Effects of Melatonin on Lipid Metabolism and Circulating Irisin in Sprague-Dawley Rats with Diet-Induced Obesity
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Animals and Experimental Protocols
4.3. Serum, Hepatic, and Fecal Lipid Measurements
4.4. Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR)
4.5. Serum Irisin Levels
4.6. Histologic Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- World Health Organization. Obesity and Overweight. Available online: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 20 May 2020).
- World Health Organization. Obesity: Preventing and Managing the Global Epidemic: Report of a WHO Consultation; WHO Technical Report Series 894; World Health Organization: Geneva, Switzerland, 2000. [Google Scholar]
- Golombek, D.A.; Casiraghi, L.P.; Agostino, P.V.; Paladino, N.; Duhart, J.M.; Plano, S.A.; Chiesa, J.J. The times they’re a-changing: Effects of circadian desynchronization on physiology and disease. J. Physiol. Paris. 2013, 107, 310322. [Google Scholar] [CrossRef] [PubMed]
- Spiegel, K.; Tasali, E.; Leproult, R.; Cauter, E.V. Effects of poor and short sleep on glucose metabolism and obesity risk. Nat. Rev. Endocrinol. 2009, 5, 253–261. [Google Scholar] [CrossRef] [PubMed]
- Morris, C.J.; Aeschbach, D.; Scheer, F.A. Circadian system, sleep and endocrinology. Mol. Cell Endocrinol. 2012, 349, 91–104. [Google Scholar] [CrossRef] [PubMed]
- Rui, B.B.; Chen, H.; Jang, L.; Li, Z.; Yang, J.M.; Xu, W.P.; Wei, W. Melatonin upregulates the activity of AMPK and attenuates lipid accumulation in alcohol-induced rats. Alcohol Alcohol. 2016, 5, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Gorman, M.R. Temporal organization of pineal melatonin signaling in mammals. Mol. Cell. Endocrinol. 2019, 503, 110687. [Google Scholar] [CrossRef] [PubMed]
- González, A.; Alvarez-García, V.; Martínez-Campa, C.; Mediavilla, M.D.; Alonso-González, C.; Sánchez-Barceló, E.J.; Cos, S. In vivo inhibition of the estrogen sulfatase enzyme and growth of DMBA-induced mammary tumors by melatonin. Curr. Cancer Drug Targets 2010, 10, 279–286. [Google Scholar] [CrossRef]
- Kubatka, P.; Bojková, B.; Ciková-Kalická, K.M.; Mníchová-Chamilová, M.; Adámeková, E.; Ahlers, I.; Ahlersová, E.; Cermáková, M. Effects of tamoxifen and melatonin on mammary gland cancer induced by N-methyl-N-nitrosourea and by 7,12-dimethylbenz(a)anthracene, respectively, in female Sprague-Dawley rats. Folia Biol. (Praha). 2001, 47, 5–10. [Google Scholar]
- Hardeland, R. Melatonin and inflammation-story of a double-edged blade. J. Pineal. Res. 2018, 65, e12525. [Google Scholar] [CrossRef]
- Kubatka, P.; Zubor, P.; Busselberg, D.; Kwon, T.K.; Adamek, M.; Petrovic, D.; Opatrilova, R.; Gazdikova, K.; Caprnda, M.; Rodrigo, L.; et al. Melatonin and breast cancer: Evidences from preclinical and human studies. Crit. Rev. Oncol. Hematol. 2018, 122, 133–143. [Google Scholar] [CrossRef]
- Bojková, B.; Marková, M.; Ahlersová, E.; Ahlers, I.; Adámeková, E.; Kubatka, P.; Kassayová, M. Metabolic effects of prolonged melatonin administration and short-term fasting in laboratory rats. Acta. Vet. Brno. 2006, 75, 21–32. [Google Scholar] [CrossRef]
