Notch Signaling Regulates the Function and Phenotype of Dendritic Cells in Helicobacter pylori Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. H. pylori Culture
2.2. Generation of Murine Bone Marrow-Derived DCs
2.3. Stimulation of BMDCs with H. pylori
2.4. Co-Culture of BMDCs and CD4+ T Cells
2.5. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.6. Protein Extraction and Western Blot
2.7. ELISA
2.8. Flow Cytometry
2.9. Statistical Analysis
3. Results
3.1. H. pylori Induced the Expression of All Notch Receptors and Notch Ligands Dll4 and Jagged1 in BMDCs
3.2. Notch Signaling Was Involved in the Regulation of Cytokines in H. pylori-Infected BMDCs
3.3. Notch Signaling Was Involved in Regulating the Phenotype of BMDCs during H. pylori Infection
3.4. Inhibition of Notch Signaling in BMDCs Shifted the Th17/Treg Balance toward Treg of CD4+ T Cells
4. Discussions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Zamani, M.; Ebrahimtabar, F.; Zamani, V.; Miller, W.H.; Alizadeh-Navaei, R.; Shokri-Shirvani, J.; Derakhshan, M.H. Systematic review with meta-analysis: The worldwide prevalence of Helicobacter pylori infection. Aliment. Pharmacol. Ther. 2018, 47, 868–876. [Google Scholar] [CrossRef] [PubMed]
- Hooi, J.K.Y.; Lai, W.Y.; Ng, W.K.; Suen, M.M.Y.; Underwood, F.E.; Tanyingoh, D.; Malfertheiner, P.; Graham, D.Y.; Wong, V.W.S.; Wu, J.C.Y.; et al. Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis. Gastroenterology 2017, 153, 420–429. [Google Scholar] [CrossRef]
- Kao, J.Y.; Zhang, M.; Miller, M.J.; Mills, J.C.; Wang, B.; Liu, M.; Eaton, K.A.; Zou, W.; Berndt, B.E.; Cole, T.S.; et al. Helicobacter pylori Immune Escape Is Mediated by Dendritic Cell–Induced Treg Skewing and Th17 Suppression in Mice. Gastroenterology 2010, 138, 1046–1054. [Google Scholar] [CrossRef] [PubMed]
- Constantino, J.; Gomes, C.; Falcão, A.; Neves, B.M.; Cruz, M.T. Dendritic cell-based immunotherapy: A basic review and recent advances. Immunol. Res. 2017, 65, 798–810. [Google Scholar] [CrossRef] [PubMed]
- Shiu, J.; Blanchard, T.G. Dendritic cell function in the host response to Helicobacter pylori infection of the gastric mucosa. Pathog. Dis. 2013, 67, 46–53. [Google Scholar] [CrossRef]
- Owyang, S.Y.; Zhang, M.; El-Zaatari, M.; Eaton, K.A.; Bishu, S.; Hou, G.; Grasberger, H.; Kao, J.Y. Dendritic cell-derived TGF-β mediates the induction of mucosal regulatory T-cell response to Helicobacter infection essential for maintenance of immune tolerance in mice. Helicobacter 2020, 25, e12763. [Google Scholar] [CrossRef]
- Blosse, A.; Lehours, P.; Wilson, K.T.; Gobert, A.P. Helicobacter: Inflammation, immunology, and vaccines. Helicobacter 2018, 23 (Suppl. S1), e12517. [Google Scholar] [CrossRef]
- Arnold, I.C.; Zhang, X.; Artola-Boran, M.; Fallegger, A.; Sander, P.; Johansen, P.; Müller, A. BATF3-dependent dendritic cells drive both effector and regulatory T-cell responses in bacterially infected tissues. PLoS Pathog. 2019, 15, e1007866. [Google Scholar] [CrossRef]
