Next Article in Journal
Soluble Activin Receptor Type IIB Improves Muscle Regeneration Following Crotalus atrox Venom-Induced Damage
Previous Article in Journal
Effects of Dietary Fiber Supplementation on Modulating Uremic Toxins and Inflammation in Chronic Kidney Disease Patients: A Systematic Review and Meta-Analysis of Randomized Controlled Trials
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Establishing Reference Genes for Accurate Gene Expression Profiling in Toxigenic Bacillus cereus

by
Tanja V. Edelbacher
1,2,†,‡,
Astrid Laimer-Digruber
1,†,
Michael W. Pfaffl
2 and
Monika Ehling-Schulz
1,*
1
Institute for Microbiology, University of Veterinary Medicine Vienna, 1210 Vienna, Austria
2
Division of Animal Physiology and Immunology, School of Life Sciences Weihenstephan, Technical University of Munich (TUM), 85354 Freising, Germany
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Current address: CDL Research, University Medical Center Utrecht, Utrecht University, 3584CE Utrecht, The Netherlands.
Toxins 2025, 17(2), 58; https://doi.org/10.3390/toxins17020058
Submission received: 11 December 2024 / Revised: 11 January 2025 / Accepted: 23 January 2025 / Published: 27 January 2025
(This article belongs to the Section Bacterial Toxins)

Abstract

Bacillus cereus is a Gram-positive pathogen associated with foodborne illnesses and severe non-gastrointestinal infections. Robust tools for accurate gene transcription analysis are essential for studying toxin gene expression dynamics and deciphering the complex regulatory networks orchestrating the expression of toxin and virulence factors. This study aimed to identify reliable reference genes for normalizing reverse transcription quantitative PCR (RT-qPCR) data in toxigenic B. cereus. An emetic and an enteropathogenic strain were used as model organisms to establish a suitable reference gene set to monitor the dynamics of toxin gene transcription. Ten candidate reference genes were evaluated for their expression stability using geNorm, NormFinder, BestKeeper and the ΔCq method, with the final rankings integrated via RefFinder. Among the tested genes, rho, rpoD and recA were identified as the most stable expressed reference genes across all tested conditions. As shown in this proof-of-principle study, the established reference gene set provides a suitable tool to investigate the influence of extrinsic and intrinsic factors on toxin gene transcription. In conclusion, our newly established reference gene set provides a robust basis for studying toxin gene expression in B. cereus and contributes to a better understanding of its pathogenicity and potential strategies to mitigate its harmful effects.
Key Contribution: Our study fills a critical gap in the field by establishing a robust set of reference genes for normalizing RT-qPCR data, which enables accurate gene expression analysis in toxigenic B. cereus strains. This advancement will facilitate future transcriptional analyses of toxin genes and help unravel yet unexplored regulatory circuits.

1. Introduction

Bacillus cereus is an endospore-forming Gram-positive pathogen known for its association with foodborne illnesses and gastrointestinal infections [1,2,3,4,5]. Recent evidence has linked B. cereus to a broader spectrum of acute non-gastrointestinal diseases, such as sepsis and central nervous system infections, particularly in immunocompromised patients and neonates [6,7,8,9,10,11]. The pathogenicity of emetic B. cereus can be attributed to its emetic toxin, cereulide—a cyclic dodecadepsipeptide known for its resistance to heat and gastric acid, which can cause severe symptoms ranging from vomiting to organ failure [12,13,14,15]. In addition, the diarrheal syndrome is mediated by multi-component pore-forming enterotoxins, such as the non-hemolytic enterotoxin (Nhe) and hemolysin BL (Hbl) [16,17,18].
Cereulide acts as a potassium ionophore. Its enzymatic synthesis is directed by a non-ribosomal peptide synthetase (NRPS) system encoded by the ces gene cluster (cesHPABCD) [2,3,19,20]. While the influence of growth conditions on cereulide production has been studied [21,22,23], the transcriptional regulation of ces gene expression warrants further investigation to elucidate the complex regulatory network governing cereulide biosynthesis fully.
The Nhe enterotoxin complex is ubiquitous among enteropathogenic B. cereus strains.
Studies have shown that it induces pore formation and subsequent cell membrane disruption in vitro [24], governed by the interaction of three components: NheA, NheB and NheC [25,26,27]. The B. cereus phospholipase sphingomyelinase (SMase), encoded by sph, is another important factor that interacts synergistically with Nhe and Hbl toxins to exacerbate disease severity [28,29]. By hydrolyzing sphingomyelin, B. cereus SMase influences membrane dynamics and modulates the host immune response [16,30,31]. In addition to SMase, there are other phospholipases, such as the phosphatidylcholine-specific phospholipase C (PC-PLC), encoded by the gene plc, that target lipids of eukaryotic and prokaryotic membranes, which might drive B. cereus-induced endophthalmitis [32,33,34]. Among other virulence factors, Nhe, SMase and PC-PLC are regulated by the pleiotropic transcriptional regulator PlcR [35,36,37,38,39].
Various growth media have been developed to cultivate bacteria, depending on the species and the study’s objectives. It has been shown that nutrient availability influences toxin production in several microorganisms, with nutrient limitation affecting the production of certain virulence factors [40,41,42,43]. Chemically defined minimal media have been developed to determine the essential nutrients that are critical not only for sustaining growth but also for meeting the nutritional requirements of enterotoxin synthesis [44,45]. In this study, we compare the commonly used LB-Miller broth according to Miller et al. (LB) [46], which is a rich medium, with the modified optimal defined medium MOD [45], which is frequently used to mimic host conditions. To understand the complex mechanisms behind disease etiology, it is necessary to develop a robust framework for fundamental in vitro studies. Currently, research is hampered by the lack of established reference genes for normalizing reverse transcription quantitative PCR (RT-qPCR) data in toxigenic B. cereus that can be shared and commonly used by researchers in the field. Therefore, we aimed to advance and standardize RT-qPCR methods by identifying and validating stable expressed reference genes for toxigenic B. cereus.
State-of-the-art RT-qPCR data analysis requires the use of reference genes with stable expression across different conditions to reduce sample variability and improve reproducibility [47,48,49]. For instance, reference genes must be stably expressed when cultivated in different media at different growth stages. Due to the versatility of metabolic phenotypes, cultivation conditions of bacterial organisms and the diversity of bacterial species, reference genes need to be evaluated for suitability in different experimental settings [48,50,51]. Furthermore, RT-qPCR data acquisition relies on technical accuracy, which is affected by different input amounts of genetic material, variances in RNA integrity and reproducibility between different RT-qPCR setups. This additionally necessitates the identification of stably expressed reference genes, to elucidate intricate biological processes that would otherwise be overshadowed by technical variabilities [50,52].
Due to the strong demands from the scientific community and the rise of transcriptional studies, several models have been proposed and developed to determine the most stable reference genes. The most prominent tools include BestKeeper [47], NormFinder [53], geNorm [54] and the comparative ΔCq method [55]. As they are based on different mathematical algorithms, stability rankings can differ between the models. Therefore RefFinder was developed to provide a holistic overview of the different stability rankings and to facilitate comprehensive, data-driven decision making [56].
We hypothesize that stable reference genes can be established for different types of toxigenic B. cereus that allow monitoring of toxin gene and virulence factor expression in relation to different growth phases and cultivation media. Thus, an RT-qPCR assay was employed to identify suitable reference genes, which were subsequently applied as a proof of principle to study toxin gene expression of toxigenic B. cereus strains across different growth phases and media conditions.

