The Connection between MiR-122 and Lymphocytes in Patients Receiving Treatment for Chronic Hepatitis B Virus Infection
Abstract
1. Introduction
2. Materials and Methods
2.1. The Article’s Main Parts
2.2. MicroRNAs Related to Treatment in Chronic HBV Patients
2.3. MicroRNAs Involved in the Response to HBV Treatment—A Bioinformatic Approach
2.4. The Known Effect of NUC or pegIFN over Lymphocytes in Chronic HBV Patients
2.5. The Patient Selection Strategy
2.6. The Biochemical and Hemathological Parameter Acquisition
2.7. The Detection Method of miR-122
2.8. The Methods Used for Statistical Analysis
3. Results
3.1. A Systematic Review of the microRNA’s Involvement in the Response to HBV Treatment
3.2. Bioinformatic Analysis Based on the Findings of the First Systematic Review
3.3. A Systematic Review of Lymphocytes Affected by Antiviral Treatment in Chronic HBV Patients
3.4. The Final Study—The Comparison between the Two Main Lots of Treated and Untreated Patients
3.5. Univariate and Multivariate Logistic Analyses Performed on Treated and Untreated Patients
3.6. The Expression of MiR-122
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- World Hepatitis Day 2023. Key Messages. Available online: https://www.who.int/campaigns/world-hepatitis-day/2023/key-messages (accessed on 29 July 2023).
- World Hepatitis Day 2023: Need to scale up efforts to address hepatitis B and C. Available online: https://www.ecdc.europa.eu/en/news-events/world-hepatitis-day-2023-need-scale-efforts-address-hepatitis-b-and-c (accessed on 29 July 2023).
- Centers for Disease Control and Prevention. Reduce Reported Rate of Hepatitis B-Related Deaths by 20% or More. Available online: https://www.cdc.gov/hepatitis/policy/npr/2023/NationalProgressReport-HepB-ReduceDeaths.htm (accessed on 22 September 2023).
- Viral Hepatitis: A Significant Threat to Health Worldwide. Available online: https://easl.eu/news/whd2023 (accessed on 29 July 2023).
- Sausen, D.G.; Shechter, O.; Bietsch, W.; Shi, Z.; Miller, S.M.; Gallo, E.S.; Dahari, H.; Borenstein, R. Hepatitis, B.; Hepatitis, D. Viruses: A Comprehensive Update with an Immunological Focus. Int. J. Mol. Sci. 2022, 23, 15973. [Google Scholar] [CrossRef]
- Nevola, R.; Beccia, D.; Rosato, V.; Ruocco, R.; Mastrocinque, D.; Villani, A.; Perillo, P.; Imbriani, S.; Delle Femine, A.; Criscuolo, L.; et al. HBV Infection and Host Interactions: The Role in Viral Persistence and Oncogenesis. Int. J. Mol. Sci. 2023, 24, 7651. [Google Scholar] [CrossRef] [PubMed]
- Schollmeier, A.; Glitscher, M.; Hildt, E. Relevance of HBx for Hepatitis B Virus-Associated Pathogenesis. Int. J. Mol. Sci. 2023, 24, 4964. [Google Scholar] [CrossRef] [PubMed]
- Shah, N.; Nelson, J.E.; Kowdley, K.V. MicroRNAs in Liver Disease: Bench to Bedside. J. Clin. Exp. Hepatol. 2013, 3, 231–242. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zhang, X.; Hou, J.; Lu, M. Regulation of Hepatitis B Virus Replication by Epigenetic Mechanisms and MicroRNAs. Front. Genet. 2013, 4, 202. [Google Scholar] [CrossRef]
- Balmasova, I.P.; Yushchuk, N.D.; Mynbaev, O.A.; Alla, N.R.; Malova, E.S.; Shi, Z.; Gao, C.-L. Immunopathogenesis of Chronic Hepatitis B. World J. Gastroenterol. 2014, 20, 14156–14171. [Google Scholar] [CrossRef]