- Khamri, W.; Walker, M.M.; Clark, P.; Atherton, J.C.; Thursz, M.R.; Bamford, K.B.; Lechler, R.I.; Lombardi, G. Helicobacter pylori Stimulates Dendritic Cells to Induce Interleukin-17 Expression from CD4+T Lymphocytes. Infect. Immun. 2010, 78, 845–853. [Google Scholar] [CrossRef]
- Andres, S.; Schmidt, H.-M.A.; Mitchell, H.; Rhen, M.; Maeurer, M.; Engstrand, L. Helicobacter pylori defines local immune response through interaction with dendritic cells. FEMS Immunol. Med. Microbiol. 2011, 61, 168–178. [Google Scholar] [CrossRef]
- Fehlings, M.; Drobbe, L.; Moos, V.; Viveros, P.R.; Hagen, J.; Beigier-Bompadre, M.; Pang, E.; Belogolova, E.; Churin, Y.; Schneider, T.; et al. Comparative Analysis of the Interaction of Helicobacter pylori with Human Dendritic Cells, Macrophages, and Monocytes. Infect. Immun. 2012, 80, 2724–2734. [Google Scholar] [CrossRef] [PubMed]
- Helmin-Basa, A.; Wiese-Szadkowska, M.; Szaflarska-Popławska, A.; Kłosowski, M.; Januszewska, M.; Bodnar, M.; Marszałek, A.; Gackowska, L.; Michalkiewicz, J. Relationship between Helicobacter pylori Infection and Plasmacytoid and Myeloid Dendritic Cells in Peripheral Blood and Gastric Mucosa of Children. Mediat. Inflamm. 2019, 2019, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Skokos, D.; Nussenzweig, M.C. CD8− DCs induce IL-12–independent Th1 differentiation through Delta 4 Notch-like ligand in response to bacterial LPS. J. Exp. Med. 2007, 204, 1525–1531. [Google Scholar] [CrossRef] [PubMed]
- Dua, B.; Upadhyay, R.; Natrajan, M.; Arora, M.; Narayanaswamy, B.K.; Joshi, B. Notch signaling induces lymphoproliferation, T helper cell activation and Th1/Th2 differentiation in leprosy. Immunol. Lett. 2019, 207, 6–16. [Google Scholar] [CrossRef] [PubMed]
- Goruganthu, M.U.L.; Shanker, A.; Dikov, M.M.; Carbone, D.P. Specific Targeting of Notch Ligand-Receptor Interactions to Modulate Immune Responses: A Review of Clinical and Preclinical Findings. Front. Immunol. 2020, 11, 1958. [Google Scholar] [CrossRef] [PubMed]
- Castro, R.C.; Gonçales, R.A.; Zambuzi, F.A.; Frantz, F.G. Notch signaling pathway in infectious diseases: Role in the regulation of immune response. Inflamm. Res. 2021, 70, 261–274. [Google Scholar] [CrossRef]
- Lai, E.C. Notch signaling: Control of cell communication and cell fate. Development 2004, 131, 965–973. [Google Scholar] [CrossRef]
- Amsen, D.; Helbig, C.; Backer, R.A. Notch in T Cell Differentiation: All Things Considered. Trends Immunol. 2015, 36, 802–814. [Google Scholar] [CrossRef]
- Bugeon, L.; Gardner, L.M.; Rose, A.; Gentle, M.; Dallman, M.J. Cutting Edge: Notch Signaling Induces a Distinct Cytokine Profile in Dendritic Cells That Supports T Cell-Mediated Regulation and IL-2-Dependent IL-17 Production. J. Immunol. 2008, 181, 8189–8193. [Google Scholar] [CrossRef]
