Detection of Cassava Component in Sweet Potato Noodles by Real-Time Loop-mediated Isothermal Amplification (Real-time LAMP) Method
Abstract
:1. Introduction
2. Results
2.1. Primer Specificity for the LAMP Assay
2.2. Optimization of the Real-Time LAMP Reaction Temperature
2.3. Specificity of the Real-Time LAMP Assay
2.4. Sensitivity of the Real-Time LAMP Assay
2.5. Validation of the LAMP Assay for Detection of Cassava Starch Contamination of Sweet Potato Noodle Samples in China
3. Discussion
4. Materials and Methods
4.1. Primer Design for LAMP Assay
4.2. Genomic DNA Isolation
4.3. Optimization of Real-Time LAMP Reaction Temperature
4.4. Specificity Determination of the Real-Time LAMP Assay
4.5. Sensitivity Determination of the Real-Time LAMP Assay
4.6. Analysis of Sweet Potato Noodle Samples from Retail Markets
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hong, E.; Lee, S.Y.; Jeong, J.Y.; Park, J.M.; Kim, B.H.; Kwon, K.; Chun, H.S. Modern analytical methods for the detection of food fraud and adulteration by food category. J. Sci. Food Agric. 2017, 97, 3877–3896. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Sagis, L.; Legger, A.; Linssen, J.P.H.; Schols, H.A.; Voragen, A.G.J. Evaluation of starch noodles made from three typical Chinese sweet-potato starches. J. Food Sci. 2002, 67, 6. [Google Scholar] [CrossRef]
- Ma, H.L.; Wang, J.W.; Chen, Y.J.; Cheng, J.L.; Lai, Z.T. Rapid authentication of starch adulterations in ultrafine granular powder of Shanyao by near-infrared spectroscopy coupled with chemometric methods. Food Chem. 2017, 215, 108–115. [Google Scholar] [CrossRef]
- Lohumi, S.; Lee, S.; Lee, W.H.; Kim, M.S.; Mo, C.; Bae, H.; Cho, B.K. Detection of starch adulteration in onion powder by FT-NIR and FT-IR spectroscopy. J. Agric. Food Chem. 2014, 62, 9246–9251. [Google Scholar] [CrossRef]
- Zhong, J.; Qin, X. Rapid Quantitative Analysis of corn starch adulteration in Konjac Glucomannan by chemometrics-assisted FT-NIR spectroscopy. Food Anal. Method 2016, 9, 61–67. [Google Scholar] [CrossRef]
- Wang, N.N.; Shen, B.H.; Guan, J.J.; Zhao, Z.R.; Zhu, Y.W.; Zhang, L.D.; Yan, Y.L.; Zheng, Y.Y.; Dong, C.Y.; Kang, D.M.; et al. Detection of adulteration in milk powder with starch near infrared. Spectrosc. Spect. Anal. 2015, 35, 2141–2146. [Google Scholar]
- Xu, L.; Shi, W.; Cai, C.B.; Zhong, W.; Tu, K. Rapid and nondestructive detection of multiple adulterants in kudzu starch by near infrared (NIR) spectroscopy and chemometrics. LWT Food Sci. Technol. 2015, 61, 590–595. [Google Scholar] [CrossRef]
- Sasikumar, B.; Syamkumar, S.; Remya, R.; Zachariah, T.J. PCR Based Detection of Adulteration in the Market Samples of Turmeric Powder. Food Biotechnol. 2005, 18, 299–306. [Google Scholar] [CrossRef]
- Rajoo, S.; Ahn, J.O.; Lee, H.W. Isolation and amplification of DNA from turmeric powder. Brit. Food J. 2004, 106, 673–678. [Google Scholar]
- Dhanya, K.; Syamkumar, S.; Siju, S.; Sasikumar, B. Sequence characterized amplified region markers: A reliable tool for adulterant detection in turmeric powder. Food Res. Int. 2011, 44, 0–2895. [Google Scholar] [CrossRef]
- Parvathy, V.A.; Swetha, V.P.; Sheeja, T.E.; Sasikumar, B. Detection of plant-based adulterants in turmeric powder using DNA barcoding. Pharm. Biol. 2015, 53, 1774–1779. [Google Scholar] [CrossRef] [PubMed]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids. Res. 2000, 28, e63. [Google Scholar] [CrossRef]