- Yim, H.J.; Kim, J.H.; Park, J.Y.; Yoon, E.L.; Park, H.; Kwon, J.H.; Sinn, D.H.; Lee, S.H.; Lee, J.-H.; Lee, H.W. Comparison of Clinical Practice Guidelines for the Management of Chronic Hepatitis B: When to Start, When to Change, and When to Stop. Clin. Mol. Hepatol. 2020, 26, 411–429. [Google Scholar] [CrossRef]
- Fiorino, S.; Bacchi-Reggiani, M.L.; Visani, M.; Acquaviva, G.; Fornelli, A.; Masetti, M.; Tura, A.; Grizzi, F.; Zanello, M.; Mastrangelo, L.; et al. MicroRNAs as Possible Biomarkers for Diagnosis and Prognosis of Hepatitis B- and C-Related-Hepatocellular-Carcinoma. World J. Gastroenterol. 2016, 22, 3907–3936. [Google Scholar] [CrossRef]
- Lak, R.; Yaghobi, R.; Garshasbi, M. Importance of MiR-125a-5p and MiR-122-5p Expression in Patients with HBV Infection. Cell. Mol. Biol. 2020, 66, 1–8. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, Z.; Dai, F.; Shi, B.; Chen, L.; Zhang, X.; Zang, G.; Zhang, J.; Chen, X.; Qian, F.; et al. Comparison of Circulating, Hepatocyte Specific Messenger RNA and MicroRNA as Biomarkers for Chronic Hepatitis B and C. PLoS ONE 2014, 9, e92112. [Google Scholar] [CrossRef]
- Mahmoudian-Sani, M.R.; Asgharzade, S.; Alghasi, A.; Saeedi-Boroujeni, A.; Sadati, S.J.A.; Moradi, M.T. MicroRNA-122 in Patients with Hepatitis B and Hepatitis B Virus-Associated Hepatocellular Carcinoma. J. Gastrointest. Oncol. 2019, 10, 789–796. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.-F.; Li, N.; Lin, D.-D.; Sun, L.-B. Circulating MicroRNA-122 for the Diagnosis of Hepatocellular Carcinoma: A Meta-Analysis. Biomed. Res. Int. 2020, 2020, 5353695. [Google Scholar] [CrossRef] [PubMed]
- Duraisamy, G.S.; Bhosale, D.; Lipenská, I.; Huvarova, I.; Růžek, D.; Windisch, M.P.; Miller, A.D. Advanced Therapeutics, Vaccinations, and Precision Medicine in the Treatment and Management of Chronic Hepatitis B Viral Infections; Where Are We and Where Are We Going? Viruses 2020, 12, 998. [Google Scholar] [CrossRef] [PubMed]
- Lampertico, P.; Agarwal, K.; Berg, T.; Buti, M.; Janssen, H.L.A.; Papatheodoridis, G.; Zoulim, F.; Tacke, F. EASL 2017 Clinical Practice Guidelines on the Management of Hepatitis B Virus Infection. J. Hepatol. 2017, 67, 370–398. [Google Scholar] [CrossRef] [PubMed]
- Terrault, N.A.; Lok, A.S.F.; McMahon, B.J.; Chang, K.-M.; Hwang, J.P.; Jonas, M.M.; Brown, R.S.J.; Bzowej, N.H.; Wong, J.B. Update on Prevention, Diagnosis, and Treatment of Chronic Hepatitis B: AASLD 2018 Hepatitis B Guidance. Hepatology 2018, 67, 1560. [Google Scholar] [CrossRef]
- Zhu, M.; Wang, H.; Lou, T.; Xiong, P.; Zhang, J.; Li, L.; Sun, Y.; Wu, Y. Current Treatment of Chronic Hepatitis B: Clinical Aspects and Future Directions. Front. Microbiol. 2022, 13, 975584. [Google Scholar] [CrossRef]
- Chien, R.-N.; Liaw, Y.-F. Current Trend in Antiviral Therapy for Chronic Hepatitis B. Viruses 2022, 14, 434. [Google Scholar] [CrossRef]
- Huang, D.Q.; Lee, D.H.; Le, M.H.; Le, A.; Yeo, Y.H.; Trinh, H.N.; Chung, M.; Nguyen, V.; Johnson, T.; Zhang, J.Q.; et al. Liver Complications in Untreated Treatment-Ineligible versus Treated Treatment-Eligible Patients with Hepatitis B. Dig. Dis. 2023, 41, 115–123. [Google Scholar] [CrossRef]
- Song, A.; Lin, X.; Chen, X. Functional Cure for Chronic Hepatitis B: Accessibility, Durability, and Prognosis. Virol. J. 2021, 18, 114. [Google Scholar] [CrossRef]
- Wang, D.; Fu, B.; Wei, H. Advances in Immunotherapy for Hepatitis B. Pathogens 2022, 11, 1116. [Google Scholar] [CrossRef]
