phenyletanol. In the bioassays, no significant differences were observed in the attraction responses of males of C. barrerai and males and females of C. lunulata to K. oxytoca VOCsB, although these compounds caused an antennal response in these beetles. Finally, Ci. freundii emitted a large number of sulfur-derived compounds; alcohols; and aromatic alcohols such as (methyldisulfanyl) methane, (methyltrisulfanyl) methane decan-1-ol, and phenol. These VOCsB cause the attraction of male C. barrerai and male and female C. lunulata, functioning as aggregation attractants. As VOCsB function as aggregation attractants, they could be used in mass trapping for the management of C. lunulata. This study is novel in terms of the identification of VOCsB and their biological activity in their hosts.

Author Contributions

M.R.-E., A.A.R.-L., and. A.S.-C. conceived the idea of the experiment; N.R. got funding; N.R., A.A.R.-L., and M.R.-E. supervised the experimental and analytical work carried out by A.S.-C.; N.R., A.A.R.-L., and A.S.-C. contributed to the discussion of the results; and N.R., A.A.R.-L., M.R.-E., and. A.S.-C. wrote and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

N.R. is an EDI: IPN fellow. A.S.-C. was supported by a scholarship from the “Consejo Nacional de Ciencia y Tecnología de México” (CONACyT). We thank the “Secretaría de Investigación y Posgrado del Instituto Politécnico Nacional” for funding (SIP 20181451).