2. Results

2.1. Candidate Reference Genes for RT-qPCR Studies in Eubacteria

The diverse nature of bacterial species and the different means of cultivation exacerbate the challenges of genetic circuit analyses. RT-qPCRs are a widely used and resourceful tool to address various biological questions beyond the purpose of untargeted transcriptomic analysis. Despite many studies being aimed at establishing effective reference genes for different biological systems, the diversity among bacterial species still poses a challenge in RT-qPCR-based studies.
We reviewed the literature on bacterial reference genes for the B. cereus group [57], Klebsiella pneumoniae [58] and Staphylococcus aureus [59] to identify potentially suitable reference genes, which allow us to investigate the dynamics of toxin gene and virulence factor expression in toxigenic B. cereus in different environments (Figure 1A). This approach requires reference genes that are not affected by nutrient availability or growth phase. Candidate reference genes identified by the literature review were classified according to their biological function using the STRING database (https://string-db.org, accessed on 20 November 2024, Figure 1B) [60]. This approach revealed the following genes as possible reference candidates, which were tested for suitability and robustness: rpoD (RNA polymerase sigma factor RpoD), fabD (Malonyl CoA-acyl carrier protein transacylase), rho (Transcription termination factor), RhoproC, (Pyrroline-5-carboxylate reductase), gyrA (DNA Gyrase subunit A), wecB (UDP-N-acetylglucosamine 2-epimerase), gatB_Yqey (gatB/Yqey domain-containing protein), rpsU (30S ribosomal protein S21), rrn (16S rRNA) and recA (Recombinase A) (for details of reference candidate genes, see Table S1).
Although all genes, except fabD, are directly associated with at least one other gene, they can still be grouped into different subclasses (Figure 1B). For each of these genes, primers were designed specifically for pathogenic B. cereus and primer efficiencies were calculated (Figure 1C, Table 1). Two strains originating from foodborne outbreaks, the emetic reference strain F4810/72 and the enteropathogenic reference strain NVH0075-95, were used to test the suitability of the candidate reference genes for normalizing RT-qPCR data. Except for proC, no significant differences in the Cq values for the tested candidate reference genes were observed between the two strains grown in two different media (see Figure S1).
Currently, several methods have been proposed to identify reference genes, and RefFinder can be utilized to obtain a comprehensive ranking of different algorithms, integrating results from geNorm, NormFinder, BestKeeper, and the comparative ΔCq method (Figure 2A) [56]. The comprehensive ranking of the candidate reference genes indicates that rho, rpoD and recA are the three most stable genes (Figure 2B). While the ranking of the least stable genes (gyrA, proC) is consistent across all four models, the most stable genes differ (Figure 2C–F). For NormFinder (Figure 2C) and the comparative ΔCq method (Figure 2D), the top three most stable genes—rho, rpoD, recA—correspond to the top three genes in the comprehensive ranking (Figure 2B). In contrast, GeNorm ranks wecB third and recA fourth (Figure 2E), while BestKeeper places rrn in the second position (Figure 2F), although all the other three models rank it in the lower half (Figure 2C–E).
The GeNorm algorithm was also used to determine the minimum number of reference genes required for adequate normalization of the target genes by a pairwise variation (V) analysis. Three genes were found to be sufficient for adequate normalization across the entire data set with two cultivation media and three time points each, as the pairwise variation value is below the commonly accepted threshold of 0.15 (Figure 3) [18]. For data normalization in subsequent assays, the estimated number of three genes required for data normalization was combined with the comprehensive ranking from RefFinder, resulting in the reference gene combination rho, rpoD and recA.

2.2. Distinct Toxin Gene Expression Pattern in Emetic and Enteropathogenic B. cereus

The combined action of different toxins characterizes pathogenic B. cereus. Therefore, the expression of the key toxin encoding genes cesB, nheB, sph and plc was assessed. In general, all conditions were normalized to the three-hour timepoint in LB. For cesB, which showed a similar gene expression pattern in both LB and MOD, gene expression peaked at nine hours (Figure 4A). For nheB, the gene expression remained constant between three and nine hours in LB but decreased significantly at 15 h. In MOD, nheB expression started to decrease already after nine hours (Figure 4B). The expression of the phospholipase genes sph and plc follow similar patterns, characterized by a continuous decrease in gene expression levels over time in both media (Figure 4C,D).
However, the differences are more pronounced in MOD with a significantly greater decrease in expression levels over time (e.g., sph t9-t3 LB −1.71 ± 0.50, MOD: −6.13 ± 0.24; plc t9-t3 LB −2.57 ± 0.27; MOD: −6.69 ± 0.13). Furthermore, sph and plc gene expression in MOD is higher compared to LB at three hours (Figure 4C,D).
To determine whether toxin gene expression differs between emetic and enteropathogenic B. cereus strains, RT-qPCR was performed after nine hours of cultivation. A separate set of samples containing both bacterial strains was used to account for batch-to-batch variation. All gene expression data were normalized to the corresponding gene expression of F4810/72 in LB. As cereulide production is limited to the emetic B. cereus, no cesB transcripts could be detected in the enteropathogenic NVH0075-95 (Figure 5A). For nheB, strain-specific differences were observed in both LB and MOD, with nheB expression levels being significantly higher in the enteropathogenic NVH0075-95 (Figure 5B). The phospholipases sph and plc did not show any strain-specific differences, despite media-dependent regulation of gene expression (Figure 5C,D).

3. Discussion

B. cereus is a Gram-positive, soil-dwelling endospore-forming human pathogen implicated in the causation of foodborne outbreaks and acute infections [2,3]. Its pathogenicity is linked to several virulence-related genes that determine the disease development [16,61]. The intricate mechanisms regulating toxin production have not yet been fully elucidated. Thus, the aim of the present study was to identify constitutively expressed reference genes suitable for normalization of RT-qPCR gene expression data in different growth phases and cultivation conditions of toxigenic B. cereus strains. Reliable normalization of RT-qPCR data is based on the use of stable reference genes, which demands testing candidate reference genes under different experimental conditions [48,50,51]. Although 16S-RNA has been widely used for data normalization and has therefore been extensively studied and discussed, it is generally acknowledged that rrn is not suitable for RT-qPCR data normalization [58,59,62,63,64]. Indeed, corroborating previous findings, our survey showed that the 16S rRNA gene (rrn) is not found to be among the most stable expressed genes in B. cereus under our tested conditions. Thus, other reference genes are needed to gain in-depth insights into the dynamics of toxin gene and virulence factor transcription in bacterial pathogens under varying environmental conditions.

3.1. Identification of Candidate Reference Genes for RT-qPCR Studies in Eubacteria

Based on a thorough literature review, we compiled a list of ten genes, which we tested for their potential to serve as references for transcription analyses of key virulence factors and toxins in B. cereus. Our study revealed that the previously proposed reference genes gatB_Yqey, rpsU and wecB [47], are not the most suitable ones for transcriptional studies in toxigenic B. cereus as the reference genes rho, rpoD and recA outperform them. Although the cultivation conditions in our study were very distinct and drove bacterial metabolisms into different states, the identified genes rho, rpoD and recA were proven suitable for data normalization. Notably, the genes we identified as the most suitable reference genes for studying pathogenic B. cereus are also the ones previously reported to be the most stable expressed genes in other bacterial species, such as Acinetobacter baumannii [62], Staphylococcus pseudintermedius [65], Klebsiella pneumonia [58], Staphylococcus aureus [59] and Clostridium perfringens [63]. Since they all have an important role in the RNA machinery [66,67,68], it is tempting to speculate that these genes are constitutively expressed across the bacterial kingdom and could serve as commonly used (or even universally used) reference genes in Eubacteria.