- Ghenea, A.E.; Pădureanu, V.; Cioboată, R.; Udriștoiu, A.-L.; Drocaş, A.I.; Țieranu, E.; Carsote, M.; Vasile, C.M.; Moroşanu, A.; Biciușcă, V.; et al. The Study of Clinical and Biochemical Parameters in Assessing the Response to the Antiviral Therapy in the Chronic Viral Hepatitis B. Medicina 2021, 57, 757. [Google Scholar] [CrossRef]
- Nakamura, M.; Kanda, T.; Jiang, X.; Haga, Y.; Takahashi, K.; Wu, S.; Yasui, S.; Nakamoto, S.; Yokosuka, O. Serum MicroRNA-122 and Wisteria Floribunda Agglutinin-Positive Mac-2 Binding Protein Are Useful Tools for Liquid Biopsy of the Patients with Hepatitis B Virus and Advanced Liver Fibrosis. PLoS ONE 2017, 12, e0177302. [Google Scholar] [CrossRef] [PubMed]
- Loukachov, V.V.; van Dort, K.A.; Maurer, I.; Takkenberg, R.B.; de Niet, A.; Reesink, H.W.; Willemse, S.B.; Kootstra, N.A. Identification of Liver and Plasma MicroRNAs in Chronic Hepatitis B Virus Infection. Front. Cell. Infect. Microbiol. 2022, 12, 790964. [Google Scholar] [CrossRef]
- Sonneveld, M.J.; Chiu, S.-M.; Park, J.Y.; Brakenhoff, S.M.; Kaewdech, A.; Seto, W.-K.; Tanaka, Y.; Carey, I.; Papatheodoridi, M.; van Bömmel, F.; et al. Probability of HBsAg Loss after Nucleo(s)Tide Analogue Withdrawal Depends on HBV Genotype and Viral Antigen Levels. J. Hepatol. 2022, 76, 1042–1050. [Google Scholar] [CrossRef]
- Sultana, C.; Casian, M.; Oprea, C.; Ianache, I.; Grancea, C.; Chiriac, D.; Ruta, S. Hepatitis B Virus Genotypes and Antiviral Resistance Mutations in Romanian HIV-HBV Co-Infected Patients. Medicina 2022, 58, 531. [Google Scholar] [CrossRef] [PubMed]
- Bello, K.E.; Mat Jusoh, T.N.A.; Irekeola, A.A.; Abu, N.; Mohd Amin, N.A.Z.; Mustaffa, N.; Shueb, R.H. A Recent Prevalence of Hepatitis B Virus (HBV) Genotypes and Subtypes in Asia: A Systematic Review and Meta-Analysis. Healthcare 2023, 11, 1011. [Google Scholar] [CrossRef] [PubMed]
- ZOTERO. Available online: http://www.zotero.org (accessed on 23 February 2023).
- Page, M.J.; McKenzie, J.E.; Bossuyt, P.M.; Boutron, I.; Hoffmann, T.C.; Mulrow, C.D.; Shamseer, L.; Tetzlaff, J.M.; Akl, E.A.; Brennan, S.E.; et al. The PRISMA 2020 statement: An updated guideline for reporting systematic reviews. BMJ 2021, 372, 71. [Google Scholar] [CrossRef]
- Wells, G.A.; Shea, B.; O’Connell, D.; Pereson, J.; Welch, V.; Losos, M.; Tugwell, P. The Newcastle-Ottawa Scale (NOS) for Assessing the Quality of Nonrandomised Studies in Meta-Analysis. Available online: https://www.ohri.ca/programs/clinical_epidemiology/oxford.asp (accessed on 16 August 2023).
- Licursi, V.; Conte, F.; Fiscon, G.; Paci, P. MIENTURNET: An Interactive Web Tool for microRNA-Target Enrichment and Network-Based Analysis. BMC Bioinform. 2019, 20, 545. [Google Scholar] [CrossRef]
- STRING: Functional Protein Association Networks. Available online: https://string-db.org (accessed on 1 August 2023).
- Martin, F.J.; Amode, M.R.; Aneja, A.; Austine-Orimoloye, O.; Azov, A.G.; Barnes, I.; Becker, A.; Bennett, R.; Berry, A.; Bhai, J.; et al. Ensembl 2023. Nucleic Acid Res. 2023, 51, D933–D941. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, Q.; Huang, H.; Huang, W.; Chen, Y.; McGarvey, P.B.; Wu, C.H.; Arighi, C.N. UniProt Consortium. A crowdsourcing open platform for literature curation in UniProt. PLoS Biol. 2021, 19, e3001464. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2022; Available online: https://www.R-project.org/ (accessed on 5 March 2023).
- Fujita, K.; Mimura, S.; Iwama, H.; Nakahara, M.; Oura, K.; Tadokoro, T.; Nomura, T.; Tani, J.; Yoneyama, H.; Morishita, A.; et al. Serum MiRNAs Predicting Sustained HBs Antigen Reduction 48 Weeks after Pegylated Interferon Therapy in HBe Antigen-Negative Patients. Int. J. Mol. Sci. 2018, 19, 1940. [Google Scholar] [CrossRef] [PubMed]
- Nagura, Y.; Matsuura, K.; Iio, E.; Fujita, K.; Inoue, T.; Matsumoto, A.; Tanaka, E.; Nishiguchi, S.; Kang, J.-H.; Matsui, T.; et al. Serum MiR-192-5p Levels Predict the Efficacy of Pegylated Interferon Therapy for Chronic Hepatitis B. PLoS ONE 2022, 17, e0263844. [Google Scholar] [CrossRef] [PubMed]
- Tan, B.; Liu, M.; Wang, L.; Wang, J.; Xiong, F.; Bao, X.; Gao, Y.; Yu, L.; Lu, J. Serum MicroRNAs Predict Response of Patients with Chronic Hepatitis B to Antiviral Therapy. Int. J. Infect. Dis. 2021, 108, 37–44. [Google Scholar] [CrossRef]
- Ouyang, Y.; Fu, X.; Peng, S.; Tan, D.; Fu, L. Plasma MiR-146a Predicts Serological Conversion of Hepatitis B e-Antigen (HBeAg) in Chronic Hepatitis B Patients Treated with Nucleotide Analogs. Ann. Transl. Med. 2019, 7, 449. [Google Scholar] [CrossRef] [PubMed]
- van der Ree, M.H.; Jansen, L.; Kruize, Z.; van Nuenen, A.C.; van Dort, K.A.; Takkenberg, R.B.; Reesink, H.W.; Kootstra, N.A. Plasma MicroRNA Levels Are Associated with Hepatitis B e Antigen Status and Treatment Response in Chronic Hepatitis B Patients. J. Infect. Dis. 2017, 215, 1421–1429. [Google Scholar] [CrossRef]
- Li, J.; Zhang, X.; Chen, L.; Zhang, Z.; Zhang, J.; Wang, W.; Wu, M.; Shi, B.; Zhang, X.; Kozlowski, M.; et al. Circulating MiR-210 and MiR-22 Combined with ALT Predict the Virological Response to Interferon-Alpha Therapy of CHB Patients. Sci. Rep. 2017, 7, 15658. [Google Scholar] [CrossRef]
- Gillespie, M.; Jassal, B.; Stephan, R.; Milacic, M.; Rothfels, K.; Senff-Ribeiro, A.; Griss, J.; Sevilla, C.; Matthews, L.; Gong, C.; et al. The reactome pathway knowledgebase 2022. Nucleic Acids Res. 2022, 50, D687–D692. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef]
- Kanehisa, M. Toward understanding the origin and evolution of cellular organisms. Protein Sci. 2019, 28, 1947–1951. [Google Scholar] [CrossRef]
- Kanehisa, M.; Furumichi, M.; Sato, Y.; Kawashima, M.; Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 2023, 51, D587–D592. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef]
- The Gene Ontology Consortium. The Gene Ontology knowledgebase in 2023. Genetics 2023, 224, iyad031. [Google Scholar] [CrossRef] [PubMed]
- Martens, M.; Ammar, A.; Riutta, A.; Waagmeester, A.; Slenter, D.N.; Hanspers, K.; Miller, R.A.; Digles, D.; Lopes, E.N.; Ehrhart, F.; et al. WikiPathways: Connecting Communities. Nucleic Acids Res. 2021, 49, D613–D621. [Google Scholar] [CrossRef] [PubMed]
- Li, C.-Z.; Hu, J.-J.; Xue, J.-Y.; Yin, W.; Liu, Y.-Y.; Fan, W.-H.; Xu, H.; Liang, X.-S. Viral Infection Parameters Not Nucleoside Analogue Itself Correlates with Host Immunity in Nucleoside Analogue Therapy for Chronic Hepatitis B. World J. Gastroenterol. 2014, 20, 9486–9496. [Google Scholar] [CrossRef] [PubMed]
- Zhao, P.-W.; Ma, L.; Ji, H.-F.; Yu, L.; Feng, J.-Y.; Wang, J.; Liu, M.-Y.; Jiang, Y.-F. The Expression of TLR-9, CD86, and CD95 Phenotypes in Circulating B Cells of Patients with Chronic Viral Hepatitis B or C before and after Antiviral Therapy. Mediat. Inflamm. 2015, 2015, 762709. [Google Scholar] [CrossRef]
- Cao, W.; Li, M.; Zhang, L.; Lu, Y.; Wu, S.; Shen, G.; Chang, M.; Liu, R.; Gao, Y.; Hao, H.; et al. The Characteristics of Natural Killer Cells in Chronic Hepatitis B Patients Who Received PEGylated-Interferon versus Entecavir Therapy. Biomed. Res. Int. 2021, 2021, 2178143. [Google Scholar] [CrossRef]
- Yang, X.; Li, J.; Liu, J.; Gao, M.; Zhou, L.; Lu, W. Relationship of Treg/Th17 Balance with HBeAg Change in HBeAg-Positive Chronic Hepatitis B Patients Receiving Telbivudine Antiviral Treatment: A Longitudinal Observational Study. Medicine 2017, 96, e7064. [Google Scholar] [CrossRef]
- Shen, X.; Fu, B.; Liu, Y.; Guo, C.; Ye, Y.; Sun, R.; Li, J.; Tian, Z.; Wei, H. NKp30+ NK Cells Are Associated with HBV Control during Pegylated-Interferon-Alpha-2b Therapy of Chronic Hepatitis B. Sci. Rep. 2016, 6, 38778. [Google Scholar] [CrossRef]
- Chen, T.; Zhu, L.; Shi, A.; Ding, L.; Zhang, X.; Tan, Z.; Guo, W.; Yan, W.; Han, M.; Jia, J.; et al. Functional Restoration of CD56bright NK Cells Facilitates Immune Control via IL-15 and NKG2D in Patients under Antiviral Treatment for Chronic Hepatitis B. Hepatol. Int. 2017, 11, 419–428. [Google Scholar] [CrossRef]
- Cao, W.; Lu, H.; Zhang, L.; Wang, S.; Deng, W.; Jiang, T.; Lin, Y.; Yang, L.; Bi, X.; Lu, Y.; et al. Functional Molecular Expression of Nature Killer Cells Correlated to HBsAg Clearance in HBeAg-Positive Chronic Hepatitis B Patients during PEG-IFN α-2a Therapy. Front. Immunol. 2022, 13, 1067362. [Google Scholar] [CrossRef]
- Lin, Y.; Shen, G.; Xie, S.; Bi, X.; Lu, H.; Yang, L.; Jiang, T.; Deng, W.; Wang, S.; Zhang, L.; et al. Dynamic Changes of the Proportion of HLA-DR and CD38 Coexpression Subsets on T Lymphocytes during IFN-Based Chronic Hepatitis B Treatment. Front. Immunol. 2023, 13, 1116160. [Google Scholar] [CrossRef]
- Pang, X.; Zhang, L.; Liu, N.; Liu, B.; Chen, Z.; Li, H.; Chen, M.; Peng, M.; Ren, H.; Hu, P. Combination of Pegylated Interferon-Alpha and Nucleos(t)Ide Analogue Treatment Enhances the Activity of Natural Killer Cells in Nucleos(t)Ide Analogue Experienced Chronic Hepatitis B Patients. Clin. Exp. Immunol. 2020, 202, 80–92. [Google Scholar] [CrossRef]
- Liu, R.; Chen, Y.; Guo, J.; Li, M.; Lu, Y.; Zhang, L.; Shen, G.; Wu, S.; Chang, M.; Hu, L.; et al. The Reduction in CD8+PD-1+ T Cells in Liver Histological Tissue Is Related to Pegylated IFN-α Therapy Outcomes in Chronic Hepatitis B Patients. BMC Infect. Dis. 2020, 20, 590. [Google Scholar] [CrossRef]
- Ho, P.T.B.; Clark, I.M.; Le, L.T.T. MicroRNA-Based Diagnosis and Therapy. Int. J. Mol. Sci. 2022, 23, 7167. [Google Scholar] [CrossRef] [PubMed]
- Ostrycharz, E.; Hukowska-Szematowicz, B. Micro-Players of Great Significance—Host MicroRNA Signature in Viral Infections in Humans and Animals. Int. J. Mol. Sci. 2022, 23, 10536. [Google Scholar] [CrossRef]
- Chen, Y.; Tian, Z. HBV-Induced Immune Imbalance in the Development of HCC. Front. Immunol. 2019, 10, 2048. [Google Scholar] [CrossRef]
- Megahed, F.A.K.; Zhou, X.; Sun, P. The Interactions between HBV and the Innate Immunity of Hepatocytes. Viruses 2020, 12, 285. [Google Scholar] [CrossRef] [PubMed]
- Meng, Z.; Chen, Y.; Lu, M. Advances in Targeting the Innate and Adaptive Immune Systems to Cure Chronic Hepatitis B Virus Infection. Front. Immunol. 2019, 10, 3127. [Google Scholar] [CrossRef]
- Zheng, J.-R.; Wang, Z.-L.; Feng, B. Hepatitis B Functional Cure and Immune Response. Front. Immunol. 2022, 13, 1075916. [Google Scholar] [CrossRef] [PubMed]
- Çetin, G.; Klafack, S.; Studencka-Turski, M.; Krüger, E.; Ebstein, F. The Ubiquitin-Proteasome System in Immune Cells. Biomolecules 2021, 11, 60. [Google Scholar] [CrossRef]
- Sijts, E.J.A.M.; Kloetzel, P.M. The Role of the Proteasome in the Generation of MHC Class I Ligands and Immune Responses. Cell. Mol. Life Sci. 2011, 68, 1491–1502. [Google Scholar] [CrossRef] [PubMed]
- Stopak, K.S.; Chiu, Y.-L.; Kropp, J.; Grant, R.M.; Greene, W.C. Distinct Patterns of Cytokine Regulation of APOBEC3G Expression and Activity in Primary Lymphocytes, Macrophages, and Dendritic Cells. J. Biol. Chem. 2007, 282, 3539–3546. [Google Scholar] [CrossRef]
- Baudi, I.; Kawashima, K.; Isogawa, M. HBV-Specific CD8+ T-Cell Tolerance in the Liver. Front. Immunol. 2021, 12, 721975. [Google Scholar] [CrossRef] [PubMed]
- Kern, D.; Regl, G.; Hofbauer, S.W.; Altenhofer, P.; Achatz, G.; Dlugosz, A.; Schnidar, H.; Greil, R.; Hartmann, T.N.; Aberger, F. Hedgehog/GLI and PI3K Signaling in the Initiation and Maintenance of Chronic Lymphocytic Leukemia. Oncogene 2015, 34, 5341–5351. [Google Scholar] [CrossRef] [PubMed]
- Li, T.-Y.; Yang, Y.; Zhou, G.; Tu, Z.-K. Immune Suppression in Chronic Hepatitis B Infection Associated Liver Disease: A Review. World J. Gastroenterol. 2019, 25, 3527–3537. [Google Scholar] [CrossRef]
- Guldenpfennig, C.; Teixeiro, E.; Daniels, M. NF-KB’s Contribution to B Cell Fate Decisions. Front. Immunol. 2023, 14, 1214095. [Google Scholar] [CrossRef]
- Chuang, H.-C.; Tan, T.-H. MAP4K Family Kinases and DUSP Family Phosphatases in T-Cell Signaling and Systemic Lupus Erythematosus. Cells 2019, 8, 1433. [Google Scholar] [CrossRef]
- Sun, F.; Yue, T.-T.; Yang, C.-L.; Wang, F.-X.; Luo, J.-H.; Rong, S.-J.; Zhang, M.; Guo, Y.; Xiong, F.; Wang, C.-Y. The MAPK Dual Specific Phosphatase (DUSP) Proteins: A Versatile Wrestler in T Cell Functionality. Int. Immunopharmacol. 2021, 98, 107906. [Google Scholar] [CrossRef]
- Thakker, P.; Ariana, A.; Hajjar, S.; Cai, D.; Rijal, D.; Sad, S. XIAP Promotes the Expansion and Limits the Contraction of CD8 T Cell Response through Cell Extrinsic and Intrinsic Mechanisms Respectively. PLoS Pathog. 2023, 19, e1011455. [Google Scholar] [CrossRef]
- Nayak, R.C.; Hegde, S.; Althoff, M.J.; Wellendorf, A.M.; Mohmoud, F.; Perentesis, J.; Reina-Campos, M.; Reynaud, D.; Zheng, Y.; Diaz-Meco, M.T.; et al. The Signaling Axis Atypical Protein Kinase C λ/ι-Satb2 Mediates Leukemic Transformation of B-Cell Progenitors. Nat. Commun. 2019, 10, 46. [Google Scholar] [CrossRef]
- Elliott, D.E.; Li, J.; Blum, A.M.; Metwali, A.; Patel, Y.C.; Weinstock, J.V. SSTR2A Is the Dominant Somatostatin Receptor Subtype Expressed by Inflammatory Cells, Is Widely Expressed and Directly Regulates T Cell IFN-Gamma Release. Eur. J. Immunol. 1999, 29, 2454–2463. [Google Scholar] [CrossRef]
- Talme, T.; Ivanoff, J.; Hägglund, M.; Van Neerven, R.J.; Ivanoff, A.; Sundqvist, K.G. Somatostatin Receptor (SSTR) Expression and Function in Normal and Leukaemic T-Cells. Evidence for Selective Effects on Adhesion to Extracellular Matrix Components via SSTR2 and/or 3. Clin. Exp. Immunol. 2001, 125, 71–79. [Google Scholar] [CrossRef] [PubMed]





| Assay | Assay ID/Catalog Number | Mature miRNA Sequence | Chromosome Location |
|---|---|---|---|
| hsa-miR-21 | 000397/4427975 | UAGCUUAUCAGACUGAUGUUGA | Chr.17 |
| hsa-miR-122 | 002245/4427975 | UGGAGUGUGACAAUGGUGUUUG | Chr.18 |
| First Author; Reference | Year | Study Location | Study Design | Sample Size | Detection Method for microRNA | Expression of microRNA | Treatment | Moment When the Outcome Was First Observed (from the Beginning of Study) | NOS * |
|---|---|---|---|---|---|---|---|---|---|
| Fujita, K. [39] | 2018 | Japan | Cohort and cell-culture | 6 treatment responders versus 16 nonresponders (treatment responders had a 1-log decrease in the level of HBsAg as compared to baseline) | Microarray, RT-PCR * | MiR-6126-higher in responder’s sera | PegIFN+/−NUC | Week 24 | 9 |
| Nagura, Y. [40] | 2022 | Japan | Cohort | 12 treatment responders versus 49 nonresponders (treatment response was established based on ALT < 31 U/L, HBV-DNA < 2000 IU/mL, on the absence of NUCs till week 48, and on the absence of HBeAg) | RT-PCR * | MiR-192-5p-lower in responder’s sera | PegIFN | Baseline (under no treatment) | 7 |
| Tan, B. [41] | 2021 | China | Cohort | 18 treatment responders versus 18 nonresponders (treatment response was based on the absence of HBeAg) | Sequencing | MiR-122-5p- lower in responder’s sera; MiR-1307-3p, miR-320a-3p, miR-320c-higher in responder’s sera | Entecavir+ PegIFN | Baseline (under no treatment) for miR-122-5p and miR-1307-3p; Week 48 for miR-320a-3p and miR-320c | 8 |
| Ouyang, Y. [42] | 2019 | China | Cohort | 28 treatment responders versus 87 nonresponders (treatment response was based on the absence of HBeAg) | RT-PCR * | MiR-146a-lower in responder’s plasma | NUCs | Baseline (under no treatment) | 7 |
| van der Ree, M.H. [43] | 2021 | Netherlands | Cohort and cell culture | 14 treatment responders versus 27 nonresponders (treatment response was based on the absence of HBeAg, normal ALT levels, and HBV-DNA < 2000 IU/mL) | RT-PCR * | MiR-301-3p-higher in responder’s plasma | PegIFN +NUCs | Baseline (under no treatment) | 7 |
| Li, J. [44] | 2017 | China | Cohort | 56 treatment responders versus 56 nonresponders (treatment response was based on an early decrease by 2 log10 of the HBV-DNA, and then sustained with a viremia less than 2000 IU/mL and the absence of HBeAg) | RT-PCR * | MiR-22 and miR-210-higher in responder’s plasma | Interferon based | Baseline (under no treatment) | 6 |
| First Author; Reference | Year | Study Location | Study Design | Sample Size | Detection Method for Lymphocytes | Outcome (Treatment Effect on Lymphocytes) | Treatment | Moment When the Outcome Was First Observed (from the Beginning of Study) | NOS |
|---|---|---|---|---|---|---|---|---|---|
| Li, C.-Z. [52] | 2014 | China | Case control | 14 healthy controls versus 52 HBV patients with chronic hepatitis, divided in 2 equal groups (one group of lamivudine treated subjects and another one of telbivudine treated subjects) | Flow Cytometry | A decrease in time of the number of PD-1 CD8+ T cells and of T regulatory cells | NUCs * | Week 12 | 8 |
| Zhao, P.-W. [53] | 2015 | China | Case control | 17 healthy subjects versus 15 patients with chronic HBV infection, treated with adefovir dipidoxil | Flow Cytometry | An increase in time in the number of CD 95+ B cells | NUCs * | Week 12 | 8 |
| Cao, W. [54] | 2021 | China | Cohort | 89 patients with chronic hepatitis B (49 subjects treated with pegIFN versus 40 subjects treated with Entecavir- both groups were divided in treatment responders versus nonresponders; responders were established at 48 weeks among those with a decrease in HBsAg of >60% in the pegIFN group, and those with an undetectable level of HBV-DNA in the Entecavir group) | Flow Cytometry | An increase in time in the frequency of NK * cells in both pegIFN and Entecavir groups; The NK * cell frequency was increased both in the responder group of pegIFN treated subjects, and in the nonresponder group of Entecavir subjects. | Entecavir/pegIFN | Week 12 | 7 |
| Yang, X. [55] | 2017 | China | Case control | 12 healthy controls versus 27 chronic hepatitis B patients, treated with lamivudine | Flow Cytometry | A decrease in time in the number of T cells | NUCs * | Week 8 | 7 |
| Shen, X. [56] | 2016 | China | Cohort | 92 patients with chronic hepatitis B, treated with pegIFN or pegIFN+ adefovir dipivoxil (they were separated in 2 groups—17 responders versus 75 nonresponders; treatment response was established at the end of the follow-up, and it was defined as the loss of HBeAg and HBV-DNA < 2000 IU/mL) | Flow Cytometry | An increase in time in the NK * cell number in responders versus nonresponders | pegIFN+/− NUCs | Week 12 | 9 |
| Chen, T. [57] | 2017 | China | Cohort | 52 patients with chronic hepatitis B (divided in several groups with different ALT, HBV-DNA values, or with HBeAg present or absent) | Flow cytometry | An increase in NKG2D+ CD56bright NK * cells in patients with HBeAg seroconversion at 36 weeks; the percentage of NK * cells was increased in subjects with high levels of HBV-DNA at 12 weeks | NUCs * | Week 12 for the difference in the NK * cells’ percentage; week 36 for the increase in NKG2D+ CD56bright NK * cells | 8 |