Acknowledgments

We thank Bravo-Luna L. for assistance in insect collection and Rivas L. for technical support.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Jackson, T.A.; Klein, M.G. Scarabs as pests: A continuing problem. Coleopt. Bull. 2006, 60, 102–119. [Google Scholar] [CrossRef] [Scilit]
  2. Morón, M.Á.; Nogueira, G.; Rojas-Gómez, C.V.; Arce-Pérez, R. Biodiversidad de Melolonthidae (Coleoptera) en México. Rev. Mex. Biodivers. 2014, 85, 298–302. [Google Scholar] [CrossRef] [Scilit]
  3. Cherman, M.A.; Grossi, P.C. A crop pest species of Cyclocephala Dejean (Coleoptera: Melolonthidae: Dynastinae) misidentified for over twenty years in Southern Brazil. Bragantia 2020, 79, 372–376. [Google Scholar] [CrossRef] [Scilit]
  4. Ratcliffe, B. The Dynastinae scarab beetles of Costa Rica and Panama (Coleoptera: Scarabaeidae: Dynastinae). Bull. Univ. Neb. State Mus. 2003, 16, 506–527. [Google Scholar]
  5. Abarca, G.; Quesada, M. Especies del complejo de jobotos (Phyllophaga spp., Anomala spp. y Cyclocephala spp.) asociadas a cultivos en el Valle Central y Pacífico Seco de Costa Rica. Agron. Mesoam. 1997, 8, 44–53. [Google Scholar] [CrossRef] [Scilit]
  6. Stechauner-Rohringer, R. Redescripción de inmaduros, ciclo de vida, distribución e importancia agrícola de Cyclocephala lunulata Burmeister (Coleoptera: Melolonthidae: Dynastinae) en Colombia. Bol. Cient. Mus. Hist. Nat. 2010, 14, 203–220. [Google Scholar]
  7. Dicke, M.; Sabelis, M.W. Infochemical terminology: Based on cost benefit analysis rather origin of compounds. Funct. Ecol. 1988, 2, 131–139. [Google Scholar] [CrossRef] [Scilit]
  8. Mitchell-Olds, T.; Gershenzon, J.; Baldwin, I.; Boland, W. Chemical ecology in the molecular era. Trends Plant Sci. 1998, 3, 362–365. [Google Scholar] [CrossRef] [Scilit]
  9. Robbins, P.S.; Crocker, R.L.; Nojima, S.; Morris, B.D.; Roelofs, W.L.; Villani, M.G. Methyl 2-(methylthio) benzoate: The unique sulfur-containing sex pheromone of Phyllophaga crinite. J. Insect Sci. 2003, 11, 517–520. [Google Scholar] [CrossRef] [Scilit]
  10. Romero-López, A.A.; Arzuffi, R. Evidencias sobre la producción y liberación de compuestos bioactivos de la feromona sexual de un melolóntido mexicano. In Ecología y Control de Plagas Edafícolas; Rodríguez del Bosque, L.A., Morón, M.A., Eds.; Publicación especial del Instituto de Ecología AC: Xalapa, Mexico, 2010; Volume 1, pp. 204–222. [Google Scholar]
  11. Leal, W.S. Chemical ecology of phytagous scarab beetles. Annu. Rev. Entomol. 1998, 43, 39–61. [Google Scholar] [CrossRef] [Scilit]
  12. Facundo, H.T.; Linn Jr., C.E.; Villani, M.G.; Roelofs, W.L. Emergence, mating, and postmating behaviors of the Oriental beetle (Coleoptera: Scarabaeidae). J. Insect Behav. 1999, 12, 175–192. [Google Scholar] [CrossRef] [Scilit]
  13. Benítez-Herrera, L.N.; Martínez, I.; Romero-López, A.A. Anatomía del aparato reproductor de Macrodactylus mexicanus (Coleoptera: Scarabaeoidea: Melolonthidae) y su posible participación en su comunicación química sexual. Southwest. Entomol. 2015, 40, 189–198. [Google Scholar] [CrossRef] [Scilit]
  14. Romero-López, A.A.; Arzuffi, R.; Valdez, J.; Sánchez-Espíndola, E.; Morón, M.A. Tissues involved in sex pheromone production in Phyllophaga obsoleta (Coleoptera: Scarabaeoidea: Melolonthidae). Ann. Entomol. Soc. Am. 2011, 104, 960–965. [Google Scholar] [CrossRef] [Scilit]
  15. Hoyt, C.P.; Osborne, G.O.; Mulcock, A.P. Production of an insect sex attractant by symbiotic bacteria. Nature 1971, 230, 472–473. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Marshall, D.G.; Jackson, T.A.; Unelius, C.R.; Wee, S.L.; Young, S.D.; Townsend, R.J.; Suckling, D.M. Morganella morganii bacteria produces phenol as the sex pheromone of the New Zealand grass grub from tyrosine in the colleterial gland. Sci. Nat. 2016, 103, 59. [Google Scholar] [CrossRef] [Scilit]
  17. Rosete-Enríquez, M.; Romero-López, A.A. Klebsiella bacteria isolated from the genital chamber of Phyllophaga obsoleta 1. Southwest. Entomol. 2017, 42, 1003–1013. [Google Scholar] [CrossRef] [Scilit]
  18. Schulz, S.; Dickschat, J.S. Bacterial volatiles: The smell of small organisms. Nat. Prod. Rep. 2007, 24, 814–842. [Google Scholar] [CrossRef] [Scilit]
  19. Kai, M.; Haustein, M.; Molina, F.; Petri, A.; Scholz, B.; Piechulla, B. Bacterial volatiles and their action potential. App. Microbiol. Biotechnol. 2009, 81, 1001–1012. [Google Scholar] [CrossRef] [Scilit]
  20. Turton, L.J.; Drucker, D.B.; Ganguli, L.A. Effect of glucose concentration in the growth medium upon neutral and acidic fermentation end-products of Clostridium bifermentans, Clostridium sporogenes and Peptostreptococcus anaerobius. J. Med. Microbiol. 1983, 16, 61–67. [Google Scholar] [CrossRef] [Scilit]