3.2. Distinct Toxin Gene Expression Pattern in Emetic and Enteropathogenic B. cereus

The emetic type of B. cereus is characterized by the presence of the ces gene cluster, which is located on the pXO1-like plasmid pCER270 [19,20]. The ces genes encode the CesNRPS, a mega multienzyme machinery responsible for the assembly and export of the depsipeptide toxin cereulide [19,69]. While the ces genes are only found in emetic B. cereus, the genetic determinants involved in the enteropathogenicity of B. cereus are commonly found among all B. cereus group members [6,70]. Our newly established set of reference genes was successfully employed to study toxin gene expression patterns in an emetic and enteropathogenic B. cereus strain. The highest cesB expression in our tested samples was measured after nine hours of cultivation, significantly dropping at the 15 h time point. This aligns with previous work indicating that cereulide production in the transition phase is repressed by the transition state regulator AbrB at later growth phases [61,71]. As expected, no cesB transcripts were observed in the enteropathogenic B. cereus since it does not harbor the ces gene locus [70]. In contrast, the chromosomally encoded virulence factors nhe and sph, which contribute to enteropathogenicity, and plc were transcribed in both the enteropathogenic and emetic strains, although at different levels. It has been reported previously that the actual enteropathogenic potential of a particular B. cereus strain is linked to the expression level of Nhe and SMase [16,72].
There is a close biological linkage between enterotoxins and phospholipases in B. cereus. First, they act synergistically, enhancing the overall pathogenic potency of a given strain [28,29]. Second, the phospholipases SMase and PC-PLC can be shuttled together with enterotoxin components by extracellular vesicles to host cells in a protected manner [73]. Third, the gene expression of Nhe, SMase and PC-PLC is driven by the same pleiotropic transcriptional regulator PlcR [35,36].
PlcR, which is activated by the quorum-sensing molecule PapR [74,75], is the master quorum-sensing regulator in enteropathogenic B. cereus. In its processed form, PapR can specifically interact with PlcR and facilitate the binding of PlcR to its DNA targets. In contrast, the disruption of papR abolishes the expression of genes belonging to the PlcR regulon [39,76,77]. Using our newly established set of RT-qPCR reference genes, we could verify similar gene expression patterns of the aforementioned virulence factors in both environments, LB and MOD. Since these virulence factors belong to the PlcR regulon, the observed similarities in their expression pattern were to be expected and might, at least partially, be related to their transcriptional control by the quorum-sensing regulator PlcR.
The PlcR-regulated genes sph, nheB and plc were shown to be downregulated over time, with the highest transcript levels in the early growth phase. These data corroborate previous transcription studies showing that plcR and, subsequently, nheB mRNA levels decrease over time [16,71]. Although the transcriptional patterns in LB and MOD were comparable for sph and plc, the kinetics of nheB expression differed between both media, highlighting the impact of extrinsic factors on gene expression. It has been shown previously that distinctive growth environments have a significant impact on the kinetics and the amount of enterotoxins produced by a particular strain [78]. In our current study, environmental challenges were mimicked by cultivating B. cereus in the full medium LB or the minimal medium MOD. The inherently different compositional media profiles lead to different nutrient availabilities and osmolarities, which may impact the expression of virulence factors. Changes in the salt concentration of the cultivation medium have previously been revealed by Dommel et al., 2011, to affect cereulide production [21]. As reported by Jessberger et al., 2017, the Nhe toxin was detectable in bacterial cultures grown under host-mimicking conditions as early as two hours. These findings are in line with the results from our newly established RT-qPCR, demonstrating that the maximal expression level of nheB is reached earlier in MOD than in LB.
The biological differences between the toxigenic reference strains associated with emetic and enteropathogenic syndromes were particularly evident in the regulation of nheB, which varied significantly between the strains F4810/72 and NVH0075-95. We have previously shown that the branched-chain amino acid-sensing regulator CodY acts as a nutrient-responsive transcription regulator that orchestrates cereulide and enterotoxin synthesis in B. cereus F4810/72 [71]. Furthermore, a detailed analysis of the promoter region of B. cereus enterotoxin genes by Böhm et al., 2016, suggests that the low conservation of CodY binding sites in B. cereus group strains may contribute to the strain-specific modulation of toxin synthesis [79].
In summary, the results from our proof-of-principle study highlight the complexity of multilayer networks involved in the transcriptional and posttranscriptional regulation of enterotoxins and virulence factors in B. cereus, which are far from understood.
Thus, our newly established set of reference genes, including rho, rpoD and recA, is expected to facilitate data normalization in future RT-qPCR-based studies to exploit the intricate multifaceted cellular processes that orchestrate the panoply of toxins and other virulence factors in pathogenic B. cereus. Understanding the molecular mechanisms behind toxin regulation could pave the way for innovative strategies to harness the beneficial properties of B. cereus, while mitigating its pathogenic potential. Insights into the regulatory pathways coining toxin production could also potentially be leveraged toward new pharmaceutical strategies to treat bacterial infections.

4. Materials and Methods

4.1. Bacterial Cultivation and RNA Isolation

Two toxigenic B. cereus strains, the emetic reference strain F4810/72 and enteropathogenic reference strain NVH0075-95, were used as model organisms. Both strains included in this study have been isolated in the context of foodborne outbreaks. B. cereus F4810/72 (also known as AH187) was implicated in a foodborne outbreak in 1972 in the UK. It was isolated from the vomit of a patient after the consumption of contaminated rice by the Public Health Laboratory Service (PHLS) in London, UK. It has been extensively characterized by Ehling-Schulz et al. [70]. It is the commonly known reference strain for the emetic type of B. cereus because it was used to decipher the molecular basis of the non-ribosomal synthesis of the emetic toxin cereulide [17,20].
B. cereus NVH0075-95 was isolated from stew with vegetables, which was implicated in a large foodborne outbreak in Norway in 1995 [27]. NVH0075-95 is a commonly used reference strain for the enteropathogenic type of B. cereus since the non-hemolytic tripartite enterotoxin Nhe, a key virulence factor in enteropathogenic B. cereus, was first described and characterized in this strain [27].
Bacteria were pre-cultured in 3 mL LB and incubated for 8 h at 30 °C while shaking at 120 rpm. These pre-cultures were used to inoculate the 100 mL main cultures with a start OD600 of 0.05. The main cultures were incubated at 30 °C while shaking at 120 rpm for three, nine and fifteen h. LB-Miller broth (LB) and modified optimal defined medium (MOD) liquid media were used for the main cultures [45,46]. LB contains 10 g tryptone, 5 g yeast extract and 10 g NaCl per liter. MOD medium [45] consists of a basic medium [45.41 mM (NH4)2SO4, 5.74 mM K2HPO4, 0.16 mM MgSO4] supplemented with trace elements (3.39 mM FeCl2 × 6 H2O, 0.25 mM MnCl2 × 4 H2O, 0.12 mM Na2MoO4 × 2 H2O, 2.47 mM CaCl2, 0.62 mM ZnCl2, 0.12 mM CoCl2 × 6 H2O, 0.25 mM CuSO4, 0.12 mM NaSeO4), 20 mM D-glucose and a mixture of 15 amino acids (13.60 mM L-glutamic acid, 5.20 mM L-glycine, 7.77 mM L-valine, 7.64 mM L-threonine, 2.68 mM L-methionine, 2.32 mM L-histidine, 2.64 mM L-arginine, 6.83 mM L-aspartic acid, 0.33 mM L-cysteine, 5.37 mM L-isoleucine, 10.44 mM L-leucine, 1.70 mM L-phenylalanine, 8.07 mM L-lysine, 6.28 mM L-serine, 0.23 mM L-tyrosine). The composition of both media in a table format is shown in Supplementary Table S2.
Transcription of toxin genes and candidate reference genes in both B. cereus strains was analyzed by RT-qPCR as described previously [80]. For RNA extraction, the main cultures were centrifuged at 5,000 × g for 5 min to obtain the cell pellets. The supernatant was discarded, and the cell pellets were snap-frozen in liquid nitrogen and stored at −80 °C until RNA extraction.
RNA was extracted from the frozen pellets using TRIzol reagent (Thermo Fisher, Waltham, MA, USA) and homogenized using a FastPrep®-24 Ribolyser (MP Biomedicals, Santa Ana, CA, USA) at a speed of 6.5 for 2 cycles of 45 s each, with 30 s on ice between cycles. ZnSn beads (0.1 mm) in 2 mL screw-top tubes were used to homogenize the samples. Chloroform was added to induce phase separation, and nucleic acids were precipitated with 75% ethanol. The RNA concentration was measured using a Nanodrop™ 2000 spectrophotometer (Thermo Fisher, Waltham, MA, USA). Samples were then diluted to achieve a final volume of 2 µg for cDNA synthesis using the iScript™ gDNA Clear Synthesis Kit (Bio-Rad, Hercules, CA, USA).

4.2. Primer Design and Efficiency Testing

All primers except for cesB were designed specifically for this study. Primers targeting cesB (Table 1) were designed based on the plasmid sequence (GenBank accession number DQ360825, see Table 1 for localization) [21]. Primers for this study were designed using the Primer3 algorithm [81,82,83] with the following parameters: primer length of 21 ± 3 bp, GC content of 40–60% and a melting temperature (Tm) of 60 ± 0.5 °C. Primers were designed using the genomes of F4810/72 [84] (GenBank accession number: GCA_000021225.1) and NVH0075-95 [27] (GenBank accession number: GCF_027945115.1) as reference genomes, ensuring complete sequence identity with both strains (for localization in F4810/72, see Table 1; for detailed gene accession numbers, see Table S1). Primer integrity and potentially emerging secondary structures were further assessed using NetPrimer (Premier Biosoft, San Francisco, CA, USA) [85,86,87]. RT-qPCR efficiencies of various primer sets were calculated by using seven serial dilutions of pooled cDNA as previously described [21]. By plotting Cq values and the corresponding negative logarithm of the dilution factor, a linear regression model was calculated, and both Pearson’s correlation coefficient (R2) and the respective slope were determined. RT-qPCR efficiencies E were calculated according to the following equation.
E % = 10   1 Slope 1 ×   100

4.3. RNA Quantification by RT-qPCR

For the gene expression analysis of cellular RNA, qPCR reactions were performed using the SsoFast EvaGreen Supermix (Bio-Rad, Hercules, CA, USA) on a Rotor-Gene Q thermal cycler (model 5-Plex HRM, Qiagen, Hilden, Germany) in a total volume of 10 μL, with 1 ng cDNA and a respective primer concentration of 500 nM. The thermal cycling protocol included an initial polymerase activation step at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s, and annealing at 57 °C for cesB and 60 °C for all other genes for 5 s. Controls without a template were included to verify the absence of secondary structures of primers. Rotor-Gene Q 2.3.1.49 software (Qiagen, Hilden, Germany) was used to obtain Cq values, setting the threshold for quantification in the exponential phase.

