Determination of IL-6 Gene Promoter Polymorphism in Patients with Hepatitis C and Its Impact on RNA Secondary Structure
Abstract
1. Introduction
2. Methods
2.1. Study Design and Location
2.2. Sampling Technique
2.3. Inclusion Criteria
2.4. Exclusion Criteria
2.5. DNA Extraction
2.6. Conventional PCR Method
2.6.1. Cycling Conditions: SNP-1363
| Holding stage | 95 °C | - 5 min | ||
| Denaturation | 95 °C | - 1 min | ![]() | |
| Annealing | 62 °C | - 45 s | 35 | |
| Extension | 72 °C | - 1 min | ||
| Final Extension | 72 °C | - 10 min | ||
| Hold | 4 °C | ~ |
2.6.2. Cycling Conditions: SNP-174
| Holding stage | 95 °C | - 5 min | ||
| Denaturation | 95 °C | - 1 min | ![]() | |
| Annealing | 57 °C | - 45 s | 35 | |
| Extension | 72 °C | - 1 min | ||
| Final Extension | 72 °C | - 10 min |
2.7. Measurement of Serum IL-6 by (CLIA)
2.8. Statistical Analysis
2.9. Bioinformatics Analysis
2.10. Prediction of RNA Secondary Structure
2.11. Annotation of Regulatory Elements
2.12. Prediction of Transcription Factor Binding Sites
3. Results
4. Discussion
5. Conclusions
6. Limitations of the Study
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Westbrook, R.H.; Dusheiko, G. Natural history of hepatitis C. J. Hepatol. 2014, 61, S58–S68. [Google Scholar] [CrossRef]
- Elgharably, A.; Gomaa, A.I.; Crossey, M.M.; Norsworthy, P.J.; Waked, I.; Taylor-Robinson, S.D. Hepatitis C in Egypt–past, present, and future. Int. J. Gen. Med. 2016, 10, 1–6. [Google Scholar] [CrossRef]
- Tambur, A.R.; Ortegel, J.W.; Ben-Ari, Z.; Shabtai, E.; Klein, T.; Michowiz, R.; Tur-Kaspa, R.; Mor, E.J.T. Role Of Cytokine Gene Polymorphism In Hepatitis C Recurrence And Allograft Rejection Among Liver Transplant Recipients 1. Transplantation 2001, 71, 1475–1480. [Google Scholar] [CrossRef]
- Cussigh, A.; Falleti, E.; Fabris, C.; Bitetto, D.; Cmet, S.; Fontanini, E.; Bignulin, S.; Fornasiere, E.; Fumolo, E.; Minisini, R.J.I. Interleukin 6 promoter polymorphisms influence the outcome of chronic hepatitis C. Immunogenetics 2011, 63, 33–41. [Google Scholar] [CrossRef]
- Ghatak, S.; Muthukumaran, R.B.; Nachimuthu, S.K. A simple method of genomic DNA extraction from human samples for PCR-RFLP analysis. J. Biomol. Tech. 2013, 24, 224–231. [Google Scholar] [CrossRef]
- Yu, H.; Zou, W.; Xin, S.; Wang, X.; Mi, C.; Dai, G.; Zhang, T.; Zhang, G.; Xie, K.; Wang, J.; et al. Association Analysis of Single Nucleotide Polymorphisms in the 5′ Regulatory Region of the IL-6 Gene with Eimeria Tenella Resistance in Jinghai Yellow Chickens. Genes 2019, 10, 890. [Google Scholar] [CrossRef]
- Ali, Y.; Moussa, S.G.; Shahen, S.M.; Dewir, M.A.; El-Sayed, I.H. Association between interleukin-6 gene polymorphism and iron regulation in hemodialysis patients infected with HCV. Braz. J. Nephrol. 2020, 42, 437–447. [Google Scholar] [CrossRef]