  21. Gao, C.; Wang, A.; Wu, W.M.; Yin, Y.; Zhao, Y.G. Enrichment of anodic biofilm inoculated with anaerobic or aerobic sludge in single chambered air-cathode microbial fuel cells. Bioresour. Technol. 2014, 167, 124–132. [Google Scholar] [CrossRef] [Scilit]
  22. Jia, B.; Sohnlein, B.; Mortelmans, K.; Coggiola, M.; Oser, H. Distinguishing Methicillin resistant and sensitive Staphylococcus aureus using volatile headspace metabolites. IEEE. Sens. J. 2010, 10, 71–75. [Google Scholar] [CrossRef]
  23. Rowan, D.D. Volatile metabolites. Metabolites 2011, 1, 41–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Tait, E.; Perry, J.D.; Stanforth, S.P.; Dean, J.R. Identification of volatile organic compounds produced by bacteria using HS-SPME-GC-MS. J. Chromatogr. Sci. 2014, 52, 363–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Elgaali, H.; Hamilton-Kemp, T.R.; Newman, M.C.; Collins, R.W.; Yu, K.; Archbold, D.D. Comparison of long-chain alcohols and other volatile compounds emitted from food-borne and related Gram positive and Gram negative bacteria. J. Basic. Microbiol. 2002, 42, 373–380. [Google Scholar] [CrossRef] [Scilit]
  26. Hamilton-Kemp, T.; Newman, M.; Collins, R.; Elgaali, H.; Yu, K.; Archbold, D. Production of the long-chain alcohols octanol, decanol, and dodecanol by Escherichia coli. Curr. Microbiol. 2005, 51, 82–86. [Google Scholar] [CrossRef] [Scilit]
  27. Thibout, E.; Guillot, J.F.; Auger, J. Microorganisms are involved in the production of volatile kairomones affecting the host seeking behaviour of Diadromus pulchellus, a parasitoid of Acrolepiopsis assectella. Physiol. Entomol. 1993, 18, 176–182. [Google Scholar] [CrossRef] [Scilit]
  28. Verhulst, N.O.; Beijleveld, H.; Knols, B.G.; Takken, W.; Schraa, G.; Bouwmeester, H.J.; Smallegange, R.C. Cultured skin microbiota attracts malaria mosquitoes. Malar. J. 2009, 8, 302. [Google Scholar] [CrossRef] [Scilit]
  29. Zhu, J.J.; Chaudhury, M.F.; Durso, L.M.; Sagel, A.; Skoda, S.R.; Jelvez-Serra, N.S.; Santanab, E.G. Semiochemicals released from five bacteria identified from animal wounds infested by primary screwworms and their effects on fly behavioral activity. PLoS ONE 2017, 12, e0179090. [Google Scholar] [CrossRef] [Scilit]
  30. Blomquist, G.J.; Figueroa-Teran, R.; Aw, M.; Song, M.; Gorzalski, A.; Abbott, N.L.; Tittiger, C. Pheromone production in bark beetles. Insect Biochem. Mol. 2010, 40, 699–712. [Google Scholar] [CrossRef] [Scilit]
  31. Thacker, J.R.; Train, M.R. Use of volatiles in pest control. Chem. Biol. Volatiles 2010, 5, 151–172. [Google Scholar] [CrossRef] [Scilit]
  32. Davis, T.S.; Crippen, T.L.; Hofstetter, R.W.; Tomberlin, J.K. Microbial Volatile Emissions as Insect Semiochemicals. J. Chem. Ecol. 2013, 30, 840–859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Robacker, D.C.; Lauzon, C.R.; He, X. Volatiles production and attractiveness to the Mexican fruit fly of Enterobacter agglomerans isolated from apple maggot and Mexican fruit flies. J. Chem. Ecol. 2004, 30, 1329–1347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Naaz, N.; Choudhary, J.S.; Prabhakar, C.S.; Moanaro; Maurya, S. Identification and evaluation of cultivable gut bacteria associated with peach fruit fly, Bactrocera zonata (Biptera: Tephritidae). Phytoparasitica 2016, 44, 165–176. [Google Scholar] [CrossRef] [Scilit]
  35. Dillon, R.; Vennard, C.; Charnley, A. A Note: Gut bacteria produce components of a locust cohesion pheromone. J. Appl. Microbiol. 2002, 92, 759–763. [Google Scholar] [CrossRef] [Scilit]
  36. Wada-Katsumata, A.; Zurek, L.; Nalyanya, G.; Roelofs, W.L.; Zhang, A.; Schal, C. Gut bacteria mediate aggregation in the German cockroach. Proc. Natl. Acad. Sci. USA 2015, 112, 15678–15683. [Google Scholar] [CrossRef] [Scilit]
  37. Hallett, R.H.; Perez, A.L.; Gries, G.; Gries, R.; Pierce Jr, H.D.; Yue, J.; Oehlschlager, A.C.; Gonzalez, L.M.; Borden, J.H. Aggregation pheromone of coconut rhinoceros beetle, Oryctes rhinoceros (L.) (Coleoptera: Scarabaeidae). J. Chem. Ecol. 1995, 21, 1549–1570. [Google Scholar] [CrossRef] [Scilit]
  38. Tolasch, T.; Solter, S.; Tóth, M.; Ruther, J.; Francke, W. (R)-acetoin-female sex pheromone of the summer chafer Amphimallon solstitiale (L.). J. Chem. Ecol. 2003, 29, 1045–1050. [Google Scholar] [CrossRef] [Scilit]