- Marková, M.; Adámeková, E.; Kubatka, P.; Bojková, B.; Ahlersová, E.; Ahlers, I. Effect of prolonged melatonin application on metabolic parameters and organ weights in young male and female Sprague-Dawley rats. Acta. Vet. Brno. 2003, 72, 163–173. [Google Scholar] [CrossRef]
- Tan, D.X.; Manchester, L.C.; Fuentes-Broto, L.; Paredes, S.D.; Reiter, R.J. Significance and application of melatonin in the regulation of brown adipose tissue metabolism: Relation to human obesity. Obes. Rev. 2011, 12, 167–188. [Google Scholar] [CrossRef] [PubMed]
- Prunet-Marcassus, B.; Desbazeille, M.; Bros, A.; Louche, K.; Delagrange, P.; Renard, P.; Casteilla, L.; Pénicaud, L. Melatonin reduces body weight gain in Sprague Dawley rats with diet-induced obesity. Endocrinology 2003, 144, 5347–5352. [Google Scholar] [CrossRef] [PubMed]
- Sartori, C.; Dessen, P.; Mathieu, C.; Monney, A.; Bloch, J.; Nicod, P.; Scherrer, U.; Duplain, H. Melatonin improves glucose homeostasis and endothelial vascular function in high-fat diet-fed insulin-resistant mice. Endocrinology 2009, 150, 5311–5317. [Google Scholar] [CrossRef] [PubMed]
- Sun, H.; Wang, X.; Chen, J.; Song, K.; Gusdon, A.M.; Li, L.; Bu, L.; Qu, S. Melatonin improves non-alcoholic fatty liver disease via MAPK-JNK/P38 signaling in high-fat-diet-induced obese mice. Lipids Health Dis. 2016, 15, 202. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.; Wang, J.; Hong, F.; Wang, S.; Jin, X.; Xue, T.; Jia, L.; Zhai, Y. Melatonin prevents obesity through modulation of gut microbiota in mice. J. Pineal. Res. 2017, 62, e12399. [Google Scholar] [CrossRef] [PubMed]
- Favero, G.; Stacchiotti, A.; Castrezzati, S.; Bonomini, F.; Albanese, M.; Rezzani, R.; Rodella, L.F. Melatonin reduces obesity and restores adipokine patterns and metabolism in obese (ob/ob) mice. Nutr. Res. 2015, 35, 891–900. [Google Scholar] [CrossRef]
- Lima, F.B.; Machado, U.F.; Bartol, I.; Seraphim, P.M.; Sumida, D.H.; Moraes, S.M.; Hell, N.S.; Okamoto, M.M.; Saad, M.J.; Carvalho, C.R.; et al. Pinealectomy causes glucose intolerance and decreases adipose cell responsiveness to insulin in rats. Am. J. Physiol. 1998, 275, E934–E941. [Google Scholar] [CrossRef]
- Alonso-Vale, M.I.; Anhê, G.F.; Borges-Silva, C.D.N.; Andreotti, S.; Peres, S.B.; Cipolla-Neto, J.; Lima, F.B. Pinealectomy alters adipose tissue adaptability to fasting in rats. Metabolism 2004, 53, 500–506. [Google Scholar] [CrossRef]
- Rasmussen, D.D.; Boldt, B.M.; Wilkinson, C.W.; Yellon, S.M.; Matsumoto, A.M. Daily melatonin administration at middle age suppresses male rat visceral fat, plasma leptin, and plasma insulin to youthful levels. Endocrinology 1999, 140, 1009–1012. [Google Scholar] [CrossRef]
- Zhao, Z.J.; Wang, D.H. Short photoperiod influences energy intake and serum leptin level in Brandt’s voles (Microtus brandtii). Horm. Behav. 2006, 49, 463–469. [Google Scholar] [CrossRef] [PubMed]
- Heldmaier, G.; Hoffmann, K. Melatonin stimulates growth of brown adipose tissue. Nature 1974, 247, 224–225. [Google Scholar] [CrossRef] [PubMed]
- Jahnke, G.; Marr, M.; Myers, C.; Wilson, R.; Travlos, G.; Price, C. Maternal and developmental toxicity evaluation of melatonin administered orally to pregnant Sprague-Dawley rats. Toxicol. Sci. 1999, 50, 271–279. [Google Scholar] [CrossRef] [PubMed]
- Wolden-Hanson, T.; Mitton, D.R.; McCants, R.L.; Yellon, S.M.; Wilkinson, C.W.; Matsumoto, A.M.; Rasmussen, D.D. Daily melatonin administration to middle-aged male rats suppresses body weight, intraabdominal adiposity, and plasma leptin and insulin independent of food intake and total body fat. Endocrinology 2000, 141, 487–497. [Google Scholar] [CrossRef] [PubMed]
- Pan, M.; Song, Y.L.; Xu, J.M.; Gan, H.Z. Melatonin ameliorates nonalcoholic fatty liver induced by high-fat diet in rats. J. Pineal. Res. 2006, 41, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Raskind, M.A.; Burke, B.L.; Crites, N.J.; Tapp, A.M.; Rasmussen, D.D. Olanzapine-induced weight gain and increased visceral adiposity is blocked by melatonin replacement therapy in rats. Neuropsychopharmacology 2007, 32, 284–288. [Google Scholar] [CrossRef] [PubMed]
- Bostrom, P.; Wu, J.; Jedrychowski, M.P.; Korde, A.; Ye, L.; Lo, J.C.; Rasbach, K.A.; Boström, E.A.; Choi, J.H.; Long, J.Z.; et al. A PGC1-alpha-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature 2012, 481, 463–468. [Google Scholar] [CrossRef] [PubMed]
- Huh, J.Y.; Panagiotou, G.; Mougios, V.; Brinkoetter, M.; Vamvini, M.T.; Schneider, B.E.; Mantzoros, C.S. FNDC5 and irisin in humans: I. Predictors of circulating concentrations in serum and plasma and II. mRNA expression and circulating concentrations in response to weight loss and exercise. Metabolism 2012, 61, 1725–1738. [Google Scholar] [CrossRef]
- Moreno-Navarrete, J.M.; Ortega, F.; Serrano, M.; Guerra, E.; Pardo, G.; Tinahones, F.; Ricart, W.; Fernández-Real, J.M. Irisin is expressed and produced by human muscle and adipose tissue in association with obesity and insulin resistance. J. Clin. Endocrinol. Metab. 2013, 98, E769–E778. [Google Scholar] [CrossRef]
- Choi, Y.K.; Kim, M.K.; Bae, K.H.; Seo, H.A.; Jeong, J.Y.; Lee, W.K.; Kim, J.G.; Lee, I.K.; Park, K.G. Serum irisin levels in new-onset type 2 diabetes. Diabetes Res. Clin. Pract. 2013, 100, 96–101. [Google Scholar] [CrossRef]
- Jimenez-Aranda, A.; Fernández-Vázquez, G.; Campos, D.; Tassi, M.; Velasco-Perez, L.; Tan, D.X.; Reiter, R.J.; Agil, A. Melatonin induces browning of inguinal white adipose tissue in Zucker diabetic fatty rats. J. Pineal. Res. 2013, 55, 416–423. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; You, W.; Liu, J.; Wang, Y.; Shan, T. Elucidating the regulatory role of melatonin in brown, white, and beige adipocytes. Adv. Nutr. 2020, 11, 447–460. [Google Scholar] [CrossRef] [PubMed]
- Guilford, B.L.; Parson, J.C.; Grote, C.W.; Vick, S.N.; Ryals, J.M.; Wright, D.E. Increased FNDC5 is associated with insulin resistance in high fat-fed mice. Physiol. Rep. 2017, 5, e13319. [Google Scholar] [CrossRef]
- Roca-Rivada, A.; Castelao, C.; Senin, L.L.; Landrove, M.O.; Baltar, J.; Crujeiras, A.B.; Seoane, L.M.; Casanueva, F.F.; Pardo, M. FNDC5/irisin is not only a myokine but also an adipokine. PLoS ONE 2013, 8, e60563. [Google Scholar] [CrossRef] [PubMed]
- Temel, R.E.; Brown, J.M.; Ma, Y.; Tang, W.; Rudel, L.L.; Ioannou, Y.A.; Davies, J.P.; Yu, L. Diosgenin stimulation of fecal cholesterol excretion in mice is not NPC1L1 dependent. J. Lipid Res. 2009, 50, 915–923. [Google Scholar] [CrossRef] [PubMed]
- Hussain, S.A. Effect of melatonin on cholesterol absorption in rats. J. Pineal. Res. 2007, 42, 267–271. [Google Scholar] [CrossRef] [PubMed]
- Chan, T.Y.; Tang, P.L. Effect of melatonin on the maintenance of cholesterol homeostasis in the rat. Endocr. Res. 1995, 21, 681–696. [Google Scholar] [CrossRef] [PubMed]
- Muller-Wieland, D.; Behnke, B.; Koopmann, K.; Krone, W. Melatonin inhibits LDL receptor activity and cholesterol synthesis in freshly isolated human mononuclear leukocytes. Biochem. Biophys. Res. Commun. 1994, 203, 416–421. [Google Scholar] [CrossRef]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar]
Sample Availability: Samples of the compounds are not available from the authors. |
VC | PC | MEL10 | MEL20 | MEL50 | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Initial body weight (g) | 535 | ± | 12 b | 635 | ± | 12 a | 603 | ± | 18 a | 614 | ± | 18 a | 619 | ± | 23 a |
Final body weight (g) | 597 | ± | 12 b | 745 | ± | 18 a | 688 | ± | 22 a | 699 | ± | 25 a | 704 | ± | 32 a |
Total weight gain (g) | 62.3 | ± | 5.5c | 110.2 | ± | 6.0 a | 84.8 | ± | 6.2 b | 85.5 | ± | 8.3 b | 84.8 | ± | 9.4 b |
Liver weight (g) | 16.5 | ± | 0.5 | 18.5 | ± | 1.4 | 16.8 | ± | 0.6 | 17.5 | ± | 0.8 | 17.5 | ± | 1.4 |
Kidney weight (g) | 3.75 | ± | 0.19 | 4.37 | ± | 0.25 | 3.65 | ± | 0.21 | 3.81 | ± | 0.32 | 4.04 | ± | 0.22 |
eWAT weight (g) | 13.0 | ± | 0.8 b | 22.4 | ± | 1.4 a | 20.7 | ± | 2.1 a | 16.8 | ± | 2.0 a,b | 19.9 | ± | 2.5 a |
Relative liver weight (g/100 g BW) | 2.77 | ± | 0.12 | 2.47 | ± | 0.13 | 2.44 | ± | 0.07 | 2.50 | ± | 0.06 | 2.47 | ± | 0.10 |
Relative kidney weight (g/100 g BW) | 0.63 | ± | 0.03 | 0.59 | ± | 0.03 | 0.53 | ± | 0.03 | 0.55 | ± | 0.05 | 0.58 | ± | 0.05 |
Relative eWAT weight (g/100 g BW) | 2.18 | ± | 0.13 | 3.03 | ± | 0.23 | 3.00 | ± | 0.27 | 2.40 | ± | 0.29 | 2.79 | ± | 0.28 |
VC | PC | MEL10 | MEL20 | MEL50 | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Food intake (g/d) | 21.4 | ± | 0.5 | 20.7 | ± | 0.5 | 19.8 | ± | 0.4 | 20.6 | ± | 0.4 | 20.3 | ± | 0.6 |
Dietary caloric intake (kcal/d) | 84.3 | ± | 1.8 b | 97.2 | ± | 2.3 a | 93.0 | ± | 2.0 a | 97.0 | ± | 1.7 a | 95.2 | ± | 2.9 a |
Feed efficiency (%) | 5.19 | ± | 0.40 c | 9.52 | ± | 0.49 a | 7.67 | ± | 0.55 b | 7.42 | ± | 0.72 b | 7.50 | ± | 0.87 b |
Water intake (mL/d) | 29.6 | ± | 0.7 a | 28.8 | ± | 2.4 a,b | 25.9 | ± | 0.9 a,b | 31.1 | ± | 2.9 a,b | 22.4 | ± | 0.5 b |
Completion rate (%) | 90.9 | ± | 1.1 | 91.1 | ± | 1.6 | 89.7 | ± | 1.6 | 91.7 | ± | 1.1 | 91.3 | ± | 0.5 |
Actual melatonin dose (mg/kg BW) | 0.0 | ± | 0.0 | 0.0 | ± | 0.0 | 9.0 | ± | 0.2 c | 18.2 | ± | 0.3 b | 45.6 | ± | 0.2 a |
VC | PC | MEL10 | MEL20 | MEL50 | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TG (mg/dL) | 51.2 | ± | 5.8 | 43.2 | ± | 4.9 | 36.7 | ± | 2.7 | 32.7 | ± | 3.9 | 38.7 | ± | 6.4 |
TC (mg/dL) | 59.7 | ± | 5.6 b | 86.3 | ± | 7.1 a | 67.3 | ± | 5.3 b | 64.3 | ± | 4.2 b | 62.0 | ± | 8.5 b |
HDL-C (mg/dL) | 10.3 | ± | 0.8 c | 19.0 | ± | 1.1 a | 14.5 | ± | 1.4 b | 14.3 | ± | 0.8 b | 12.8 | ± | 1.5 b,c |
LDL-C (mg/dL) | 5.00 | ± | 0.52 | 5.50 | ± | 0.50 | 4.83 | ± | 0.48 | 4.67 | ± | 0.33 | 4.00 | ± | 0.37 |
Hepatic TC (mg/g liver) | 2.46 | ± | 0.15 | 2.94 | ± | 0.36 | 2.98 | ± | 0.07 | 2.71 | ± | 0.27 | 2.64 | ± | 0.15 |
Hepatic TG (mg/g liver) | 11.2 | ± | 1.6 | 16.0 | ± | 2.0 | 14.2 | ± | 1.1 | 11.2 | ± | 0.6 | 12.7 | ± | 1.6 |
g/kg Diet | Control Diet | High-Fat and -Calorie Diet |
---|---|---|
Corn starch | 529.49 | 289.23 |
Casein | 200 | 238.12 |
Sucrose | 100 | 119.08 |
Cellulose | 50 | 59.54 |
Soybean oil | 70 | 235.07 |
AIN 93M mineral mix | 35 | 41.68 |
AIN 93M vitamin mix | 10 | 11.91 |
Choline bitartrate | 2.5 | 2.98 |
L-cystine | 3 | 2.38 |
Tertbutylhydroquinone | 0.014 | 0.017 |
Calories (kcal/kg diet) | 3947.96 | 4701.35 |
Gene (Accession No.) | Sequence (5′→3′) | |
---|---|---|
LPL (NM_012598.2) | Fw | GATGGACGGTGACAGGAATGTA |
Rv | CGGCAGACACTGGATAATGTTG | |
HSL (XM_008758896.1) | Fw | GCTGGGCTGTCAAGCACTGT |
Rv | GTAACTGGGTAGGCTGCCAT | |
PPARγ (XM_006237009.2) | Fw | GCCCTTTGGTGACTTTATGGAG |
Rv | GCAGCAGGTTGTCTTGGATGT | |
Adiponectin (NM_144744.3) | Fw | CGTTCTCTTCACCTACGACCAGT |
Rv | ATTGTTGTCCCCTTCCCCATAC | |
UCP1 (NM_012682.2) | Fw | AGAAGGATTGCCGAAACTGTAC |
Rv | AGATCTTGCTTCCCAAAGAGG | |
PGC-1α (XM_008770220.1) | Fw | ACCAAACCCACAGAGAACAG |
Rv | GGGTCAGAGGAAGAGATAAAGTTG | |
FNDC5 (NM_001270981.1) | Fw | AGGACAACGAGCCCAATAAC |
Rv | CATATCTTGCTTCGGAGGAGAC | |
GAPDH (NG_028301.2) | Fw | ACAGCAACAGGGTGGTGGAC |
Rv | TTTGAGGGTGCAGCGAACTT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tung, Y.-T.; Chiang, P.-C.; Chen, Y.-L.; Chien, Y.-W. Effects of Melatonin on Lipid Metabolism and Circulating Irisin in Sprague-Dawley Rats with Diet-Induced Obesity. Molecules 2020, 25, 3329. https://doi.org/10.3390/molecules25153329
Tung Y-T, Chiang P-C, Chen Y-L, Chien Y-W. Effects of Melatonin on Lipid Metabolism and Circulating Irisin in Sprague-Dawley Rats with Diet-Induced Obesity. Molecules. 2020; 25(15):3329. https://doi.org/10.3390/molecules25153329
Chicago/Turabian StyleTung, Yu-Tang, Pei-Chin Chiang, Ya-Ling Chen, and Yi-Wen Chien. 2020. "Effects of Melatonin on Lipid Metabolism and Circulating Irisin in Sprague-Dawley Rats with Diet-Induced Obesity" Molecules 25, no. 15: 3329. https://doi.org/10.3390/molecules25153329
APA StyleTung, Y.-T., Chiang, P.-C., Chen, Y.-L., & Chien, Y.-W. (2020). Effects of Melatonin on Lipid Metabolism and Circulating Irisin in Sprague-Dawley Rats with Diet-Induced Obesity. Molecules, 25(15), 3329. https://doi.org/10.3390/molecules25153329