- Revelo, N.H.; ter Beest, M.; van den Bogaart, G. Membrane trafficking as an active regulator of constitutively secreted cytokines. J. Cell Sci. 2020, 133, jcs234781. [Google Scholar] [CrossRef] [PubMed]
- Carulli, L.; Canedi, I.; Rondinella, S.; Lombardini, S.; Ganazzi, D.; Fargion, S.; De Palma, M.; Lonardo, A.; Ricchi, M.; Bertolotti, M.; et al. Genetic polymorphisms in non-alcoholic fatty liver disease: Interleukin-6− 174G/C polymorphism is associated with non-alcoholic steatohepatitis. Dig. Liver Dis. 2009, 41, 823–828. [Google Scholar] [CrossRef] [PubMed]
- Falleti, E.; Fabris, C.; Vandelli, C.; Colletta, C.; Cussigh, A.; Smirne, C.; Fontanini, E.; Cmet, S.; Minisini, R.; Bitetto, D.; et al. Genetic polymorphisms of interleukin-6 modulate fibrosis progression in mild chronic hepatitis C. Hum. Immunol. 2010, 71, 999–1004. [Google Scholar] [CrossRef] [PubMed]
- Said, E.A.; Al-Reesi, I.; Al-Shizawi, N.; Jaju, S.; Al-Balushi, M.S.; Koh, C.Y.; Al-Jabri, A.A.; Jeyaseelan, L. Defining IL-6 levels in healthy individuals: A meta-analysis. J. Med. Virol. 2021, 93, 3915–3924. [Google Scholar] [CrossRef]
- Maya, A.A.E.; Alves, C.F.d.S.; Marangon, C.G.; Frizon, K.; Gorziza, R.P.; Lunge, V.R.; Simon, D. Influence of the IL6− 147C/G polymorphism on clinical characteristics of chronic hepatitis C in Brazilian patients. Gene Rep. 2017, 8, 75–78. [Google Scholar] [CrossRef]
- Adnan, F.; Khan, N.U.; Iqbal, A.; Ali, I.; Petruzziello, A.; Sabatino, R.; Guzzo, A.; Loquercio, G.; Botti, G.; Khan, S.; et al. Interleukin-6 polymorphisms in HCC patients chronically infected with HCV. Infect. Agents Cancer 2020, 15, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Abbas, D.; Hamdy, E.; Helal, M.M. Promoter region polymorphism (−174 G/C) of interleukin-6 gene and SLE; are they associated? Egypt. Rheumatol. 2011, 33, 69–75. [Google Scholar] [CrossRef]
- Hamed, R.M.R.; Mohamed, S.A.; Dwedar, R.A.; Elkholy, Y.S.; Elgengehy, F.T. Association of interleukin-6 and its-174G/C promoter polymorphism with clinical and laboratory characteristics of non hepatitis C virus rheumatoid arthritis patients. Egypt. J. Med. Hum. Genet. 2018, 19, 235–240. [Google Scholar] [CrossRef]
- Christen, U.; Hintermann, E. Pathogens and autoimmune hepatitis. Clin. Exp. Immunol. 2019, 195, 35–51. [Google Scholar] [CrossRef] [PubMed]
- Brull, D.; Montgomery, H.; Sanders, J.; Dhamrait, S.; Luong, L.; Rumley, A.; Lowe, G.; Humphries, S. Interleukin-6 gene− 174g> c and− 572g> c promoter polymorphisms are strong predictors of plasma interleukin-6 levels after coronary artery bypass surgery. Arterioscler. Thromb. Vasc. Biol. 2001, 21, 1458–1463. [Google Scholar] [CrossRef] [PubMed]
- Queiroz, M.A.F.; Santiago, A.M.; Moura, T.C.F.; Amoras, E.d.S.G.; Conde, S.R.S.d.S.; Cayres-Vallinoto, I.M.V.; Ishak, R.; Vallinoto, A.C.R. The IL6-174G/C Polymorphism Associated with High Levels of IL-6 Contributes to HCV Infection, but Is Not Related to HBV Infection, in the Amazon Region of Brazil. Viruses 2022, 14, 507. [Google Scholar] [CrossRef] [PubMed]
- Lorenz, R.; Bernhart, S.H.; Honer Zu Siederdissen, C.; Tafer, H.; Flamm, C.; Stadler, P.F.; Hofacker, I.L. ViennaRNA Package 2.0. Algorithms Mol. Biol. 2011, 6, 26. [Google Scholar] [CrossRef] [PubMed]
- Dong, S.; Boyle, A.P. Predicting functional variants in enhancer and promoter elements using RegulomeDB. Hum. Mutat. 2019, 40, 1292–1298. [Google Scholar] [CrossRef]
- Li, Z.; Gao, H.; Liu, Y.; Wu, H.; Li, W.; Xing, Y.; Zhang, Z.; Zhang, X. Genetic variants in the regulation region of TLR4 reduce the gastric cancer susceptibility. Gene 2021, 767, 145181. [Google Scholar] [CrossRef]
- Lin, G.; Zhang, Y. Mutations in the non-structural protein coding region regulate gene expression from replicon RNAs derived from Venezuelan equine encephalitis virus. Biotechnol. Lett. 2023, 45, 1029–1038. [Google Scholar] [CrossRef] [PubMed]
- Hurst, T.; Chen, S.-J. Deciphering nucleotide modification-induced structure and stability changes. RNA Biol. 2021, 18, 1920–1930. [Google Scholar] [CrossRef] [PubMed]
- Snyman, M.; Xu, S. The effects of mutations on gene expression and alternative splicing: A case study of EMS-induced heritable mutations in the microcrustacean Daphnia. Proc. R. Soc. B Biol. Sci. 2023, 290, 111–123. [Google Scholar] [CrossRef]
- Cheng, C.Y.; Kladwang, W.; Yesselman, J.D.; Das, R. RNA structure inference through chemical mapping after accidental or intentional mutations. Proc. Natl. Acad. Sci. USA 2017, 114, 9876–9881. [Google Scholar] [CrossRef]
- Sumantri, N.I.; Lischer, K.; Wijayanti, D.R.; Abuzairi, T. In silico study on RNA structures of intronic mutations of beta-globin gene. F1000Research 2020, 9, 49. [Google Scholar] [CrossRef]





| Outer forward 1 | CGCGGCAGAGGACCACCGTCT |
| Outer reverse 1 | TGAATCTGCTTCCGCGTCGGCA |
| Wild allele forward 1 | CAACAGAGGTCACTGTTTTATCG |
| Mutant allele reverse 1 | AAGAAGAGATCTCTTCAAGATA |
| Outer forward primer 2 | GAGGAAACTCAGTTCAGAA |
| Outer reverse primer 2 | ATGAGCCTCAGACATCTCCAGTC |
| Wild allele forward primer 2 | TTTCCCCCTAGTTGTGTCTTGCC |
| Mutant allele reverse primer 2 | ATGTGACGTCCTTTAGCATC |
| Locus | SNP Site | Genotype Distribution | Frequency | p Value ≤ 0.05 | ||
|---|---|---|---|---|---|---|
| IL-6 −174 | −174 | GG | GC | CC | 0.37 (0.31–0.43) | GG = 0.005 GC = 0.001 CC = 0.62 |
| 47 (36.5) | 76 (63) | 13 (10) | ||||
| IL-6 −1363 | −1363 | GG | GT | TT | 0.07 (0.04–0.10) | GG = 0.012 GT = 0.0052 TT = 0.765 |
| 31 (27) | 45 (32) | 3 (1.9) | ||||
| Parameters | Studied Groups | p Value ≤ 0.05 | |
|---|---|---|---|
| IL-6 −174(GG) | IL-6 −1363(GG) | ||
| Age | 46.72 ± (11.01) | 51.87 ± (13.01) | <0.001 ** |
| Male (middle-aged) | 67 ± (65.5) | 38 ± (34.07) | 0.734 |
| Female (middle-aged) | 31 ± (29.5) | 27 ± (23.98) | 0.005 * |
| TLC | 6.37 ± (3.20) | 6.55 ± (2.99) | 0.011 * |
| Haemoglobin | 14.07 ± (2.30) | 13.29 ± (3.45) | 0.519 |
| ALT | 54.0 ± (11.0) | 43.0 ± (12.76) | <0.002 * |
| AST | 56.20 ± (11.0) | 61.11 ± (11.2) | <0.005 * |
| AFP | 2.90 ± (1.30) | 2.41 ± (1.00) | <0.001 * |
| Alb | 4.34 ± (0.70) | 4.00 ± (0.89) | 0.001 * |
| Parameters | Controls | p Value ≤ 0.05 | |
|---|---|---|---|
| IL-6 −174(GG) | IL-6 −1363(GG) | ||
| Age | 29.84 ± (7.9) | 23.87 ± (9.01) | 0.561 |
| Male (middle-aged) | 47 (45.3) | 37 ± (18.07) | 0.698 |
| Female (middle-aged) | 51 (49.7) | 41 ± (28.67) | 0.311 |
| TLC | 5.60 (4.90–11.10) | 7.81 ± (3.75) | 0.217 |
| Haemoglobin | 12.18 ± 0.88 | 9.01 ± (4.87) | 0.487 |
| ALT | 21.0 (09.0–35.0) | 18.04 ± (11.01) | 0.435 |
| AST | 24.0 (11.0–38.0) | 21.00 ± (17.03) | 0.837 |
| AFP | 3.0 (0.94–8.5) | 2.05 ± (2.01) | 0.771 |
| Alb | 5.10 ± 0.29 | 3.99 ± (2.07) | 0.583 |
| Rs IDs | Rank | Score | Rank Interpretation |
|---|---|---|---|
| rs2069827 | 1f | 0.70823 | eQTL/caQTL + TF binding/chromatin accessibility peak |
| rs1800795 | 1f | 0.55436 | eQTL/caQTL + TF binding/chromatin accessibility peak |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sadiq, S.; Anwar, M.Z.; Shafique, H.; Manzoor, S.M.; Shoaib, S.; Hamid, R.; Hashmi, S.N.; Ashraf, N.M.; Afsar, T.; Bhat, M.A.; et al. Determination of IL-6 Gene Promoter Polymorphism in Patients with Hepatitis C and Its Impact on RNA Secondary Structure. Medicina 2024, 60, 368. https://doi.org/10.3390/medicina60030368
Sadiq S, Anwar MZ, Shafique H, Manzoor SM, Shoaib S, Hamid R, Hashmi SN, Ashraf NM, Afsar T, Bhat MA, et al. Determination of IL-6 Gene Promoter Polymorphism in Patients with Hepatitis C and Its Impact on RNA Secondary Structure. Medicina. 2024; 60(3):368. https://doi.org/10.3390/medicina60030368
Chicago/Turabian StyleSadiq, Sarah, Mohammad Zeeshan Anwar, Huma Shafique, Syed Mohsin Manzoor, Shaiza Shoaib, Rabia Hamid, Shoaib Naiyer Hashmi, Naeem Mahmood Ashraf, Tayyaba Afsar, Mashooq Ahmad Bhat, and et al. 2024. "Determination of IL-6 Gene Promoter Polymorphism in Patients with Hepatitis C and Its Impact on RNA Secondary Structure" Medicina 60, no. 3: 368. https://doi.org/10.3390/medicina60030368
APA StyleSadiq, S., Anwar, M. Z., Shafique, H., Manzoor, S. M., Shoaib, S., Hamid, R., Hashmi, S. N., Ashraf, N. M., Afsar, T., Bhat, M. A., & Razak, S. (2024). Determination of IL-6 Gene Promoter Polymorphism in Patients with Hepatitis C and Its Impact on RNA Secondary Structure. Medicina, 60(3), 368. https://doi.org/10.3390/medicina60030368