  39. Rochat, D.; Ramirez Lucas, P.; Malosse, C.; Aldana, R.; Kakul, T.; Morin, J.P. Role of solid-phase microextraction in the identification of highly volatile pheromones of two Rhinoceros beetles Scapanes australis and Strategus aloeus (Coleoptera, Scarabaeidae, Dynastinae). J. Chromatogr. 2000, 885, 433–444. [Google Scholar] [CrossRef] [Scilit]
  40. Oike, M.; Kanayama, S.; Wakamura, S. Mate-searching behavior of the black chafer Holotrichia kiotonensis (Coleoptera: Scarabaeidae): Identification of a sex pheromone, and male orientation behavior controlled by olfactory and visual cues. Appl. Entomol. Zool. 2017, 52, 519–526. [Google Scholar] [CrossRef] [Scilit]
  41. Ruther, J.; Reinecke, A.; Hilker, M.; Tolasch, T. Phenol—another cockchafer attractant shared by Melolontha hippocastani fabr. and M. melolontha L. Z. Fur Naturforsch-Sect. C J. Biosci. 2002, 57, 910–913. [Google Scholar] [CrossRef] [Scilit]
  42. Robacker, D.C.; Bartelt, R.J. Chemical attractive Mexican fruit fly from Klebsiella pneumoniae and Citrobacter freundii cultures sampled by solid-phase microextraction. J. Chem. Ecol. 1997, 23, 2897–2915. [Google Scholar] [CrossRef] [Scilit]
  43. Alves, M.S.; da Silva Dias, R.C.; de Castro, A.C.D.; Riley, L.W.; Moreira, B.M. Identification of clinical isolates of indole-positive and indole-negative Klebsiella spp. J. Clin. Microbiol. 2006, 44, 3640–3646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Lü, Z.X.; Song, W. Research of indole-3-acetic acid biosynthetic pathway of Klebsiella oxytoca SG-11 by HPLC and GC-MS. Sepu Chin. J. Chromatogr. 2000, 18, 328. [Google Scholar]
  45. Xu, T.; Wang, C.; Zhu, S.; Zheng, G. Enzymatic preparation of optically pure t-butyl 6-chloro-(3R, 5S)-dihydroxyhexanoate by a novel alcohol dehydrogenase discovered from Klebsiella oxytoca. Process Biochem. 2017, 57, 72–79. [Google Scholar] [CrossRef] [Scilit]
  46. Engel, E.; Baty, C.; LeCorre, D.; Souchon, I.; Martin, N. Flavor-active compounds potentially implicated in cooked cauliflower acceptance. J. Agric. Food Chem. 2002, 50, 6459–6467. [Google Scholar] [CrossRef] [Scilit]
  47. Hayes, R.A.; Richardson, B.J.; Claus, S.C.; Wyllie, S.G. Semiochemicals and social signaling in the wild European rabbit in Australia: II. Variations in chemical composition of chin gland secretion across sampling sites. J. Chem. Ecol. 2002, 28, 2613–2625. [Google Scholar] [CrossRef] [Scilit]
  48. Ong, P.K.C.; Acree, T.E. Similarities in the aroma chemistry of Gewürztraminer variety wines and Lychee (Litchi chinesis Sonn.) fruit. J. Agric. Food Chem. 1999, 47, 665–670. [Google Scholar] [CrossRef] [Scilit]
  49. Farkas, O.; Heberger, K. Comparison of ridge regression, partial least-squares, pairwise correlation, forward and best subset selection methods for prediction of retention indices for aliphatic alcohols. J. Chem. Inf. Model. 2005, 45, 339–346. [Google Scholar] [CrossRef] [Scilit]
  50. Adams, R.P. Identification of Essential Oil Components by Gas Chromatography/Mass Spectrometry; Allured Publishing Corporation: Carol Stream, IL, USA, 1995. [Google Scholar]
  51. Bendimerad, N.; Bendiab, S.A.T.; Benabadji, A.B.; Fernandez, X.; Valette, L.; Lizzani-Cuvelier, L. Composition and antibacterial activity of Pseudocytisus integrifolius (Salisb.) essential oil from Algeria. J. Agric. Food Chem. 2005, 53, 2947–2952. [Google Scholar] [CrossRef] [Scilit]
  52. Aznar, M.; Lopez, R.; Cacho, J.; Ferreira, V. Identification and quantification of impact odorants of aged red wines from Rioja. GC-olfactometry, quantitative GC-MS, and odor evaluation of HPLC fractions. J. Agric. Food Chem. 2001, 49, 2924–2929. [Google Scholar] [CrossRef] [Scilit]
  53. De Marques, F.A.; McElfresh, J.S.; Millar, J.G. Kováts retention indexes of monounsaturated C12, C14, and C16 alcohols, acetates and aldehydes commonly found in lepidopteran pheromone blends. J. Braz. Chem. Soc. 2000, 11, 592–599. [Google Scholar] [CrossRef] [Scilit]
  54. Tellez, M.R.; Schrader, K.K.; Kobaisy, M. Volatile components of the cyanobacterium Oscillatoria perornata (Skuja). J. Agric. Food Chem. 2001, 49, 5989–5992. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Kim, B.; Cho, B.R.; Hahn, J.S. Metabolic engineering of Saccharomyces cerevisiae for the production of 2-phenylethanol via Ehrlich pathway. Biotechnol. Bioeng. 2014, 111, 115–124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Henzell, R.F.; Lowe, M.D. Sex attractant of the grass grub beetle. Science 1970, 168, 1005–1010. [Google Scholar] [CrossRef] [Scilit]
  57. Harrison, R.A. Grass grub attractant identified. N. Z. J. Agric. Res. 1970, 121, 25. [Google Scholar]