4.4. Data Analysis

A thorough literature search identified potentially suitable reference genes for data normalization [57,58,59,88]. After obtaining the RT-qPCR data of the candidate reference genes, RefFinder [56] was employed to obtain a comprehensive ranking of four commonly used algorithms: BestKeeper [47], NormFinder [53], geNorm [54] and the comparative ΔCq method [55]. This ranking was used to identify the most stable combination of reference genes. For further normalization of gene expression data, the geometric mean of the most robust combination—rho, rpoD and recA—was used.
The ∆∆Cq method [89] was used to calculate target gene expression data. The arithmetic mean of the Cq values from two technical replicates per sample was calculated, and the geometric mean of the resulting Cq values of the reference gene combination (rho, rpoD and recA) was subtracted to calculate ∆Cq values. The ∆Cq values were then normalized to the respective reference conditions to obtain ∆∆Cq values. Statistical significance was determined between ∆∆Cq values retrieved from samples from the same culture media by two-way ANOVA (Figure 4) or one-way ANOVA (Figure 5) with Tukey‘s correction for multiple testing. Statistical significance regarding strain-dependent differences in Cq values of reference gene expression (Figure S1A) was determined by multiple t-tests with Holm–Sidak correction for multiple testing. Data visualization and statistical analysis were performed using GraphPad Prism 10.4.0.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/toxins17020058/s1, Figure S1: Comparison of Cq values of candidate reference genes of emetic and enteropathogenic B. cereus strains; Table S1: Accession numbers of candidate reference genes for accurate gene expression profiling in toxigenic Bacillus cereus; Table S2: Media composition of MOD medium and LB-Miller broth.

Author Contributions

Writing—original draft, T.V.E. and A.L.-D.; visualization, T.V.E. and A.L.-D.; validation, T.V.E., A.L.-D., M.W.P. and M.E.-S.; methodology, T.V.E. and A.L.-D.; investigation, T.V.E., A.L.-D. and M.E.-S.; formal analysis, T.V.E. and A.L.-D.; conceptualization T.V.E., A.L.-D., M.W.P. and M.E.-S.; resources, M.W.P. and M.E.-S.; funding acquisition, A.L.-D., T.V.E. and M.E.-S.; writing—review and editing, M.W.P. and M.E.-S.; supervision, M.W.P. and M.E.-S.; project administration, M.E.-S. All authors have read and agreed to the published version of the manuscript.

Funding

The work of A.L.-D. was supported by the Vienna Anniversary Foundation for Higher Education (H-409332/2021). The work of T.V.E. was supported by ERASMUS+ Student Mobility for Traineeships (SMT). Open Access Funding by the University of Veterinary Medicine Vienna.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Acknowledgments