- Ting, H.-A.; Schaller, M.A.; Nagata, D.E.d.A.; Rasky, A.J.; Maillard, I.P.; Lukacs, N.W. Notch Ligand Delta-like 4 Promotes Regulatory T Cell Identity in Pulmonary Viral Infection. J. Immunol. 2017, 198, 1492–1502. [Google Scholar] [CrossRef]
- Lee, C.-C.; Lin, C.-L.; Leu, S.-J.; Lee, Y.-L. Overexpression of Notch ligand Delta-like-1 by dendritic cells enhances their immunoregulatory capacity and exerts antiallergic effects on Th2-mediated allergic asthma in mice. Clin. Immunol. 2018, 187, 58–67. [Google Scholar] [CrossRef] [PubMed]
- Cheng, P.; Gabrilovich, D. Notch signaling in differentiation and function of dendritic cells. Immunol. Res. 2007, 41, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Ohishi, K.; Varnum-Finney, B.; Serda, R.E.; Anasetti, C.; Bernstein, I.D. The Notch ligand, Delta-1, inhibits the differentiation of monocytes into macrophages but permits their differentiation into dendritic cells. Blood 2001, 98, 1402–1407. [Google Scholar] [CrossRef]
- Pérez-Cabezas, B.; Naranjo-Gómez, M.; Bastos-Amador, P.; Requena-Fernández, G.; Pujol-Borrell, R.; Borràs, F.E. Ligation of Notch Receptors in Human Conventional and Plasmacytoid Dendritic Cells Differentially Regulates Cytokine and Chemokine Secretion and Modulates Th Cell Polarization. J. Immunol. 2011, 186, 7006–7015. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Wen, J.; Chen, C.; Luo, M.; Hu, B.; Wu, D.; Ye, J.; Lin, Y.; Ning, L.; Ning, Y.; et al. Notch 1 Is Involved in CD4+ T Cell Differentiation into Th1 Subtype During Helicobacter pylori Infection. Front. Cell Infect. Microbiol. 2020, 10, 575271. [Google Scholar] [CrossRef]
- Wen, J.; Chen, C.; Luo, M.; Liu, X.; Guo, J.; Wei, T.; Gu, X.; Gu, S.; Ning, Y.; Li, Y. Notch Signaling Ligand Jagged1 Enhances Macrophage-Mediated Response to Helicobacter pylori. Front. Microbiol. 2021, 12, 692832. [Google Scholar] [CrossRef]
- Rizzuti, D.; Ang, M.; Sokollik, C.; Wu, T.; Abdullah, M.; Greenfield, L.; Fattouh, R.; Reardon, C.; Tang, M.; Diao, J.; et al. Helicobacter pylori Inhibits Dendritic Cell Maturation via Interleukin-10-Mediated Activation of the Signal Transducer and Activator of Transcription 3 Pathway. J. Innate Immun. 2014, 7, 199–211. [Google Scholar] [CrossRef]
- Oertli, M.; Sundquist, M.; Hitzler, I.; Engler, D.B.; Arnold, I.C.; Reuter, S.; Maxeiner, J.; Hansson, M.; Taube, C.; Quiding-Järbrink, M.; et al. DC-derived IL-18 drives Treg differentiation, murine Helicobacter pylori–specific immune tolerance, and asthma protection. J. Clin. Investig. 2012, 122, 1082–1096. [Google Scholar] [CrossRef]
- Zhang, M.; Berndt, B.E.; Eaton, K.A.; Rathinavelu, S.; Pierzchala, A.; Kao, J.Y. Helicobacter pylori-Pulsed Dendritic Cells Induce H. pylori-Specific Immunity in Mice. Helicobacter 2008, 13, 200–208. [Google Scholar] [CrossRef]
- Hickey, A.; Stamou, P.; Udayan, S.; Ramón-Vázquez, A.; Esteban-Torres, M.; Bottacini, F.; Woznicki, J.A.; Hughes, O.; Melgar, S.; Ventura, M.; et al. Bifidobacterium breve Exopolysaccharide Blocks Dendritic Cell Maturation and Activation of CD4+ T Cells. Front. Microbiol. 2021, 12, 653587. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Meng, S.; Chang, W.; Fan, S.; Xie, J.; Guo, F.; Yang, Y.; Qiu, H.; Liu, L. Mesenchymal stem cells activate Notch signaling to induce regulatory dendritic cells in LPS-induced acute lung injury. J. Transl. Med. 2020, 18, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Zhang, H.; Xu, H.; Zeng, W.; Qiu, Y.; Tan, C.; Tang, S.; Zhang, J. Dendritic Cells Promote Treg Expansion but Not Th17 Generation in Response to Talaromyces marneffei Yeast Cells. Infect. Drug Resist. 2020, 13, 805–813. [Google Scholar] [CrossRef] [PubMed]
- Vanderbeck, A.; Maillard, I. Notch signaling at the crossroads of innate and adaptive immunity. J. Leukoc. Biol. 2020, 109, 535–548. [Google Scholar] [CrossRef]
- Gentle, M.E.; Rose, A.; Bugeon, L.; Dallman, M.J. Noncanonical Notch Signaling Modulates Cytokine Responses of Dendritic Cells to Inflammatory Stimuli. J. Immunol. 2012, 189, 1274–1284. [Google Scholar] [CrossRef]
- Milinkovic, I.; Krasavcevic, A.D.; Nikolic, N.; Aleksic, Z.; Carkic, J.; Jezdic, M.; Jankovic, S.; Milasin, J. Notch down-regulation and inflammatory cytokines and RANKL overexpression involvement in peri-implant mucositis and peri-implantitis: A cross-sectional study. Clin. Oral Implant. Res. 2021, 32, 1496–1505. [Google Scholar] [CrossRef]
- Lutz, M.B.; Schuler, G. Immature, semi-mature and fully mature dendritic cells: Which signals induce tolerance or immunity? Trends Immunol. 2002, 23, 445–449. [Google Scholar] [CrossRef]
- Ohishi, K.; Katayama, N.; Shiku, H.; Varnumfinney, B.; Bernstein, I. Notch signalling in hematopoiesis. Semin. Cell Dev. Biol. 2003, 14, 143–150. [Google Scholar] [CrossRef]
- Osborne, B.A.; Minter, L.M. Notch signalling during peripheral T-cell activation and differentiation. Nat. Rev. Immunol. 2006, 7, 64–75. [Google Scholar] [CrossRef]
- Fasnacht, N.; Huang, H.-Y.; Koch, U.; Favre, S.; Auderset, F.; Chai, Q.; Onder, L.; Kallert, S.; Pinschewer, D.D.; MacDonald, H.R.; et al. Specific fibroblastic niches in secondary lymphoid organs orchestrate distinct Notch-regulated immune responses. J. Exp. Med. 2014, 211, 2265–2279. [Google Scholar] [CrossRef]
- Nandagopal, N.; Santat, L.A.; LeBon, L.; Sprinzak, D.; Bronner, M.E.; Elowitz, M.B. Dynamic Ligand Discrimination in the Notch Signaling Pathway. Cell 2018, 172, 869–880.e19. [Google Scholar] [CrossRef] [PubMed]
- Ong, C.-T.; Cheng, H.-T.; Chang, L.-W.; Ohtsuka, T.; Kageyama, R.; Stormo, G.D.; Kopan, R. Target Selectivity of Vertebrate Notch Proteins.Collaboration between discrete domains and csl-binding site architecture determines activation probability. J. Biol. Chem. 2006, 281, 5106–5119. [Google Scholar] [CrossRef]
- Schaller, M.A.; Allen, R.M.; Kimura, S.; Day, C.L.; Kunkel, S.L. Systemic Expression of Notch Ligand Delta-Like 4 during Mycobacterial Infection Alters the T Cell Immune Response. Front. Immunol. 2016, 7, 527. [Google Scholar] [CrossRef] [PubMed]
- Schaller, M.A.; Neupane, R.; Rudd, B.D.; Kunkel, S.L.; Kallal, L.E.; Lincoln, P.; Lowe, J.B.; Man, Y.; Lukacs, N.W. Notch ligand Delta-like 4 regulates disease pathogenesis during respiratory viral infections by modulating Th2 cytokines. J. Exp. Med. 2007, 204, 2925–2934. [Google Scholar] [CrossRef] [PubMed]
- Liotta, F.; Frosali, F.; Querci, V.; Mantei, A.; Filì, L.; Maggi, L.; Mazzinghi, B.; Angeli, R.; Ronconi, E.; Santarlasci, V.; et al. Human immature myeloid dendritic cells trigger a TH2-polarizing program via Jagged-1/Notch interaction. J. Allergy Clin. Immunol. 2008, 121, 1000–1005.e8. [Google Scholar] [CrossRef]
- Higashi, T.; Hashimoto, K.; Takagi, R.; Mizuno, Y.; Okazaki, Y.; Tanaka, Y.; Matsushita, S. Curdlan Induces DC-Mediated Th17 Polarization via Jagged1 Activation in Human Dendritic Cells. Allergol. Int. 2010, 59, 161–166. [Google Scholar] [CrossRef]
- Cao, Q.; Lu, J.; Kaur, C.; Sivakumar, V.; Li, F.; Cheah, P.S.; Dheen, S.T.; Ling, E. Expression of Notch-1 receptor and its ligands Jagged-1 and Delta-1 in amoeboid microglia in postnatal rat brain and murine BV-2 cells. Glia 2008, 56, 1224–1237. [Google Scholar] [CrossRef]
- Holla, S.; Stephen-Victor, E.; Prakhar, P.; Sharma, M.; Saha, C.; Udupa, V.; Kaveri, S.V.; Bayry, J.; Balaji, K.N. Mycobacteria-responsive sonic hedgehog signaling mediates programmed death-ligand 1- and prostaglandin E2-induced regulatory T cell expansion. Sci. Rep. 2016, 6, 24193. [Google Scholar] [CrossRef]
- Jannuzzi, G.P.; de Almeida, J.R.F.; dos Santos, S.S.; de Almeida, S.R.; Ferreira, K.S. Notch Signaling is Required for Dendritic Cell Maturation and T Cell Expansion in Paracoccidioidomycosis. Mycopathologia 2018, 183, 739–749. [Google Scholar] [CrossRef]
- Kao, J.Y.; Rathinavelu, S.; Eaton, K.A.; Bai, L.; Zavros, Y.; Takami, M.; Pierzchala, A.; Merchant, J.L. Helicobacter pylori-secreted factors inhibit dendritic cell IL-12 secretion: A mechanism of ineffective host defense. Am. J. Physiol. Liver Physiol. 2006, 291, G73–G81. [Google Scholar] [CrossRef]
- Foldi, J.; Chung, A.Y.; Xu, H.; Zhu, J.; Outtz, H.H.; Kitajewski, J.; Li, Y.; Hu, X.; Ivashkiv, L.B. Autoamplification of Notch Signaling in Macrophages by TLR-Induced and RBP-J–Dependent Induction of Jagged1. J. Immunol. 2010, 185, 5023–5031. [Google Scholar] [CrossRef] [PubMed]
- Mochizuki, K.; Meng, L.; Mochizuki, I.; Tong, Q.; He, S.; Liu, Y.; Purushe, J.; Fung, H.; Zaidi, M.R.; Zhang, Y.; et al. Programming of donor T cells using allogeneic δ-like ligand 4–positive dendritic cells to reduce GVHD in mice. Blood 2016, 127, 3270–3280. [Google Scholar] [CrossRef] [PubMed]
- Weijzen, S.; Velders, M.P.; Elmishad, A.G.; Bacon, P.E.; Panella, J.R.; Nickoloff, B.J.; Miele, L.; Kast, W.M. The Notch Ligand Jagged-1 Is Able to Induce Maturation of Monocyte-Derived Human Dendritic Cells. J. Immunol. 2002, 169, 4273–4278. [Google Scholar] [CrossRef]
- Lin, C.; Huang, H.; Hsieh, C.; Fan, C.; Lee, Y. Jagged1-expressing adenovirus-infected dendritic cells induce expansion of Foxp3+ regulatory T cells and alleviate T helper type 2-mediated allergic asthma in mice. Immunology 2018, 156, 199–212. [Google Scholar] [CrossRef]
- Kranzer, K.; Eckhardt, A.; Aigner, M.; Knoll, G.; Deml, L.; Speth, C.; Lehn, N.; Rehli, M.; Schneider-Brachert, W. Induction of Maturation and Cytokine Release of Human Dendritic Cells by Helicobacter pylori. Infect. Immun. 2004, 72, 4552–4560. [Google Scholar] [CrossRef]
- Ito, T.; Schaller, M.; Hogaboam, C.M.; Standiford, T.J.; Sandor, M.; Lukacs, N.W.; Chensue, S.W.; Kunkel, S.L. TLR9 regulates the mycobacteria-elicited pulmonary granulomatous immune response in mice through DC-derived Notch ligand delta-like 4. J. Clin. Investig. 2008, 119, 33–46. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Xue, H.; Qi, R.; Wang, Y.; Yuan, L. Effect of γ-secretase inhibitor on Th17 cell differentiation and function of mouse psoriasis-like skin inflammation. J. Transl. Med. 2018, 16, 59. [Google Scholar] [CrossRef]
- Lin, Y.; Chen, W.; Li, J.; Yan, G.; Li, C.; Jin, N.; Chen, J.; Gao, C.; Ma, P.; Xu, S.; et al. Overexpression of Jagged-1 combined with blockade of CD40 pathway prolongs allograft survival. Immunol. Cell Biol. 2014, 93, 213–217. [Google Scholar] [CrossRef]
- Li, Q.; Zhang, H.; Yu, L.; Wu, C.; Luo, X.; Sun, H.; Ding, J. Down-regulation of Notch signaling pathway reverses the Th1/Th2 imbalance in tuberculosis patients. Int. Immunopharmacol. 2018, 54, 24–32. [Google Scholar] [CrossRef]
- Qin, L.; Zhou, Y.-C.; Wu, H.-J.; Zhuo, Y.; Wang, Y.-P.; Si, C.-Y.; Qin, Y.-M. Notch Signaling Modulates the Balance of Regulatory T Cells and T Helper 17 Cells in Patients with Chronic Hepatitis C. DNA Cell Biol. 2017, 36, 311–320. [Google Scholar] [CrossRef]
- Qi, J.; Yang, Y.; Hou, S.; Qiao, Y.; Wang, Q.; Yu, H.; Zhang, Q.; Cai, T.; Kijlstra, A.; Yang, P. Increased Notch pathway activation in Behçet’s disease. Rheumatology 2014, 53, 810–820. [Google Scholar] [CrossRef] [PubMed]





| Species | Target Gene | Primer Sequence (5′→3′) | |
|---|---|---|---|
| Murine | βActin | Forward | GCAGGAGTACGATGAGTCCG |
| Reverse | ACGCAGCTCAGTAACAGTCC | ||
| Murine | Notch1 | Forward | ACGTAGTCCCACCTGCCTAT |
| Reverse | CAGGTGCCCTGATTGTAGCA | ||
| Murine | Notch2 | Forward | GTTGATCCCCGTCAGTGTGT |
| Reverse | CAGGAGGCTGAAGTCGGTTT | ||
| Murine | Notch3 | Forward | ACTCCTCCTCAGGGAGATGC |
| Reverse | GTGGGGTGAAGCCATCAGG | ||
| Murine | Notch4 | Forward | CCAGAGAGCTTCTGTGTGGA |
| Reverse | CAGAAATCCAGGGGCACACT | ||
| Murine | Dll1 | Forward | ACCAAGTGCCAGTCACAGAG |
| Reverse | TCCATCTTACACCTCAGTCGC | ||
| Murine | Dll3 | Forward | CTCCCGGATGCACTCAACAA |
| Reverse | TGGAAGGGGCTGGTATGACA | ||
| Murine | Dll4 | Forward | CTTTGGCAATGTCTCCACGC |
| Reverse | ACTGCCGCTATTCTTGTCCC | ||
| Murine | Jagged1 | Forward | GGGTCAGTTTGAGCTGGAGA |
| Reverse | GTACGTATCACACTCGTCGC | ||
| Murine | Jagged2 | Forward | GCCTCGTCGTCATTCCCTTT |
| Reverse | AGCTCCTCATCTGGAGTGGT | ||
| Murine | Il6 | Forward | TAGTCCTTCCTACCCCAATTTCC |
| Reverse | TTGGTCCTTAGCCACTCCTTC | ||
| Murine | Il12 | Forward | CAATCACGCTACCTCCTCTTTT |
| Reverse | CAGCAGTGCAGGAATAATGTTTC | ||
| Murine | Il1β | Forward | TTCAGGCAGGCAGTATCACTC |
| Reverse | GAAGGTCCACGGGAAAGACAC | ||
| Murine | Tnfα | Forward | GGTCACTGTCCCAGCATCTT |
| Reverse | CTGTGAAGGGAATGGGTGTT | ||
| Murine | Il10 | Forward | ATTTCCGATAAGGCTTGGCAA |
| Reverse | GCTGGACAACATACTGCTAACC | ||
| Murine | Tgfβ | Forward | AGTGTGGAGCAACATGTGGAACT |
| Reverse | AGCAGCCGGTTACCAAGGTA | ||
| Murine | Tbx21 | Forward | AACACACACGTCTTTACTTTCCA |
| Reverse | CGTATCAACAGATGCGTACATGG | ||
| Murine | Ifnγ | Forward | ACTGGCAAAAGGATGGTGAC |
| Reverse | ACCTGTGGGTTGTTGACCTC | ||
| Murine | Gata3 | Forward | CGAGATGGTACCGGGCACTA |
| Reverse | GACAGTTCGCGCAGGATGT | ||
| Murine | Il4 | Forward | TCTCGAATGTACCAGGAGCCATAT |
| Reverse | AAGCACCTTGGAAGCCCTACAGA | ||
| Murine | Rorγt | Forward | CCGCTGAGAGGGCTTCAC |
| Reverse | TGCAGGAGTAGGCCACATTACA | ||
| Murine | Il17A | Forward | TTTAACTCCCTTGGCGCAAAA |
| Reverse | CTTTCCCTCCGCATTGACAC | ||
| Murine | Il17F | Forward | TGCTACTGTTGATGTTGGGAC |
| Reverse | AATGCCCTGGTTTTGGTTGAA | ||
| Murine | Foxp3 | Forward | CCCATCCCCAGGAGTCTTG |
| Reverse | ACCATGACTAGGGGCACTGTA | ||
| Antibodies | Dilution or Concentration | Source (Location) |
|---|---|---|
| Rabbit monoclonal anti-Jagged1 | 1:1000 | Cell signaling, Danvers, MA, USA Cat. No. 2620S |
| Rabbit polyclonal anti-Dll4 | 1:1000 | Affinity, San Francisco, CA, USA Cat. No. DF13221 |
| Anti-Dll1 antibody | 1:1000 | Abcam, Cambridge, UK No. ab84620 |
| β-Tubulin (9F3) Rabbit mAb | 1:1000 | Cell signaling, Danvers, MA, USA Cat. No. 2128S |
| Peroxidase conjugated Goat anti-Rabbit IgG | 1:10,000 | Fude BioTech, Hangzhou, China Cat. No. FDR007 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Q.; Chen, C.; He, Y.; Mai, W.; Ruan, S.; Ning, Y.; Li, Y. Notch Signaling Regulates the Function and Phenotype of Dendritic Cells in Helicobacter pylori Infection. Microorganisms 2023, 11, 2818. https://doi.org/10.3390/microorganisms11112818
Liu Q, Chen C, He Y, Mai W, Ruan S, Ning Y, Li Y. Notch Signaling Regulates the Function and Phenotype of Dendritic Cells in Helicobacter pylori Infection. Microorganisms. 2023; 11(11):2818. https://doi.org/10.3390/microorganisms11112818
Chicago/Turabian StyleLiu, Qiaoyuan, Chuxi Chen, Yunxuan He, Wenhao Mai, Shipeng Ruan, Yunshan Ning, and Yan Li. 2023. "Notch Signaling Regulates the Function and Phenotype of Dendritic Cells in Helicobacter pylori Infection" Microorganisms 11, no. 11: 2818. https://doi.org/10.3390/microorganisms11112818
APA StyleLiu, Q., Chen, C., He, Y., Mai, W., Ruan, S., Ning, Y., & Li, Y. (2023). Notch Signaling Regulates the Function and Phenotype of Dendritic Cells in Helicobacter pylori Infection. Microorganisms, 11(11), 2818. https://doi.org/10.3390/microorganisms11112818