  58. Zarbin, P.H.G.; Leal, W.S.; Ávila, C.J.; Oliveira, L.J. Identification of the sex pheromone of Phyllophaga cuyabana (Coleoptera: Melolonthidae). Tetrahedron Lett. 2007, 48, 1991–1992. [Google Scholar] [CrossRef] [Scilit]
  59. Gruner, L.; Marival, D. The attraction of males of the West Indian beetle Cyclocephala insulicola Arrow by phenol (Coleoptera: Dynastinae). C.R. Acad. Seances Agric. Fr. 1974, 60, 203–208. [Google Scholar]
  60. Zhang, A.; Robbins, S.A.; Leal, W.S.; Lin, C., Jr.; Villani, M.G.; Roelofs, W.L. Essential amino acid methyl esters: Major sex pheromone components of the cranberry white grub, Phyllophaga anxia (Coleoptera: Scarabaeidae). J. Chem. Ecol. 1997, 23, 231–245. [Google Scholar] [CrossRef] [Scilit]
  61. Yasui, H.; Wakamura, S.; Tanaka, S.; Harano, K.; Mochizuki, F.; Nagayama, A.; Hokama, Y.; Arakaki, N. Quantification of 2-butanol as a sex attractant pheromone and related alcohols emitted by individual white grub beetle, Dasylepida ishigakiensis (Coleoptera: Scarabaeidae). App. Entomol. Zool. 2010, 45, 129–135. [Google Scholar] [CrossRef] [Scilit]
  62. Ju, Q.; Guo, X.; Li, X.; Jiang, X.; Jiang, X.; Ni, W.; Qu, M. Plant volatiles increase sex pheromone attraction of Holotrichia parallela (Coleoptera: Scarabaeoidea). J. Chem. Ecol. 2017, 43, 236–242. [Google Scholar] [CrossRef] [Scilit]
  63. Cardé, R.T. Defining attraction and aggregation pheromones: Teleological versus functional perspectives. J. Chem. Ecol. 2014, 40, 519–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Toffin, E.; Gabriel, E.; Louis, M.; Deneubourg, J.; Grégoire, J. Colonization of weakened trees by mass-attacking bark beetles: No penalty for pioneers, scattered initial distributions and final regular patterns. R. Soc. Open Sci. 2018, 5, 170454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Gries, G.; Gries, R.; Perez, A.L.; Oehlschlager, A.C.; Gonzales, L.M.; Pierce, H.D.; Zebeyou, M.; Kouame, B.; Kouame, B. Aggregation pheromone of the african rhinoceros beetle, Oryctes monoceros (Olivier) (Coleoptera: Scarabaeidae) b-binding site of photosystem ii. Z. Fur Naturforsch.-Sect. C J. Biosci. 1994, 49, 363–366. [Google Scholar] [CrossRef] [Scilit]
  66. Morin, J.P.; Rochat, D.; Malosse, C.; Lettere, M.; De Chenon, R.D.; Wibwo, H.; Descoins, C. Ethyl 4-methyloctanoate, major component of Oryctes rhinoceros (L.) (Coleoptera, Dynastidae) male pheromone. C.R. Acad. Sci. Paris. 1996, 319, 595–602. [Google Scholar] [PubMed]
  67. Rochat, D.; Mohammadpoor, K.; Malosse, C.; Avand-Faghih, A.; Lettere, M.; Beauhaire, J.; Morin, J.P.; Pezier, A.; Renou, M.; Abdollahi, G.A. Male aggregation pheromone of date palm fruit stalk borer Oryctes elegans. J. Chem. Ecol. 2004, 30, 387–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Allou, K.; Morin, J.P.; Kouassi, P.; N’klo, F.H.; Rochat, D. Oryctes monoceros trapping with synthetic pheromone and palm material in Ivory coast. J. Chem. Ecol. 2006, 32, 1743–1754. [Google Scholar] [CrossRef] [Scilit]
  69. Said, I.; Hasni, N.; Abdallah, Z.; Couzi, P.; Ouhichi, M.; Renou, M.; Rochat, D. Identification of the aggregation pheromone of the date palm root borer Oryctes agamemnon. J. Chem. Ecol. 2015, 41, 446–457. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Leal, W.S.; Yadava, C.P.S.; Vijayvergia, J.N. Aggregation of the scarab beetle Holotrichia consanguinea in response to female-released pheromone suggests secondary function hypothesis for semiochemical. J. Chem. Ecol. 1996, 22, 1557–1566. [Google Scholar] [CrossRef] [Scilit]
  71. Arakaki, N.; Wakamura, S.; Yasui, H.; Sadoyama, Y.; Kishita, M. Sexually differentiated functions of female-produced pheromone of the black chafer Holotrichia loochooana loochooana (Sawada) (Coleoptera: Scarabaeidae). Chemoecology 2003, 13, 183–186. [Google Scholar] [CrossRef] [Scilit]
  72. Hunt, D.W.A.; Borden, J.H. Conversion of verbenols to verbenone by yeasts isolated from Dendroctonus ponderosae (Coleoptera: Scolytidae). J. Chem. Ecol. 1990, 16, 1385–1397. [Google Scholar] [CrossRef] [Scilit]
  73. Kubo, I.; Muroi, H.; Kubo, A. Structural functions of antimicrobial long-chain alcohols and phenols. Bioorg. Med. Chem. 1995, 3, 873–880. [Google Scholar] [CrossRef] [Scilit]
  74. Ruiu, L. Insect Pathogenic Bacteria in Integrated Pest Management. Insects 2015, 6, 352–367. [Google Scholar] [CrossRef] [Scilit]
  75. Morón, M.A.; Ratcliffe, B.C.; Deloya, C. Atlas de los Escarabajos de México. Coleoptera: Lamellicornia. Vol. I. Familia Melolonthidae; Publicación especial de la Sociedad Mexicana de Entomología, A.C. y Conabio: México, Mexico, 1997. [Google Scholar]
  76. Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