We thank Susanna Leiter and Daniela Drin for their excellent technical assistance. Moreover, we thank Christian Grätz for support in the primer design and Granit Thaqi for assistance in data analysis.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Agata, N.; Ohta, M.; Yokoyama, K. Production of Bacillus cereus Emetic Toxin (Cereulide) in Various Foods. Int. J. Food Microbiol. 2002, 73, 23–27. [Google Scholar] [CrossRef] [PubMed]
  2. Ehling-Schulz, M.; Fricker, M.; Scherer, S. Bacillus cereus, the Causative Agent of an Emetic Type of Food-Borne Illness. Mol. Nutr. Food Res. 2004, 48, 479–487. [Google Scholar] [CrossRef] [PubMed]
  3. Messelhäußer, U.; Ehling-Schulz, M. Bacillus cereus—A Multifaceted Opportunistic Pathogen. Curr. Clin. Micro Rpt. 2018, 5, 120–125. [Google Scholar] [CrossRef]
  4. Jovanovic, J.; Ornelis, V.F.M.; Madder, A.; Rajkovic, A. Bacillus cereus Food Intoxication and Toxicoinfection. Compr. Rev. Food Sci. Food Saf. 2021, 20, 3719–3761. [Google Scholar] [CrossRef]
  5. Foxcroft, N.; Masaka, E.; Oosthuizen, J. Prevalence Trends of Foodborne Pathogens Bacillus cereus, Non-STEC Escherichia coli and Staphylococcus aureus in Ready-to-Eat Foods Sourced from Restaurants, Cafés, Catering and Takeaway Food Premises. Int. J. Environ. Res. Public Health 2024, 21, 1426. [Google Scholar] [CrossRef]
  6. Dietrich, R.; Jessberger, N.; Ehling-Schulz, M.; Märtlbauer, E.; Granum, P.E. The Food Poisoning Toxins of Bacillus cereus. Toxins 2021, 13, 98. [Google Scholar] [CrossRef]
  7. Cormontagne, D.; Rigourd, V.; Vidic, J.; Rizzotto, F.; Bille, E.; Ramarao, N. Bacillus cereus Induces Severe Infections in Preterm Neonates: Implication at the Hospital and Human Milk Bank Level. Toxins 2021, 13, 123. [Google Scholar] [CrossRef]
  8. Zhang, W.; Ma, C.; Hu, L.; Wang, L.; Xu, F. Late-Onset Sepsis in Newborns Caused by Bacillus cereus: A Case Report and Literature Review. Ann. Clin. Microbiol. Antimicrob. 2024, 23, 66. [Google Scholar] [CrossRef]
  9. Bottone, E.J. Bacillus cereus, a Volatile Human Pathogen. Clin. Microbiol. Rev. 2010, 23, 382–398. [Google Scholar] [CrossRef]
  10. Glasset, B.; Herbin, S.; Granier, S.A.; Cavalié, L.; Lafeuille, E.; Guérin, C.; Ruimy, R.; Casagrande-Magne, F.; Levast, M.; Chautemps, N.; et al. Bacillus cereus, a Serious Cause of Nosocomial Infections: Epidemiologic and Genetic Survey. PLoS ONE 2018, 13, e0194346. [Google Scholar] [CrossRef]
  11. Little, J.S.; Coughlin, C.; Hsieh, C.; Lanza, M.; Huang, W.Y.; Kumar, A.; Dandawate, T.; Tucker, R.; Gable, P.; Vazquez Deida, A.A.; et al. Neuroinvasive Bacillus cereus Infection in Immunocompromised Hosts: Epidemiologic Investigation of 5 Patients with Acute Myeloid Leukemia. Open Forum Infect. Dis. 2024, 11, ofae048. [Google Scholar] [CrossRef]
  12. Rouzeau-Szynalski, K.; Stollewerk, K.; Messelhäusser, U.; Ehling-Schulz, M. Why Be Serious about Emetic Bacillus cereus: Cereulide Production and Industrial Challenges. Food Microbiol. 2020, 85, 103279. [Google Scholar] [CrossRef] [PubMed]
  13. Tschiedel, E.; Rath, P.-M.; Steinmann, J.; Becker, H.; Dietrich, R.; Paul, A.; Felderhoff-Müser, U.; Dohna-Schwake, C. Lifesaving Liver Transplantation for Multi-Organ Failure Caused by Bacillus cereus Food Poisoning. Pediatr. Transplant. 2015, 19, E11–E14. [Google Scholar] [CrossRef] [PubMed]
  14. Mahler, H.; Pasi, A.; Kramer, J.M.; Schulte, P.; Scoging, A.C.; Bär, W.; Krähenbühl, S. Fulminant Liver Failure in Association with the Emetic Toxin of Bacillus cereus. N. Engl. J. Med. 1997, 336, 1142–1148. [Google Scholar] [CrossRef] [PubMed]
  15. Thery, M.; Cousin, V.L.; Tissieres, P.; Enault, M.; Morin, L. Multi-Organ Failure Caused by Lasagnas: A Case Report of Bacillus cereus Food Poisoning. Front. Pediatr. 2022, 10, 978250. [Google Scholar] [CrossRef]
  16. Jessberger, N.; Kranzler, M.; Da Riol, C.; Schwenk, V.; Buchacher, T.; Dietrich, R.; Ehling-Schulz, M.; Märtlbauer, E. Assessing the Toxic Potential of Enteropathogenic Bacillus cereus. Food Microbiol. 2019, 84, 103276. [Google Scholar] [CrossRef]
  17. Ehling-Schulz, M.; Lereclus, D.; Koehler, T.M. The Bacillus cereus Group: Bacillus Species with Pathogenic Potential. Microbiol. Spectr. 2019, 7. [Google Scholar] [CrossRef]
  18. Stenfors Arnesen, L.P.; Fagerlund, A.; Granum, P.E. From Soil to Gut: Bacillus cereus and Its Food Poisoning Toxins. FEMS Microbiol. Rev. 2008, 32, 579–606. [Google Scholar] [CrossRef]
  19. Ehling-Schulz, M.; Fricker, M.; Grallert, H.; Rieck, P.; Wagner, M.; Scherer, S. Cereulide Synthetase Gene Cluster from Emetic Bacillus cereus: Structure and Location on a Mega Virulence Plasmid Related to Bacillus anthracis Toxin Plasmid pXO1. BMC Microbiol. 2006, 6, 20. [Google Scholar] [CrossRef]
  20. Ehling-Schulz, M.; Vukov, N.; Schulz, A.; Shaheen, R.; Andersson, M.; Märtlbauer, E.; Scherer, S. Identification and Partial Characterization of the Nonribosomal Peptide Synthetase Gene Responsible for Cereulide Production in Emetic Bacillus cereus. Appl. Environ. Microbiol. 2005, 71, 105–113. [Google Scholar] [CrossRef]
  21. Dommel, M.K.; Lücking, G.; Scherer, S.; Ehling-Schulz, M. Transcriptional Kinetic Analyses of Cereulide Synthetase Genes with Respect to Growth, Sporulation and Emetic Toxin Production in Bacillus cereus. Food Microbiol. 2011, 28, 284–290. [Google Scholar] [CrossRef] [PubMed]
  22. Häggblom, M.M.; Apetroaie, C.; Andersson, M.A.; Salkinoja-Salonen, M.S. Quantitative Analysis of Cereulide, the Emetic Toxin of Bacillus cereus, Produced under Various Conditions. Appl. Environ. Microbiol. 2002, 68, 2479–2483. [Google Scholar] [CrossRef] [PubMed]
  23. Apetroaie-Constantin, C.; Shaheen, R.; Andrup, L.; Smidt, L.; Rita, H.; Salkinoja-Salonen, M. Environment Driven Cereulide Production by Emetic Strains of Bacillus cereus. Int. J. Food Microbiol. 2008, 127, 60–67. [Google Scholar] [CrossRef]
  24. Fox, D.; Mathur, A.; Xue, Y.; Liu, Y.; Tan, W.H.; Feng, S.; Pandey, A.; Ngo, C.; Hayward, J.A.; Atmosukarto, I.I.; et al. Bacillus cereus Non-Haemolytic Enterotoxin Activates the NLRP3 Inflammasome. Nat. Commun. 2020, 11, 760. [Google Scholar] [CrossRef]
  25. Lindbäck, T.; Fagerlund, A.; Rødland, M.S.; Granum, P.E. Characterization of the Bacillus cereus Nhe Enterotoxin. Microbiology 2004, 150, 3959–3967. [Google Scholar] [CrossRef]
  26. Lindbäck, T.; Hardy, S.P.; Dietrich, R.; Sødring, M.; Didier, A.; Moravek, M.; Fagerlund, A.; Bock, S.; Nielsen, C.; Casteel, M.; et al. Cytotoxicity of the Bacillus cereus Nhe Enterotoxin Requires Specific Binding Order of Its Three Exoprotein Components. Infect. Immun. 2010, 78, 3813–3821. [Google Scholar] [CrossRef]
  27. Lund, T.; Granum, P.E. Characterisation of a Non-Haemolytic Enterotoxin Complex from Bacillus cereus Isolated after a Foodborne Outbreak. FEMS Microbiol. Lett. 1996, 141, 151–156. [Google Scholar] [CrossRef]
  28. Doll, V.M.; Ehling-Schulz, M.; Vogelmann, R. Concerted Action of Sphingomyelinase and Non-Hemolytic Enterotoxin in Pathogenic Bacillus cereus. PLoS ONE 2013, 8, e61404. [Google Scholar] [CrossRef]
  29. Beecher, D.J.; Wong, A.C.L. Cooperative, Synergistic and Antagonistic Haemolytic Interactions between Haemolysin BL, Phosphatidylcholine Phospholipase C and Sphingomyelinase from Bacillus cereus. Microbiology 2000, 146 Pt 12, 3033–3039. [Google Scholar] [CrossRef]
  30. Oda, M.; Fujita, A.; Okui, K.; Miyamoto, K.; Shibutani, M.; Takagishi, T.; Nagahama, M. Bacillus cereus Sphingomyelinase Recognizes Ganglioside GM3. Biochem. Biophys. Res. Commun. 2013, 431, 164–168. [Google Scholar] [CrossRef]