- Zhen, Z.; Zhang, M.; Yu, Y.; Gao, X.; Zhu, Y.; Yan, Y.; Zhang, R. Establishment of a loop-mediated isothermal amplification (LAMP) detection method for genetically modified maize MON88017. Eur. Food Res. Technol. 2015, 242, 1–7. [Google Scholar] [CrossRef]
- Wang, D.; Huo, G.; Ren, D.; Li, Y. Development and evaluation of a loop-mediated isothermal amplification (LAMP) method for detecting listeria monocytogenes in raw milk. J. Food Safety 2010, 30, 12. [Google Scholar] [CrossRef]
- Wang, D.; Zhang, G.; Lu, C.; Deng, R.; Zhi, A.; Guo, J.; Zhao, D.; Xu, Z. Rapid Detection of Listeria monocytogenes in Raw Milk with Loop-Mediated Isothermal Amplification and Chemosensor. J. Food Sci. 2011, 76, M611–M615. [Google Scholar] [CrossRef]
- Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP): Recent progress in research and development. J. Infect Chemother. 2013, 19, 404–411. [Google Scholar] [CrossRef]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop Mediated Isothermal Amplification (LAMP): A Versatile Technique for Detection of Microorganisms. J. Appl. Microbiol. 2017, 124, 626–643. [Google Scholar] [CrossRef] [PubMed]
- Nagamine, K.; Hase, T.; Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell Probes. 2002, 16, 223–229. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Lowe, S.B.; Gooding, J.J. Brief review of monitoring methods for loop-mediated isothermal amplification (LAMP). Biosens. Bioelectron 2014, 61, 491–499. [Google Scholar] [CrossRef] [PubMed]
- Tasrip, N.A.; Khairil Mokhtar, N.F.; Hanapi, U.K.; Abdul Manaf, Y.N.; Ali, M.E.; Cheah, Y.K.; Mustafa, S.; Mohd Desa, M.N. Loop mediated isothermal amplification: A review on its application and strategy in animal species authentication of meat based food products. Int. Food Res. J. 2019, 26, 1–10. [Google Scholar]
- Frackman, S.; Kobs, G.; Simpson, D.; Storts, D. Betaine and DMSO: Enhancing Agents for PCR. Promega. Notes 1998, 65, 27. [Google Scholar]
- Wang, D. Novel primers for increased specificity and sensitivity for the detection of Staphylococcus aureus by Real-time LAMP. CYTA J. Food 2016, 14, 88–91. [Google Scholar] [CrossRef]
Sample Availability: Samples of the compounds are not available from the authors. |




| Primer | Sequence (5′-3′) |
|---|---|
| FIP | GGTTGCGTGACACCCAGGCATTTTACGCAAGTTGCGCCCG |
| BIP | GGACGTTGGCCTCCCGTGTTTTTCGCCGAGGACTCTGCTT |
| F3 | CCCGCGAACCATCGAGTT |
| B3 | ACCACCGATAGCCGTGG |
| LF | TCGGCCGGATGGCTT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, D.; Wang, Y.; Zhu, K.; Shi, L.; Zhang, M.; Yu, J.; Liu, Y. Detection of Cassava Component in Sweet Potato Noodles by Real-Time Loop-mediated Isothermal Amplification (Real-time LAMP) Method. Molecules 2019, 24, 2043. https://doi.org/10.3390/molecules24112043
Wang D, Wang Y, Zhu K, Shi L, Zhang M, Yu J, Liu Y. Detection of Cassava Component in Sweet Potato Noodles by Real-Time Loop-mediated Isothermal Amplification (Real-time LAMP) Method. Molecules. 2019; 24(11):2043. https://doi.org/10.3390/molecules24112043
Chicago/Turabian StyleWang, Deguo, Yongzhen Wang, Kai Zhu, Lijia Shi, Meng Zhang, Jianghan Yu, and Yanhong Liu. 2019. "Detection of Cassava Component in Sweet Potato Noodles by Real-Time Loop-mediated Isothermal Amplification (Real-time LAMP) Method" Molecules 24, no. 11: 2043. https://doi.org/10.3390/molecules24112043
APA StyleWang, D., Wang, Y., Zhu, K., Shi, L., Zhang, M., Yu, J., & Liu, Y. (2019). Detection of Cassava Component in Sweet Potato Noodles by Real-Time Loop-mediated Isothermal Amplification (Real-time LAMP) Method. Molecules, 24(11), 2043. https://doi.org/10.3390/molecules24112043