  77. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Kimura, M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  80. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2017, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  81. Clarke, E.G. Isolation and identification of drugs. Pharm. Press 1978, 2, 927–928. [Google Scholar]
Sample Availability: Samples are not available from the authors.
Figure 1. Representative total ion chromatogram and chemical structure of the volatile organic compounds from bacteria (VOCsB) from bacteria isolated in the genital chamber of Cyclocephala lunulata (a,b) and Cyclocephala barrerai (c,d). Red color: peak number and blue: retention time (minutes). (Methyl disulfanyl) methane (mdm), (methyl trisulfanyl) methane (mtm), phenol (p), 2-phenylethanol (pe), decan-1-ol (do), indole (i), tridecan-2-one (to), undecan-1-ol (vdo), 3-methylbutan-1-ol (mo), dodecan-1-ol (dod), and (methyltetrasulfanyl) methane (mts).
Figure 1. Representative total ion chromatogram and chemical structure of the volatile organic compounds from bacteria (VOCsB) from bacteria isolated in the genital chamber of Cyclocephala lunulata (a,b) and Cyclocephala barrerai (c,d). Red color: peak number and blue: retention time (minutes). (Methyl disulfanyl) methane (mdm), (methyl trisulfanyl) methane (mtm), phenol (p), 2-phenylethanol (pe), decan-1-ol (do), indole (i), tridecan-2-one (to), undecan-1-ol (vdo), 3-methylbutan-1-ol (mo), dodecan-1-ol (dod), and (methyltetrasulfanyl) methane (mts).
Molecules 25 04430 g001
Figure 2. Attraction of Cyclocephala lunulata and Cyclocephala barrerai towards VOCsB from the bacteria resident of the genital chamber of females. Asterisks indicate significant differences in χ2 test and p > 0.05. (a) Males (n = 10) and females (n = 19) of C. lunulata attracted to VOCsB from Morganella morganii; (b) Males of C. barrerai (n = 18) attracted to VOCsB from Klebsiella oxytoca and Citrobacter freundii.
Figure 2. Attraction of Cyclocephala lunulata and Cyclocephala barrerai towards VOCsB from the bacteria resident of the genital chamber of females. Asterisks indicate significant differences in χ2 test and p > 0.05. (a) Males (n = 10) and females (n = 19) of C. lunulata attracted to VOCsB from Morganella morganii; (b) Males of C. barrerai (n = 18) attracted to VOCsB from Klebsiella oxytoca and Citrobacter freundii.
Molecules 25 04430 g002
Figure 3. Attraction of females (n = 18) and males (n = 18) of Cyclocephala lunulata towards the VOCsB of the bacteria resident of the genital chamber of females of Cyclocephala barrerai. The asterisk indicates significant differences in χ2 test, and p > 0.05).
Figure 3. Attraction of females (n = 18) and males (n = 18) of Cyclocephala lunulata towards the VOCsB of the bacteria resident of the genital chamber of females of Cyclocephala barrerai. The asterisk indicates significant differences in χ2 test, and p > 0.05).
Molecules 25 04430 g003
Figure 4. Antennal depolarization of Cyclocephala lunulata at VOCsB of Morganella morganii. The asterisk indicates significant differences in the paired t-test (n = 11, p > 0.05).
Figure 4. Antennal depolarization of Cyclocephala lunulata at VOCsB of Morganella morganii. The asterisk indicates significant differences in the paired t-test (n = 11, p > 0.05).
Molecules 25 04430 g004
Figure 5. Antennal depolarization of Cyclocephala barrerai and Cyclocephala lunulata at VOCsB of Citrobacter freundii and Klebsiella oxytoca. Different letters indicate statistically different values by ANOVA Repeat Measures (RM) (Fisher Least significant difference (LSD), n = 12, p > 0.05).
Figure 5. Antennal depolarization of Cyclocephala barrerai and Cyclocephala lunulata at VOCsB of Citrobacter freundii and Klebsiella oxytoca. Different letters indicate statistically different values by ANOVA Repeat Measures (RM) (Fisher Least significant difference (LSD), n = 12, p > 0.05).
Molecules 25 04430 g005
Table 1. Identification of the bacterial strains isolated from the genital chamber of Cyclocephala lunulata and Cyclocephala barrerai by comparing the homologous sequences of the 16S rRNA gene.
Table 1. Identification of the bacterial strains isolated from the genital chamber of Cyclocephala lunulata and Cyclocephala barrerai by comparing the homologous sequences of the 16S rRNA gene.
Melolonthidae SpecieStrainClosest MatchesAccession no.Similarity (%)Phylogenetic AffiliationHost/Isolation Source
Cyclocephala lunulataKlebsiella sp. MT239565Klebsiella spallanzanii strain SPARK1058C2MN091365.1100EnterobacteriaceaeHomo sapiens