  31. Oda, M.; Hashimoto, M.; Takahashi, M.; Ohmae, Y.; Seike, S.; Kato, R.; Fujita, A.; Tsuge, H.; Nagahama, M.; Ochi, S.; et al. Role of Sphingomyelinase in Infectious Diseases Caused by Bacillus cereus. PLoS ONE 2012, 7, e38054. [Google Scholar] [CrossRef] [PubMed]
  32. Flores-Díaz, M.; Monturiol-Gross, L.; Naylor, C.; Alape-Girón, A.; Flieger, A. Bacterial Sphingomyelinases and Phospholipases as Virulence Factors. Microbiol. Mol. Biol. Rev. 2016, 80, 597–628. [Google Scholar] [CrossRef] [PubMed]
  33. Mursalin, M.H.; Coburn, P.S.; Livingston, E.; Miller, F.C.; Astley, R.; Fouet, A.; Callegan, M.C. S-Layer Impacts the Virulence of Bacillus in Endophthalmitis. Invest. Ophthalmol. Vis. Sci. 2019, 60, 3727–3739. [Google Scholar] [CrossRef]
  34. Mei, F.; Lin, J.; Liu, M.; Yang, Y.; Lin, X.; Duan, F. Posttraumatic Bacillus cereus Endophthalmitis: Clinical Characteristics and Antibiotic Susceptibilities. J. Ophthalmol. 2021, 2021, 6634179. [Google Scholar] [CrossRef] [PubMed]
  35. Gohar, M.; Faegri, K.; Perchat, S.; Ravnum, S.; Økstad, O.A.; Gominet, M.; Kolstø, A.-B.; Lereclus, D. The PlcR Virulence Regulon of Bacillus cereus. PLoS ONE 2008, 3, e2793. [Google Scholar] [CrossRef]
  36. Declerck, N.; Bouillaut, L.; Chaix, D.; Rugani, N.; Slamti, L.; Hoh, F.; Lereclus, D.; Arold, S.T. Structure of PlcR: Insights into Virulence Regulation and Evolution of Quorum Sensing in Gram-Positive Bacteria. Proc. Natl. Acad. Sci. USA 2007, 104, 18490–18495. [Google Scholar] [CrossRef]
  37. Pomerantsev, A.P.; Kalnin, K.V.; Osorio, M.; Leppla, S.H. Phosphatidylcholine-Specific Phospholipase C and Sphingomyelinase Activities in Bacteria of the Bacillus cereus Group. Infect. Immun. 2003, 71, 6591–6606. [Google Scholar] [CrossRef]
  38. Agaisse, H.; Gominet, M.; Okstad, O.A.; Kolstø, A.B.; Lereclus, D. PlcR Is a Pleiotropic Regulator of Extracellular Virulence Factor Gene Expression in Bacillus thuringiensis. Mol. Microbiol. 1999, 32, 1043–1053. [Google Scholar] [CrossRef]
  39. Slamti, L.; Lereclus, D. A Cell–Cell Signaling Peptide Activates the PlcR Virulence Regulon in Bacteria of the Bacillus cereus Group. EMBO J. 2002, 21, 4550–4559. [Google Scholar] [CrossRef]
  40. Wloch-Salamon, D.M.; Gerla, D.; Hoekstra, R.F.; de Visser, J.A.G.M. Effect of Dispersal and Nutrient Availability on the Competitive Ability of Toxin-Producing Yeast. Proc. Biol. Sci. 2008, 275, 535–541. [Google Scholar] [CrossRef]
  41. Konečná, K.; Klimentová, J.; Benada, O.; Němečková, I.; Janďourek, O.; Jílek, P.; Vejsová, M. A Comparative Analysis of Protein Virulence Factors Released via Extracellular Vesicles in Two Candida albicans Strains Cultivated in a Nutrient-Limited Medium. Microb. Pathog. 2019, 136, 103666. [Google Scholar] [CrossRef]
  42. Jugert, C.-S.; Didier, A.; Jessberger, N. Lactoferrin-Based Food Supplements Trigger Toxin Production of Enteropathogenic Bacillus cereus. Front. Microbiol. 2023, 14, 1284473. [Google Scholar] [CrossRef] [PubMed]
  43. Kranzler, M.; Frenzel, E.; Walser, V.; Hofmann, T.F.; Stark, T.D.; Ehling-Schulz, M. Impact of Phytochemicals on Viability and Cereulide Toxin Synthesis in Bacillus cereus Revealed by a Novel High-Throughput Method, Coupling an AlamarBlue-Based Assay with UPLC-MS/MS. Toxins 2021, 13, 672. [Google Scholar] [CrossRef] [PubMed]
  44. Glatz, B.A.; Goepfert, J.M. Production of Bacillus cereus Enterotoxin in Defined Media in Fermenter-Grown Cultures. J. Food Prot. 1977, 40, 472–474. [Google Scholar] [CrossRef]
  45. Rosenfeld, E.; Duport, C.; Zigha, A.; Schmitt, P. Characterization of Aerobic and Anaerobic Vegetative Growth of the Food-Borne Pathogen Bacillus cereus F4430/73 Strain. Can. J. Microbiol. 2005, 51, 149–158. [Google Scholar] [CrossRef]
  46. Miller, J.H. Experiments in Molecular Genetics; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, USA, 1972; ISBN 978-0-87969-106-6. [Google Scholar]
  47. Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of Stable Housekeeping Genes, Differentially Regulated Target Genes and Sample Integrity: BestKeeper—Excel-Based Tool Using Pair-Wise Correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
  48. Grätz, C.; Bui, M.L.U.; Thaqi, G.; Kirchner, B.; Loewe, R.P.; Pfaffl, M.W. Obtaining Reliable RT-qPCR Results in Molecular Diagnostics—MIQE Goals and Pitfalls for Transcriptional Biomarker Discovery. Life 2022, 12, 386. [Google Scholar] [CrossRef]
  49. Dheda, K.; Huggett, J.F.; Chang, J.S.; Kim, L.U.; Bustin, S.A.; Johnson, M.A.; Rook, G.a.W.; Zumla, A. The Implications of Using an Inappropriate Reference Gene for Real-Time Reverse Transcription PCR Data Normalization. Anal. Biochem. 2005, 344, 141–143. [Google Scholar] [CrossRef]
  50. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef]
  51. Bustin, S.A. Improving the Quality of Quantitative Polymerase Chain Reaction Experiments: 15 Years of MIQE. Mol. Aspects Med. 2024, 96, 101249. [Google Scholar] [CrossRef]
  52. Curis, E.; Nepost, C.; Grillault Laroche, D.; Courtin, C.; Laplanche, J.-L.; Etain, B.; Marie-Claire, C. Selecting Reference Genes in RT-qPCR Based on Equivalence Tests: A Network Based Approach. Sci. Rep. 2019, 9, 16231. [Google Scholar] [CrossRef] [PubMed]
  53. Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
  54. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biol. 2002, 3, RESEARCH0034. [Google Scholar] [CrossRef] [PubMed]
  55. Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of Housekeeping Genes for Gene Expression Studies in Human Reticulocytes Using Real-Time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef]
  56. Xie, F.; Wang, J.; Zhang, B. RefFinder: A Web-Based Tool for Comprehensively Analyzing and Identifying Reference Genes. Funct. Integr. Genomics 2023, 23, 125. [Google Scholar] [CrossRef]
  57. Reiter, L.; Kolstø, A.-B.; Piehler, A.P. Reference Genes for Quantitative, Reverse-Transcription PCR in Bacillus cereus Group Strains throughout the Bacterial Life Cycle. J. Microbiol. Methods 2011, 86, 210–217. [Google Scholar] [CrossRef]
  58. Gomes, A.É.I.; Stuchi, L.P.; Siqueira, N.M.G.; Henrique, J.B.; Vicentini, R.; Ribeiro, M.L.; Darrieux, M.; Ferraz, L.F.C. Selection and Validation of Reference Genes for Gene Expression Studies in Klebsiella pneumoniae Using Reverse Transcription Quantitative Real-Time PCR. Sci. Rep. 2018, 8, 9001. [Google Scholar] [CrossRef]
  59. Theis, T.; Skurray, R.A.; Brown, M.H. Identification of Suitable Internal Controls to Study Expression of a Staphylococcus aureus Multidrug Resistance System by Quantitative Real-Time PCR. J. Microbiol. Methods 2007, 70, 355–362. [Google Scholar] [CrossRef]
  60. Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING Database in 2023: Protein-Protein Association Networks and Functional Enrichment Analyses for Any Sequenced Genome of Interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [CrossRef]
  61. Lücking, G.; Dommel, M.K.; Scherer, S.; Fouet, A.; Ehling-Schulz, M. Cereulide Synthesis in Emetic Bacillus cereus Is Controlled by the Transition State Regulator AbrB, but Not by the Virulence Regulator PlcR. Microbiology 2009, 155, 922–931. [Google Scholar] [CrossRef]
  62. de Oliveira, P.A.A.; Baboghlian, J.; Ramos, C.O.A.; Mançano, A.S.F.; Porcari, A.d.M.; Girardello, R.; Ferraz, L.F.C. Selection and Validation of Reference Genes Suitable for Gene Expression Analysis by Reverse Transcription Quantitative Real-Time PCR in Acinetobacter baumannii. Sci. Rep. 2024, 14, 3830. [Google Scholar] [CrossRef]
  63. Williams, M.L.; Ghanem, M. Evaluation of Candidate Reference Genes Stability for Gene Expression Analysis by Reverse Transcription qPCR in Clostridium perfringens. Sci. Rep. 2022, 12, 19434. [Google Scholar] [CrossRef] [PubMed]