| Cao, W. [58] | 2022 | China | Cohort | 66 patients with chronic hepatitis B (divided in 2 groups: 17 subjects achieved functional cure and 49 patients were included in a nonfunctional cure category; the follow-up was then performed on 14 patients, and on 40 subjects; functional cure was defined as the absence of HBsAg and HBeAg, together with the undetectable level of HBV-DNA) | Flow cytometry | An increase in the percentage of CD56bright NK * cells/NK * cells in patients with functional cure | pegIFN+/− NUCs * | Week 12 | 7 |
| Lin, Y. [59] | 2023 | China | Cohort | 34 patients treated only with pegIFN; 10 patients treated with pegIFN and NUCs *, and 15 patients with intermittent pegIFN treatment | Flow cytometry | An increase in time in the HLA-DR+ CD 38hi T lymphocytes in long term treatment with pegIFN | pegIFN+/− NUCs * | Week 12 | 8 |
| Pang, X. [60] | 2020 | China | Cohort | 40 patients (divided in 2 groups—33 subjects treated with NUCs *, and 7 subjects treated with pegIFN+ NUCs *) | Flow cytometry | A persistent decrease in the number of CD56dim NK * cells in patients treated with pegIFN and NUCs *; a persistent increase in the number of CD56brightNK * cells in patients treated with pegIFN and NUCs | NUCs *+/− pegIFN | Week 24 | 9 |
| Liu, R. [61] | 2020 | China | Cohort | 32 patients with chronic hepatitis B (divided into several groups based on their inflammation–fibrosis scores on liver histology) | IHC * staining | A decrease in CD8+ T lymphocytes in the persistent fibrosis-inflammation group | pegIFN | Week 24 | 9 |
| Variable | Total (n = 38) | Receiving Treatment (n = 20) | Not Receiving Treatment (n = 18) | p-Value ** |
|---|---|---|---|---|
| Age (years) | 38.5 [32.2, 53] | 36.5 [32.8, 57.8] | 40.5 [32.5, 52] | 0.988 |
| Sex—female (%) | 16 (42.1) | 7 (35) | 9 (50) | 0.544 |
| ALT * (U/L) | 26.5 [21.2, 41.5] | 27 [23.5, 47.2] | 26.5 [21, 37] | 0.715 |
| AST * (U/L) | 25.5 [23, 35] | 28.5 [22.8, 36] | 25 [23, 26.8] | 0.319 |
| Total Bilirubin (mg/dL) | 0.6 [0.5, 0.8] | 0.6 [0.6, 0.8] | 0.6 [0.5, 0.8] | 0.767 |
| PT * (seconds) | 14 [13.2, 14.7] | 14.2 [13.6, 14.9] | 13.6 [13, 14.7] | 0.224 |
| Leucocyte count (×103 µL) | 7.1 [5.9, 8.4] | 6.3 [5.8, 7.6] | 7.6 [6.4, 9.6] | 0.067 |
| Lymphocyte count (×103 µL) | 2.2 [1.7, 2.4] | 1.9 [1.6, 2.2] | 2.3 [1.9, 2.5] | 0.023 |
| Platelet count (×103 µL) | 262 [215, 307.5] | 224 [204.8, 271.5] | 298.5 [260.8, 328.8] | 0.005 |
| HBV-DNA (IU/mL) | 2514 [326, 14,323.8] | 1635 [66.8, 7932.8] | 4228 [2045, 17,826.2] | 0.128 |
| Variables | OR * | 95% CI * | p-Value ** |
|---|---|---|---|
| Age (years) | 1 | 0.96, 1.05 | >0.9 |
| Sex—male (%) | 1.86 | 0.51, 7.07 | 0.4 |
| ALT * (U/L) | 1 | 0.99, 1 | 0.7 |
| AST * (U/L) | 1 | 0.99, 1.01 | 0.7 |
| Total Bilirubin (mg/dL) | 0.89 | 0.47, 1.25 | 0.5 |
| PT * (seconds) | 1.43 | 0.86, 2.58 | 0.2 |
| Leucocyte count (×103 µL) | 0.73 | 0.5, 1 | 0.068 |
| Lymphocyte count (×103 µL) | 0.16 | 0.03, 0.63 | 0.02 |
| Platelet count (×103 µL) | 0.99 | 0.98, 1 | 0.075 |
| HBV-DNA (IU/mL) | 1 | 1, 1 | 0.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Manea, M.; Apostol, D.; Constantinescu, I. The Connection between MiR-122 and Lymphocytes in Patients Receiving Treatment for Chronic Hepatitis B Virus Infection. Microorganisms 2023, 11, 2731. https://doi.org/10.3390/microorganisms11112731
Manea M, Apostol D, Constantinescu I. The Connection between MiR-122 and Lymphocytes in Patients Receiving Treatment for Chronic Hepatitis B Virus Infection. Microorganisms. 2023; 11(11):2731. https://doi.org/10.3390/microorganisms11112731
Chicago/Turabian StyleManea, Marina, Dimitri Apostol, and Ileana Constantinescu. 2023. "The Connection between MiR-122 and Lymphocytes in Patients Receiving Treatment for Chronic Hepatitis B Virus Infection" Microorganisms 11, no. 11: 2731. https://doi.org/10.3390/microorganisms11112731
APA StyleManea, M., Apostol, D., & Constantinescu, I. (2023). The Connection between MiR-122 and Lymphocytes in Patients Receiving Treatment for Chronic Hepatitis B Virus Infection. Microorganisms, 11(11), 2731. https://doi.org/10.3390/microorganisms11112731