(urine)
Klebsiella grimontii strain SS141CP044527.1100EnterobacteriaceaeCoffee cup
Klebsiella oxytoca strain 4928STDY7387762LR607363.1100EnterobacteriaceaeFeces
Morganella morganii MT239566 Morganella morganii strain FC6853MH628232.1100EnterobacteriaceaeHomo sapiens (patient)
Uncultured organism clone ELU0075-T355-S-NIPCRAMgANa_000386HQ774639.1100EnterobacteriaceaeHomo sapiens
(gastrointestinal)
Morganella morganii subsp. morganii strain JY 16SKR094121.1100EnterobacteriaceaeMedical College, Soochow University
Cyclocephala barreraiCitrobacter freundii
Cyl_Citf01
MG652605
Citrobacter freundii
strain FDAARGOS_61
CP02604599EnterobacteriaceaeHomo sapiens
(rectal swab)
Citrobacter freundii
strain BD
CP01881099EnterobacteriaceaeBactrocera dorsalis (gut)
Citrobacter sp.
PT2B
GU45828399EnterobacteriaceaeReticulitermes speratus
(gut)
Klebsiella oxytoca
Cyl_Kleb02
MG652606
Uncultured bacteriumJF208909100EnterobacteriaceaeHomo sapiens
(skin)
Klebsiella oxytoca
strain CAU9419
MF42863299Enterobacteriaceaepickle
Klebsiella oxytoca
strain NGB-FR100
LC04919599EnterobacteriaceaeRoot nodules of fava bean
Table 2. Morphological characteristics of colonial and individual bacteria isolated from the genital chamber of females of Cyclocephala lunulata and Cyclocephala barrerai.
Table 2. Morphological characteristics of colonial and individual bacteria isolated from the genital chamber of females of Cyclocephala lunulata and Cyclocephala barrerai.
MorphologyCyclocephala lunulataCyclocephala barrerai
Klebsiella sp.Morganella morganiiKlebsiella oxytocaCitrobacter freundii
ShapeCircularCircularCircularCircular
EdgesRoundedRoundedRoundedRounded
ElevationConvexConvexConvexConvex
SurfaceSmoothSmoothSmoothSmooth
ConsistencyCreamyCreamyCreamyCreamy
PigmentationBeigeYellowBeigeYellow
Transmitted lightTranslucentTranslucentTranslucentTranslucent
Optical propertyIridescentBrilliantIridescentBrilliant
Size (mm)111−21
Individual morphologybacillusbacillus bacillusbacillus
Gram’s reactionNegativeNegativeNegativeNegative
Table 3. VOCsB from the Klebsiella sp. captured by SHS-SPME and DHS-SPE.
Table 3. VOCsB from the Klebsiella sp. captured by SHS-SPME and DHS-SPE.
Specie BacteriaPk No.Extraction TechniqueVOCsBKRI Ref. KRI Characteristic EI ions
Klebsiella sp.1SHS-SPME(methyl disulfanyl) methane691735 [46]45, 61, 69, 79,83, 91, 94 (M+)
2SHS-SPME(methyl trisulfanyl) methane966961 [46]64, 79, 83, 111, 113, 126 (M+)
3SHS-SPMEphenol977980 [47]40, 55, 66, 74, 94 (M+)
4SHS-SPME2-phenylethanol10871078 [48]51, 65, 77, 91, 92, 122 (M+)
5SHS-SPMEdecan-1-ol12341256 [49]43, 70, 83, 97, 112, 140, 158 (M+)
6SHS-SPMEindole12511288 [50]40, 58, 63, 74, 90, 102, 117 (M+)
7SHS-SPMEtridecan-2-one14751474 [51]43, 58, 71, 85, 96, 140, 198 (M+)
Morganella morganii1SHS-SPME(methyl disulfanyl) methane691735 [46]45, 61, 69, 79,83, 91, 94 (M+)
2SHS-SPME/DHS-SPE(methyl trisulfanyl) methane966961 [46]64, 79, 83, 111, 113, 126 (M+)
3SHS-SPME/DHS-SPEphenol977980 [47]40, 55, 66, 74, 94 (M+)
4SHS-SPME/DHS-SPE2-phenylethanol10871078 [48]51, 65, 77, 91, 92, 122 (M+)
5SHS-SPMEdecan-1-ol12341256 [49]43, 70, 83, 97, 112, 140, 158 (M+)
6SHS-SPMEindole12511288 [50]40, 58, 63, 74, 90, 102, 117 (M+)
7SHS-SPMEundecan-1-ol12821372 [51]55, 69, 83, 97, 111, 154, 172 (M+)
Klebsiella oxytoca1SHS-SPME3-methylbutan-1-ol688734 [50]42, 55, 57, 70, 87, 88 (M+)
2SHS-SPME/DHS-SPE2-phenylethanol10871078 [48]51, 65, 77, 91, 92, 122 (M+)
3SHS-SPMEethyl octanoate11791192 [52]57, 88, 127, 172 (M+)
4SHS-SPMEdecan-1-ol12341256 [49]43, 70, 83, 97, 112, 140, 158 (M+)
5SHS-SPMEindole12511288 [50]40, 58, 63, 74, 90, 102, 117 (M+),
6SHS-SPMEdodecan-1-ol14611473 [53]69,83, 97,111, 140, 168, 186 (M+)
7SHS-SPMEtridecan-2-one14751474 [51]58, 71, 140, 169, 183, 198 (M+)
Citrobacter freundii1SHS-SPME(methyldisulfanyl) methane691735 [46]45, 61, 69, 79,83, 91, 94 (M+)
2SHS-SPME/DHS-SPE(methyltrisulfanyl) methane966961 [46]64, 79, 83, 111, 113, 126 (M+)
3SHS-SPME/DHS-SPEphenol977980 [47]40, 55, 66, 74, 94 (M+)
4SHS-SPME/DHS-SPE2-phenylethanol10871078 [48]51, 65, 77, 91, 92, 122 (M+)
5SHS-SPMEethyl octanoate11791192 [52]57, 88, 127, 143, 157, 172 (M+)
6SHS-SPME/DHS-SPE(methyltetrasulfanyl) methane12041210 [54]45, 64, 79, 94, 111, 145, 158 (M+)
7SHS-SPMEdecan-1-ol12341256 [49]43, 70, 83, 97, 112, 140, 158 (M+)
8SHS-SPMEundecan-1-ol12821372 [51]55, 69, 83, 97, 111, 154, 172 (M+)
Pk No (peak number), headspace-solid phase microextraction (SHS-SPME), dynamic headspace Super Q solid-phase extraction (DHS-SPE), volatile organic compounds from bacteria (VOCsB), and Kovats Retention Index (KRI), Electron Ionization (EI).

Share and Cite

MDPI and ACS Style

Sanchez-Cruz, A.; Robledo, N.; Rosete-Enríquez, M.; Romero-López, A.A. Attraction of Adults of Cyclocephala lunulata and Cyclocephala barrerai (Coleoptera: Scarabaeoidea: Melolonthidae) towards Bacteria Volatiles Isolated from Their Genital Chambers. Molecules 2020, 25, 4430. https://doi.org/10.3390/molecules25194430

AMA Style

Sanchez-Cruz A, Robledo N, Rosete-Enríquez M, Romero-López AA. Attraction of Adults of Cyclocephala lunulata and Cyclocephala barrerai (Coleoptera: Scarabaeoidea: Melolonthidae) towards Bacteria Volatiles Isolated from Their Genital Chambers. Molecules. 2020; 25(19):4430. https://doi.org/10.3390/molecules25194430

Chicago/Turabian Style

Sanchez-Cruz, Abraham, Norma Robledo, María Rosete-Enríquez, and Angel A. Romero-López. 2020. "Attraction of Adults of Cyclocephala lunulata and Cyclocephala barrerai (Coleoptera: Scarabaeoidea: Melolonthidae) towards Bacteria Volatiles Isolated from Their Genital Chambers" Molecules 25, no. 19: 4430. https://doi.org/10.3390/molecules25194430

APA Style

Sanchez-Cruz, A., Robledo, N., Rosete-Enríquez, M., & Romero-López, A. A. (2020). Attraction of Adults of Cyclocephala lunulata and Cyclocephala barrerai (Coleoptera: Scarabaeoidea: Melolonthidae) towards Bacteria Volatiles Isolated from Their Genital Chambers. Molecules, 25(19), 4430. https://doi.org/10.3390/molecules25194430

Article Metrics

Back to TopTop