  64. Magalhães, A.P.; França, Â.; Pereira, M.O.; Cerca, N. RNA-Based qPCR as a Tool to Quantify and to Characterize Dual-Species Biofilms. Sci. Rep. 2019, 9, 13639. [Google Scholar] [CrossRef] [PubMed]
  65. Crawford, E.C.; Singh, A.; Metcalf, D.; Gibson, T.W.G.; Weese, S.J. Identification of Appropriate Reference Genes for qPCR Studies in Staphylococcus pseudintermedius and Preliminary Assessment of icaA Gene Expression in Biofilm-Embedded Bacteria. BMC Res. Notes 2014, 7, 451. [Google Scholar] [CrossRef]
  66. Bidnenko, V.; Nicolas, P.; Grylak-Mielnicka, A.; Delumeau, O.; Auger, S.; Aucouturier, A.; Guerin, C.; Repoila, F.; Bardowski, J.; Aymerich, S.; et al. Termination Factor Rho: From the Control of Pervasive Transcription to Cell Fate Determination in Bacillus subtilis. PLoS Genet. 2017, 13, e1006909. [Google Scholar] [CrossRef]
  67. Del Val, E.; Nasser, W.; Abaibou, H.; Reverchon, S. Design and Comparative Characterization of RecA Variants. Sci. Rep. 2021, 11, 21106. [Google Scholar] [CrossRef]
  68. Price, C.W.; Doi, R.H. Genetic Mapping of rpoD Implicates the Major Sigma Factor of Bacillus subtilis RNA Polymerase in Sporulation Initiation. Mol. Gen. Genet. 1985, 201, 88–95. [Google Scholar] [CrossRef]
  69. Gacek-Matthews, A.; Chromiková, Z.; Sulyok, M.; Lücking, G.; Barák, I.; Ehling-Schulz, M. Beyond Toxin Transport: Novel Role of ABC Transporter for Enzymatic Machinery of Cereulide NRPS Assembly Line. mBio 2020, 11, 01577-20. [Google Scholar] [CrossRef]
  70. Ehling-Schulz, M.; Svensson, B.; Guinebretiere, M.-H.; Lindbäck, T.; Andersson, M.; Schulz, A.; Fricker, M.; Christiansson, A.; Granum, P.E.; Märtlbauer, E.; et al. Emetic Toxin Formation of Bacillus cereus Is Restricted to a Single Evolutionary Lineage of Closely Related Strains. Microbiology 2005, 151, 183–197. [Google Scholar] [CrossRef]
  71. Frenzel, E.; Doll, V.; Pauthner, M.; Lücking, G.; Scherer, S.; Ehling-Schulz, M. CodY Orchestrates the Expression of Virulence Determinants in Emetic Bacillus cereus by Impacting Key Regulatory Circuits. Mol. Microbiol. 2012, 85, 67–88. [Google Scholar] [CrossRef]
  72. Johler, S.; Kalbhenn, E.M.; Heini, N.; Brodmann, P.; Gautsch, S.; Bağcioğlu, M.; Contzen, M.; Stephan, R.; Ehling-Schulz, M. Enterotoxin Production of Bacillus thuringiensis Isolates from Biopesticides, Foods, and Outbreaks. Front. Microbiol. 2018, 9, 1915. [Google Scholar] [CrossRef] [PubMed]
  73. Buchacher, T.; Digruber, A.; Kanzler, M.; Del Favero, G.; Ehling-Schulz, M. Bacillus cereus Extracellular Vesicles Act as Shuttles for Biologically Active Multicomponent Enterotoxins. Cell Commun. Signal. 2023, 21, 112. [Google Scholar] [CrossRef] [PubMed]
  74. Bouillaut, L.; Perchat, S.; Arold, S.; Zorrilla, S.; Slamti, L.; Henry, C.; Gohar, M.; Declerck, N.; Lereclus, D. Molecular Basis for Group-Specific Activation of the Virulence Regulator PlcR by PapR Heptapeptides. Nucleic Acids Res. 2008, 36, 3791–3801. [Google Scholar] [CrossRef] [PubMed]
  75. Pomerantsev, A.P.; Pomerantseva, O.M.; Leppla, S.H. A Spontaneous Translational Fusion of Bacillus cereus PlcR and PapR Activates Transcription of PlcR-Dependent Genes in Bacillus anthracis via Binding with a Specific Palindromic Sequence. Infect. Immun. 2004, 72, 5814–5823. [Google Scholar] [CrossRef]
  76. Slamti, L.; Lereclus, D. Specificity and Polymorphism of the PlcR-PapR Quorum-Sensing System in the Bacillus cereus Group. J. Bacteriol. 2005, 187, 1182–1187. [Google Scholar] [CrossRef]
  77. Slamti, L.; Perchat, S.; Gominet, M.; Vilas-Bôas, G.; Fouet, A.; Mock, M.; Sanchis, V.; Chaufaux, J.; Gohar, M.; Lereclus, D. Distinct Mutations in PlcR Explain Why Some Strains of the Bacillus cereus Group Are Nonhemolytic. J. Bacteriol. 2004, 186, 3531–3538. [Google Scholar] [CrossRef]
  78. Jeßberger, N.; Rademacher, C.; Krey, V.M.; Dietrich, R.; Mohr, A.-K.; Böhm, M.-E.; Scherer, S.; Ehling-Schulz, M.; Märtlbauer, E. Simulating Intestinal Growth Conditions Enhances Toxin Production of Enteropathogenic Bacillus cereus. Front. Microbiol. 2017, 8, 627. [Google Scholar] [CrossRef]
  79. Böhm, M.-E.; Krey, V.M.; Jeßberger, N.; Frenzel, E.; Scherer, S. Comparative Bioinformatics and Experimental Analysis of the Intergenic Regulatory Regions of Bacillus cereus Hbl and Nhe Enterotoxin Operons and the Impact of CodY on Virulence Heterogeneity. Front. Microbiol. 2016, 7, 768. [Google Scholar] [CrossRef]
  80. Kalbhenn, E.M.; Kranzler, M.; Gacek-Matthews, A.; Grass, G.; Stark, T.D.; Frenzel, E.; Ehling-Schulz, M. Impact of a Novel PagR-like Transcriptional Regulator on Cereulide Toxin Synthesis in Emetic Bacillus cereus. Int. J. Mol. Sci. 2022, 23, 11479. [Google Scholar] [CrossRef]
  81. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
  82. Koressaar, T.; Remm, M. Enhancements and Modifications of Primer Design Program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [PubMed]
  83. Kõressaar, T.; Lepamets, M.; Kaplinski, L.; Raime, K.; Andreson, R.; Remm, M. Primer3_masker: Integrating Masking of Template Sequence with Primer Design Software. Bioinformatics 2018, 34, 1937–1938. [Google Scholar] [CrossRef] [PubMed]
  84. Turnbull, P.C.; Kramer, J.M.; Jørgensen, K.; Gilbert, R.J.; Melling, J. Properties and Production Characteristics of Vomiting, Diarrheal, and Necrotizing Toxins of Bacillus cereus. Am. J. Clin. Nutr. 1979, 32, 219–228. [Google Scholar] [CrossRef] [PubMed]
  85. Freier, S.M.; Kierzek, R.; Jaeger, J.A.; Sugimoto, N.; Caruthers, M.H.; Neilson, T.; Turner, D.H. Improved Free-Energy Parameters for Predictions of RNA Duplex Stability. Proc. Natl. Acad. Sci. USA 1986, 83, 9373–9377. [Google Scholar] [CrossRef] [PubMed]
  86. Breslauer, K.J.; Frank, R.; Blöcker, H.; Marky, L.A. Predicting DNA Duplex Stability from the Base Sequence. Proc. Natl. Acad. Sci. USA 1986, 83, 3746–3750. [Google Scholar] [CrossRef]
  87. Rychlik, W.; Spencer, W.J.; Rhoads, R.E. Optimization of the Annealing Temperature for DNA Amplification in Vitro. Nucleic Acids Res. 1990, 18, 6409–6412. [Google Scholar] [CrossRef]
  88. Sihto, H.-M.; Tasara, T.; Stephan, R.; Johler, S. Validation of Reference Genes for Normalization of qPCR mRNA Expression Levels in Staphylococcus aureus Exposed to Osmotic and Lactic Acid Stress Conditions Encountered during Food Production and Preservation. FEMS Microbiol. Lett. 2014, 356, 134–140. [Google Scholar] [CrossRef]
  89. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Figure 1. Schematic overview of identification of suitable reference genes and primers for RT-qPCR analysis of toxigenic B. cereus. (A) Cultivation of bacteria: 100 mL main cultures, either LB or MOD, inoculated with B. cereus precultivated in 3 mL LB overnight at 30 °C. Start OD600: 0.05. For details, see Material and Methods (created with biorender.com); (B) bioinformatical network analysis (STRING DB) to identify putative protein–protein interactions of the gene products of candidate reference genes; (C) RT-qPCR efficiency: slopes of primer sets targeting candidate reference genes were used to calculate RT-qPCR efficiencies.
Figure 1. Schematic overview of identification of suitable reference genes and primers for RT-qPCR analysis of toxigenic B. cereus. (A) Cultivation of bacteria: 100 mL main cultures, either LB or MOD, inoculated with B. cereus precultivated in 3 mL LB overnight at 30 °C. Start OD600: 0.05. For details, see Material and Methods (created with biorender.com); (B) bioinformatical network analysis (STRING DB) to identify putative protein–protein interactions of the gene products of candidate reference genes; (C) RT-qPCR efficiency: slopes of primer sets targeting candidate reference genes were used to calculate RT-qPCR efficiencies.
Toxins 17 00058 g001
Figure 2. Validation of reference genes for transcriptional studies of toxigenic B. cereus. (A) The scheme shows four common mathematical models to identify reference genes (created with biorender.com), (B) which are summarized by their geometric mean by RefFinder. Rankings of each model are shown for (C) NormFinder; (D) comparative ΔCq; (E) geNorm; and (F) BestKeeper.
Figure 2. Validation of reference genes for transcriptional studies of toxigenic B. cereus. (A) The scheme shows four common mathematical models to identify reference genes (created with biorender.com), (B) which are summarized by their geometric mean by RefFinder. Rankings of each model are shown for (C) NormFinder; (D) comparative ΔCq; (E) geNorm; and (F) BestKeeper.
Toxins 17 00058 g002
Figure 3. Pairwise variation (V) of B. cereus candidate genes. The pairwise variation (Vn/Vn+1) was calculated between the consecutive normalization factors NFn, and NFn+1 using geNorm to determine the optimal number of reference genes. The dotted line indicates the threshold of 0.15, below which including additional reference genes is not necessary.
Figure 3. Pairwise variation (V) of B. cereus candidate genes. The pairwise variation (Vn/Vn+1) was calculated between the consecutive normalization factors NFn, and NFn+1 using geNorm to determine the optimal number of reference genes. The dotted line indicates the threshold of 0.15, below which including additional reference genes is not necessary.
Toxins 17 00058 g003
Figure 4. Spatiotemporal analysis of toxin gene expression in emetic B. cereus using the newly defined set of reference genes. Dynamics of toxin gene transcription of (A) cesB, (B) nheB, (C) sph and (D) plc are shown for emetic B. cereus (F4810/72) grown in LB and MOD. Samples were taken after 3 h, 9 h and 15 h incubation at 30 °C, 120 rpm. The most appropriate combination of constitutively expressed reference genes—rho, rpoD and recA (see Figure 2)—was used to normalize the data. To assess transcriptional patterns, each condition was further normalized to gene expression of bacteria grown in LB for 3 h. Statistical significance was calculated by two-way ANOVA with Tukey‘s correction for multiple testing. Statistical significance levels are indicated as follows: ns > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 4. Spatiotemporal analysis of toxin gene expression in emetic B. cereus using the newly defined set of reference genes. Dynamics of toxin gene transcription of (A) cesB, (B) nheB, (C) sph and (D) plc are shown for emetic B. cereus (F4810/72) grown in LB and MOD. Samples were taken after 3 h, 9 h and 15 h incubation at 30 °C, 120 rpm. The most appropriate combination of constitutively expressed reference genes—rho, rpoD and recA (see Figure 2)—was used to normalize the data. To assess transcriptional patterns, each condition was further normalized to gene expression of bacteria grown in LB for 3 h. Statistical significance was calculated by two-way ANOVA with Tukey‘s correction for multiple testing. Statistical significance levels are indicated as follows: ns > 0.05, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Toxins 17 00058 g004
Figure 5. Comparative transcriptional analysis of toxin genes in emetic and enteropathogenic B. cereus. Toxin gene expression of (A) cesB, (B) nheB, (C) sph and (D) plc are shown for emetic (F4810/72) and enteropathogenic (NVH0075-95) B. cereus grown in LB and MOD at 30 °C for 9 h. The newly established set of reference genes, rho, rpoD and recA (see Figure 2), was used for data normalization. Each tested condition was further normalized to the gene expression of the emetic strain (F4810/72) grown in LB. Statistical significance was calculated by one-way ANOVA with Tukey‘s correction for multiple testing. Statistical significance levels are indicated as follows: ns > 0.05, ** p < 0.01, *** p < 0.001; ‘nd’ indicates not detected.
Figure 5. Comparative transcriptional analysis of toxin genes in emetic and enteropathogenic B. cereus. Toxin gene expression of (A) cesB, (B) nheB, (C) sph and (D) plc are shown for emetic (F4810/72) and enteropathogenic (NVH0075-95) B. cereus grown in LB and MOD at 30 °C for 9 h. The newly established set of reference genes, rho, rpoD and recA (see Figure 2), was used for data normalization. Each tested condition was further normalized to the gene expression of the emetic strain (F4810/72) grown in LB. Statistical significance was calculated by one-way ANOVA with Tukey‘s correction for multiple testing. Statistical significance levels are indicated as follows: ns > 0.05, ** p < 0.01, *** p < 0.001; ‘nd’ indicates not detected.
Toxins 17 00058 g005
Table 1. Oligonucleotide primers designed for RT-qPCR.
Table 1. Oligonucleotide primers designed for RT-qPCR.
Gene NameProduct NamePrimer Sequences (5′–3′)Nucleotide
Position
Product Size (bp)E (%)R2
cesBcereulide synthetase BTTAGATGGTATTCTTCACTTGGC20,181–20,203308114.240.9961
TTGATACAAATCGCATTCTTATAACC20,463–20,488
nheBnon-hemolytic enterotoxin NHE subunit BCTTTAGTTGCTGCGGTAGATGC1,859,686–1,859,70716891.020.9961
CATCACCCTTGAAGTTTTGCGT1,859,832–1,859,853
sphsphingomyelinase CATTGGGGACAAAGTCAGCGT762,343–762,36211695.290.9927
TCCTAAAAGGCGATCTGAAGCA762,437–762,458
plcphospholipase CGAACGGTATTTATGCTGCTGACT761,515–761,537125102.780.9933
CAGTTTCTTTTGCCTGCTTTGC761,618–761,639
gatB_
Yqey
gatB/Yqey domain-
containing protein
GTCATTCGTATGGTTAAGGCTGC4,115,261–4,115,283223103.840.9969
GCTCTTCTTCCGTTAATTGCTCC4,115,061–4,115,083
gyrADNA Gyrase subunit AAAGAGGTTACCAGCTTCCACGT8148–81697293.540.997
ATTTGTCCCCATTCCTTGCAC8199–8219
proCPyrroline-5-carboxylate reductaseGATCGCTGCTGGTAAAAGTATTGA2,802,477–2,802,500136113.930.9467
TGTCACCATTTCATTCGGGC2,802,593–2,802,612
recArecombinase ACACCACCATTCCGTGTTGC3,578,587–3,578,60515188.980.988
CGACCTTGTCCTAAGCGTTCT3,578,455–3,578,475
rhotranscription
termination factor Rho
ACGACCTCCGAAAGAAAATGAAC5,093,968–5,093,99012594.60.9917
TGGCGATCTGGGTATAATGGTG5,093,862–5,093,883
rpoDRNA polymerase sigma factor RpoDCACAGGAGCCAGTTTCTCTTGA4,101,300–4,101,32191102.880.9921
GGCGATGTTGCTTCTTGGTC4,101,231–4,101,250
rpsU30S ribosomal protein S21AGATCGGTTTCTAAAACTGGTACAC4,115,460–4,115,48411199.930.9958
GAATTTACGCTTTCTTGCCGC4,115,374–4,115,394
rrn16S rRNATTTCCGCCCTTTAGTGCTGA 250120.310.9975
CCCAACATCTCACGACACGA
wecBUDP-N-acetylglucosamine 2-epimeraseGCAGGACTTCGTACATGGGAT4,946,363–4,946,38379101.390.9962
TCGTTGCTGATTTTGCTGTAGG4,946,272–4,946,293
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Edelbacher, T.V.; Laimer-Digruber, A.; Pfaffl, M.W.; Ehling-Schulz, M. Establishing Reference Genes for Accurate Gene Expression Profiling in Toxigenic Bacillus cereus. Toxins 2025, 17, 58. https://doi.org/10.3390/toxins17020058

AMA Style

Edelbacher TV, Laimer-Digruber A, Pfaffl MW, Ehling-Schulz M. Establishing Reference Genes for Accurate Gene Expression Profiling in Toxigenic Bacillus cereus. Toxins. 2025; 17(2):58. https://doi.org/10.3390/toxins17020058

Chicago/Turabian Style

Edelbacher, Tanja V., Astrid Laimer-Digruber, Michael W. Pfaffl, and Monika Ehling-Schulz. 2025. "Establishing Reference Genes for Accurate Gene Expression Profiling in Toxigenic Bacillus cereus" Toxins 17, no. 2: 58. https://doi.org/10.3390/toxins17020058

APA Style

Edelbacher, T. V., Laimer-Digruber, A., Pfaffl, M. W., & Ehling-Schulz, M. (2025). Establishing Reference Genes for Accurate Gene Expression Profiling in Toxigenic Bacillus cereus. Toxins, 17(2), 58. https://doi.org/10.3390/toxins17020058

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop