Next Article in Journal
IL13 May Play an Important Role in Developing Eosinophilic Chronic Rhinosinusitis and Eosinophilic Otitis Media with Severe Asthma
Next Article in Special Issue
Morphophysiological and Proteomic Responses on Plants of Irradiation with Electromagnetic Waves
Previous Article in Journal
Chronic Rhinosinusitis and Alzheimer’s Disease—A Possible Role for the Nasal Microbiome in Causing Neurodegeneration in the Elderly
Previous Article in Special Issue
Constitutive Photomorphogenic 1 Enhances ER Stress Tolerance in Arabidopsis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 22
Issue 20
10.3390/ijms222011208
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Cytogenetic Analysis of the Introgression between Agropyron cristatum P Genome and Wheat Genome

by
Zhi Zhang
1,†,
Shenghui Zhou
1,†,
Weihua Liu
1,
Liqiang Song
2,
Jinpeng Zhang
1,
Haiming Han
1,
Xinming Yang
1,
Yida Lin
1,
Xiuquan Li
1 and
Lihui Li
1,*
1
National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing 100081, China
2
Center for Agricultural Resources Research, Institute of Genetics and Developmental Biology of Sciences, Shijiazhuang 050022, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Int. J. Mol. Sci. 2021, 22(20), 11208; https://doi.org/10.3390/ijms222011208
Submission received: 21 September 2021 / Revised: 14 October 2021 / Accepted: 15 October 2021 / Published: 18 October 2021
(This article belongs to the Collection Feature Papers in Molecular Plant Sciences)
Browse Figures
Versions Notes

Abstract

:
Agropyron cristatum (2n = 4x = 28, PPPP) is an important wild relative of common wheat (Triticum aestivum L., 2n = 6x = 42). A previous report showed that the wheat-A. cristatum 6P translocation line WAT655 carrying A. cristatum 6PS (0.81–1.00) exhibited high resistance to prevalent physiological races of stripe rust (CYR32 and CYR33). In this study, three disease resistance-related transcripts, which were mapped to A. cristatum 6PS (0.81–1.00) through the analysis of specific molecular markers, were acquired from among A. cristatum full-length transcripts. The BC5F2 and BC5F2:3 genetic populations of the translocation line WAT655 were analyzed by using three disease resistance-related gene markers, A. cristatum P genome-specific markers, and fluorescence in situ hybridization (FISH). The results revealed that the introgression between A. cristatum P genome and wheat genome was observed in progenies of the genetic populations of the translocation line WAT655 and the physical positions of the three genes were considerably adjacent on A. cristatum 6PS (0.81–1.00) according to the FISH results. Additionally, kompetitive allele-specific PCR (KASP) markers of the three genes were developed to detect and acquire 24 breeding lines selected from the progenies of the distant hybridization of wheat and A. cristatum, which showed resistance to physiological races of stripe rust (CYR32 and CYR33) and other desirable agronomic traits according to the field investigation. In conclusion, this study not only provides new insights into the introgression between A. cristatum P genome and wheat genome but also provides the desirable germplasms for breeding practice.

1. Introduction

Common wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most cultivated cereal crops in the world. The total global wheat acreage was approximately 220 million hectares, and the global yield was more than 770 million tons in 2020 [1]. Wheat is a staple food crop that can provide starch, protein, vitamins, dietary fiber, and phytochemicals for humans, and wheat also provides approximately 20% of the calories consumed by humans [2]. However, wheat often suffers from various biotic and abiotic stresses during production, and the narrow genetic basis of wheat restricts its genetic improvement [3]. Wheat stripe rust is a fungal disease caused by the fungus Puccinia striiformis f. sp. tritici (Pst). Approximately 90% of cultivated wheat is susceptible to Pst, and more than five million tons of the wheat harvest are lost annually [4,5]. With the emergence of new Pst races and the variations in existing Pst races, many wheat varieties have lost resistance to stripe rust [6,7]. Therefore, providing new wheat germplasms with resistance to Pst infection is necessary for advancing wheat breeding.
Wild relatives of wheat are crucial gene resources for broadening the genetic basis of wheat and facilitating wheat breeding. Wild relatives of wheat carry numerous disease resistance genes [8,9]. Moreover, with the increasing number of successful distant hybridizations, an increasing number of exogenous genes from wild relatives, particularly disease resistance genes, have been transferred into common wheat. The powdery mildew resistance gene Pm21 from Haynaldia villosa has been transferred into common wheat and widely applied in breeding practice [10,11,12]. Multiple stem rust resistance genes from Triticum monococcum, such as Sr21, Sr22, Sr35, and Sr60, have been cloned in common wheat [13,14,15,16,17]. Stripe rust resistance genes, such as YrAS2388, Yr28, YrY201 from Aegilops tauschii [18,19,20,21,22], and Yr15 from wild emmer wheat [23], have been cloned from common wheat. Hence, wild relatives of wheat are an abundant gene pool for providing disease resistance genes.
Agropyron cristatum (2n = 4x = 28, PPPP), an important wild relative of wheat, carries several desirable agronomic traits that can be applied in wheat breeding. With the achievement of the distant hybridization of wheat and A. cristatum, a series of wheat-A. cristatum derived lines were generated [24,25,26,27,28,29,30]. Many desirable genes from A. cristatum have been transferred into common wheat in the form of the translocation line. For example, A. cristatum P chromosomal segments carrying the powdery mildew resistance gene, the high-thousand grain weight (TGW) gene, and the high-grain number per spike (GNS) gene have been translocated into wheat chromosomes [28,29,31]. According to recent reports, the leaf rust resistance gene and the powdery mildew resistance gene from the A. cristatum 2P chromosome have been localized on the same segment of A. cristatum 2PL (0.66–0.86) [32], and both the stripe rust resistance gene and the leaf rust resistance gene were mapped to A. cristatum 6PS (0.81–1.00) [33]. Although wheat–A. cristatum translocation lines carry many desirable genes, they remain difficult to apply in wheat breeding because of the genetic drag caused by the exogenous chromosomal segments. Therefore, the identification of the introgression lines carrying smaller exogenous components is necessary for improving wheat breeding.
At present, over 80 wheat stripe rust resistance genes (Yr1–Yr81) have been named [34], however, a small number of stripe rust resistance (Yr) genes have been cloned. Of the Yr genes cloned so far, Yr5, Yr7, YrSP, and YrAS2388R encode nucleotide-binding domains and leucine-rich repeat domains [35,36]; and Yr36 and Yr15 encode kinase domains [23,37]. Moreover, in addition to stripe rust resistance genes, most of the other disease resistance genes in wheat also encode nucleotide-binding domains, leucine-rich repeat domains, or kinase domains [38]. For example, powdery mildew resistance genes (Stpk-V, Pm21, Pm41, and Pm60) [10,12,39,40] and stem rust resistance genes (Sr22, Sr35, Sr45, and Sr60) [15,16,17] encode nucleotide-binding domains, leucine-rich repeat domains, or kinase domains. Therefore, nucleotide-binding domains, leucine-rich repeat domains, and kinase domains can be considered as typical domains to help the clone of disease resistance genes.
In this study, to explore the introgression between A. cristatum P genome and wheat genome and detect A. cristatum P genomic components of breeding lines, the specific molecular markers and fluorescence in situ hybridization (FISH)/genomic in situ hybridization (GISH) probes made from the DNA of three bacterial artificial chromosome (BAC) clones, three disease resistance-related A. cristatum genes, and A. cristatum “Z559” were used to analyze the wheat–A. cristatum 6P derived lines. The introgression between A. cristatum P genome and wheat genome was observed, and the new breeding lines carrying A. cristatum P genomic components were acquired.

2. Results

2.1. The Acquisition of Disease Resistance-Related A. cristatum Genes of the Translocation Line WAT655

In previous reports, the wheat–A. cristatum 6P translocation line WAT655 carrying A. cristatum 6PS (0.81–1.00) exhibited high resistance to stripe rust (CYR32 and CYR33) and leaf rust in the adult stage [33,41]. To further explore the disease resistance genes of A. cristatum 6PS (0.81–1.00), the software TransDecoder (version v5.5.0) [42] was used to determine protein sequences of the A. cristatum full-length transcripts [43] and the software eggNOG-mapper [44] and BLAST from the NCBI website were used for the functional annotation. According to the information of the functional annotation, the disease resistance-related transcripts were searched from among A. cristatum full-length transcripts. Then, based on the sequences of disease resistance-related transcripts, molecular markers were developed to trace the A. cristatum 6P chromosomal segments of the translocation line WAT655. As a result, the specific molecular markers of three disease resistance-related transcripts can be mapped to A. cristatum 6PS (0.81–1.00) of the translocation line WAT655 (Figure 1 and Table 1).

2.2. The Preliminary Analysis of the Introgression between A. cristatum P Genome and Wheat Genome in the BC5F2 and BC5F2:3 Genetic Populations of the Translocation Line WAT655 Using the Molecular Markers

To trace A. cristatum 6P chromosomal segments in the BC5F2 population (2019–2020) of the translocation line WAT655, A. cristatum P genome-specific markers [45] (Table S1) and the gene markers from three disease resistance-related transcripts were utilized in this study. The detection results of the gene markers were different from the results of the A. cristatum P genome-specific markers in some plants of the BC5F2 population of the translocation line WAT655 (Figure 2). Preliminarily speculating, the introgression between A. cristatum 6PS (0.81–1.00) chromosomal segments and wheat chromosomes could occur in progenies of the BC5F2 population of the translocation line WAT655, which resulted in the differences between the two kinds of molecular markers in some plants.
To further confirm whether the introgression between A. cristatum 6PS (0.81–1.00) chromosomal segments and wheat chromosomes can occur in the common wheat background, the progenies from the BC5F2 population (2019–2020) of the translocation line WAT655 were planted in 2020–2021. The two kinds of molecular markers were utilized to detect P genomic components in the BC5F2:3 population, and the results revealed that some plants still showed differences between the gene markers and P genome-specific markers (Figure 2). These results further confirmed that the introgression of A. cristatum P genome and wheat genome can occur in the translocation line WAT655.

2.3. The Identification of the Introgression between A. cristatum P Genome and Wheat Genome in the Translocation Line WAT655

To acquire more sequence information of three disease resistance-related transcripts, the gene markers from the three transcripts were used to search A. cristatum “Z559” P genomic BAC bank, moreover, three BAC clones (BAC1013, BAC700, and BAC940) of three genes were acquired (Table 1). Pacific Biosciences technology was used to sequence the three BAC clones, and the software Hifiasm [46] was used to assemble the sequence data. This work was performed by BioMarker Company (Beijing, China).
To further analyze the introgression between A. cristatum P genome and wheat genome, the DNA of the three BAC clones, three disease resistance-related genes, and A. cristatum “Z559” was utilized as the probes to perform FISH and GISH in common wheat “Fukuho”, the translocation line WAT655, and the substitution line 4844-12-1 (Figure 3 and Figure 4, Figures S1–S3). The FISH and GISH probes could not hybridize with the chromosomal DNA of common wheat “Fukuho” (Figure 3 and Figure S2). The signals of the FISH probes made from the DNA of the BAC clones (BAC1013, BAC700, and BAC940) and three genes (Agr6971, Agr4080, and Agr8173) were mapped to A. cristatum 6PS (0.81–1.00) of the translocation line WAT655 and the A. cristatum 6PS terminal of the substitution line 4844-12-1 (Figure 3, Figures S1–S3). Significantly, the FISH probe BAC1013 traced one A. cristatum 6PS chromosomal segment on the wheat chromosome 3DS in addition to the previously translocated wheat chromosome 6D (Figure 4 and Figure 5); moreover, the probe Agr8173 detected A. cristatum 6PS chromosomal segments on the wheat chromosome 7DL (Figure 4 and Figure 5). Therefore, the above results indicated that the introgression between A. cristatum P genomic chromosomal segments and wheat chromosomes can occur in progenies of the genetic population of the translocation line WAT655.

2.4. Molecular Cytogenetic Analysis of the Physical Positions of Three Disease Resistance-Related Genes

To explore the physical positional relationships of the three genes on A. cristatum 6PS (0.81–1.00) of the translocation line WAT655, the DNA of Agr6971 and Agr8173 was labeled with Texas Red®-5-dCTP (red), and the DNA of Agr4080 was labeled with Fluorescein-12-dUTP (green). The probes Agr6971 (red) and Agr4080 (green) were simultaneously used for one FISH experiment (Figure 5 and Figure S4), and the probes Agr8173 (red) and Agr4080 (green) were simultaneously used for another (Figure 5 and Figure S4). The signals of the FISH probes showed that Agr6971 (red) and Agr4080 (green) were localized at one overlapping zone of A. cristatum 6PS (0.81–1.00); moreover, Agr8173 (red) and Agr4080 (green) were also localized at one overlapping zone of A. cristatum 6PS (0.81–1.00). These FISH results revealed that three genes were localized at the considerably adjacent positions on A. cristatum 6PS (0.81–1.00) (Figure 5), which could constitute a potential disease resistance-related gene cluster.

2.5. Tracing A. cristatum P Genomic Components of Breeding Lines Selected from Progenies of Distant Hybridization between A. cristatum and Wheat

To trace the A. cristatum P genomic components of breeding lines selected from progenies of distant hybridization between A. cristatum and wheat, the KASP molecular markers of the three genes were developed according to the results of the alignment between the sequences of three genes and the Chinese Spring genome sequences RefSeq v1.0 [47] (Figure S5 and Table S2). The KASP molecular markers were used to trace the A. cristatum 6P components of the BC5F2:3 population of the translocation line WAT655 and the A. cristatum 6P components of breeding lines, and the results were completely coincident with those of standard PCR detection of the gene markers relying on agarose gel electrophoresis (Figure S6). Meanwhile, 24 breeding lines carrying A. cristatum P genomic components were acquired from among 500 breeding lines (Figure 6 and Table 2). The three gene FISH probes were used to detect the A. cristatum P genomic components of the part of 24 breeding lines, and the breeding lines showed the A. cristatum P genomic components can be detected through the FISH probes (Figure 7). Additionally, these breeding lines exhibited resistance or moderate resistance to stripe rust (CYR32 and CYR33) according to the investigation in the field (Figure 6 and Table 2). These breeding lines also exhibited other desirable agronomic traits in the field (Figure 6 and Table 2). Therefore, A. cristatum P genomic components of these breeding lines can be traced by the molecular markers and the FISH probes, and these breeding lines can also promote wheat breeding.

3. Discussion

Distant hybridization is an efficient and important method and contributes much to wheat breeding for disease resistance. For example, the powdery mildew gene Pm21 of Haynaldia villosa 6VS has been widely applied in wheat breeding [11,12]; the 1BL•1RS translocation line carries many disease resistance genes, such as the stripe rust resistance gene Yr9, the powdery mildew resistance gene Pm8, the stem rust resistance gene Sr31, and the leaf rust resistance gene Lr26 [3,48,49,50]. A. cristatum is one of the most important wild relatives of common wheat and carries many desirable agronomic traits [8,9]. In recent years, many desirable genes from A. cristatum have been transferred into common wheat, such as the stripe rust resistance, the leaf rust resistance, the powdery mildew, the high-GNS, and the high-TGW genes [28,29,31,32,33,41,51,52,53,54]. These genes from A. cristatum are usually mapped on relatively large A. cristatum chromosomal segments of translocation lines. However, translocation lines are not easy to apply in breeding practice because of the genetic drag caused by the translocated segments, so many breeders desire the introgression lines carrying smaller exogenous genetic components for breeding. In this study, gene markers, A. cristatum genome-specific markers, and FISH/GISH probes were used to analyze the wheat–A. cristatum 6P translocation line WAT655. The evidence of the introgression between A. cristatum 6P chromosomal segments and wheat chromosomes was observed (Figure 4, Figure 5, Figure 6 and Figure 7), and these three genes could be mapped to the considerably adjacent physical positions on A. cristatum 6PS (0.81–1.00) according to the FISH signals (Figure 5). Additionally, 24 breeding lines carrying A. cristatum P genomic components were acquired through molecular cytogenetic analysis (Figure 6 and Figure 7). These breeding lines exhibited favorable breeding agronomic traits including resistance to stripe rust (CYR32 and CYR33) according to the investigation in the field, which also indicated that three disease resistance-related genes were closely associated with the resistance to stripe rust. Moreover, the molecular markers designed from the sequences of three disease resistance-related genes can also promote the application of marker-assisted selection in distant hybridization of wheat and A. cristatum and wheat breeding. In addition, to further verify the function of three disease resistance-related genes, transgenic work involving coding sequences (CDSs) and full-length sequences of three disease resistance-related genes is already underway. Therefore, this study not only provides new insights into the introgression between A. cristatum P genome and wheat genome but also provides a new approach for acquiring valuable breeding lines.
Some disease resistance genes have been shown to be distributed in the form of a gene cluster. For example, the powdery mildew resistance genes Pm21 and Stpk-V were mapped to the same locus of Haynaldia villosa 6VS bin (FL 0.45–0.58) [11,12]; the stripe rust resistance genes Yr5, Yr7, and YrSP were on a gene cluster [35]. Both the powdery mildew resistance gene and the leaf rust resistance gene of A. cristatum 2P chromosome were mapped to A. cristatum 2PL (0.66–0.86) [29,32]. The stripe rust resistance gene and the leaf rust resistance gene were localized on A. cristatum 6PS (0.81–1.00) of the translocation line WAT655 [33,41,49]. In this study, the DNA of three disease resistance-related genes was used as FISH probes to identify the physical positions of the genes on A. cristatum 6PS (0.81–1.00). The results revealed that the FISH signals of the probes were located at the overlapping positions of A. cristatum 6PS (0.81–1.00) (Figure 5 and Figure S4), therefore, the three genes could be mapped to the considerably adjacent physical positions, which could constitute a potential disease resistance-related gene cluster on A. cristatum 6PS (0.81–1.00).
A. cristatum P genome and wheat genome were revealed to present a homoeologous relationship by using a wheat 660K SNP array, and apparent chromosomal rearrangements and introgression spread throughout the P genome were observed [55]. In addition, genetic rearrangements of A. cristatum 6P chromosomes could usually occur at the terminal of chromosomes by analyzing the different wheat–A. cristatum 6P addition lines [56]. In this study, the results of FISH using the DNA of the BAC clones and three disease resistance-related genes as probes indicated that the introgression can occur between A. cristatum 6P chromosomal segments and wheat chromosomes (Figure 4 and Figure 5), moreover, the observed introgression also occurred in the terminal of the chromosomes (Figure 4 and Figure 5). The mechanism of the introgression could involve chromosomal rearrangements between A. cristatum P genome and wheat genome resulting from their homoeologous relationship.

4. Materials and Methods

4.1. Plant Materials

The plant materials utilized in this study included the following: A. cristatum accession “Z559” (2n = 4x = 28, PPPP, from Xinjiang, China), a wheat–A. cristatum 6P disomic addition line 4844-12 (2n = 44) [27], a wheat-A. cristatum 6P disomic substitution line 4844-12-1 (2n = 42) (Table 3 and Figure S7), a wheat–A. cristatum 6P terminal translocation line WAT655 (Figure S8), a 6PS whole-arm translocation line WAT638a, a 6PL whole-arm translocation line WAT638b [33,41] (Table 3), Triticum aestivum cv. Fukuhokomugi (Fukuho) (2n = 6x = 42, AABBDD), wheat varieties (Zhoumai18, Jimai22, Shi4185, Luyuan502, Gaocheng8901, and Xinong979), and 500 breeding lines (WAg1–WAg500) selected from the progenies of the distant hybridization of A. cristatum and wheat. The wheat–A. cristatum 6P disomic addition line 4844-12 was produced via distant hybridization of A. cristatum accession “Z559” and common wheat “Fukuho” [27]. The wheat–A. cristatum 6P disomic substitution line 4844-12-1 was produced from the progenies of wheat–A. cristatum 6P disomic addition line 4844-12. Wheat–A. cristatum 6P translocation lines WAT655, WAT638a, and WAT638b were produced by radiating hybrid plants of the wheat–A. cristatum 6P disomic addition line 4844-12, which were acquired via strict backcrossing with common wheat “Fukuho” as the recurrent parent and self-pollination. The BC5F2 and BC5F2:3 genetic populations of the translocation line WAT655 were acquired via five-time strict backcrossing (BC5) with common wheat “Fukuho” as the recurrent parent and strict self-pollination. A total of 500 breeding lines were selected from the progenies of the distant hybridization of A. cristatum and wheat. All of the plant materials were preserved at the Center of Crop Germplasm Resources Research at the Institute of Crop Science, Chinese Academy of Agricultural Sciences (Beijing, China).

4.2. Molecular Cytogenetic Analysis

A. cristatum P genome-specific markers were designed from P genome-specific repeat sequences (Table S1) [42]. A. cristatum P genome-specific markers were also used to detect A. cristatum 6P chromosomal segments in the genetic populations of the translocation line WAT655. The A. cristatum full-length transcripts were analyzed by using TransDecoder (version v5.5.0) [43] to determine the CDSs and protein sequences, and the software eggNOG-mapper [44] and BLAST from the National Center of Biotechnology Information (NCBI) website were used to annotate these sequences. The disease resistance-related genes were searched, and specific molecular markers were developed for the analysis of wheat–A. cristatum 6P translocation line WAT655. Additionally, the specific sequences of three genes were used to design KASP markers to trace A. cristatum P genomic components in wheat–A. cristatum breeding lines (Figure S5 and Table S2). HiGeno 2x Probe Mix (JasonGen, Beijing, China) was used for the KASP reaction, and PCR products were detected with a PHERAstarplus SNP genotyping instrument (LGC Science Shanghai Ltd., Shanghai, China). The software KlusterCallerTM was used for genotyping assays.
FISH and GISH were performed in root tip cells, as described by Cuadrado et al. [57]. The DNA of three BAC clones, three disease resistance-related genes, and A. cristatum “Z559” were used as FISH/GISH probes, and the genomic DNA of common wheat “Fukuho” was used as the blocker. The FISH/GISH probes and the blocker were used at a 1:40 ratio. Oligo-pTa535-1 (red) and Oligo-pSc119.2-1 (green) [58] (Table S1) were used to analyze the wheat chromosomes in the substitution line 4844-12-1. The QIAGEN Large-Construct Kit (Qiagen, Germany) was used to extract the DNA of the three BAC clones. The DNA of three disease resistance-related genes was acquired from the three A. cristatum “Z559” genomic BAC clones, respectively. The DNA of A. cristatum “Z559”, the three BAC clones (BAC1013, BAC700, and BAC940), the three genes (Agr6971, Agr4080, and Agr8173), and pAs1 [59] were labeled with Texas Red®-5-dCTP (red) (PerkinElmer, Waltham Mass, MA, USA). The DNA of A. cristatum “Z559”, the gene Agr4080, and pHvG39 [59] was labeled with Fluorescein-12-dUTP (green) (PerkinElmer, Waltham Mass, MA, USA). VECTASHIELD® Antifade Mounting Medium with DAPI (Vector Laboratories, Burlingame, CA, USA) was used for the FISH/GISH experiments. Signals were captured using an OLYMPUS AX80 (Olympus Corporation, Tokyo, Japan) fluorescence microscope with a CCD camera (Diagnostic Institute, Inc., Sterling Height, MI, USA) and processed with Photoshop CS 3.0.

4.3. Evaluation of the Agronomic Traits of Wheat–A. cristatum Breeding Lines in the Field

To evaluate stripe rust resistance, the wheat-A. cristatum 6P disomic addition line 4844-12, the wheat–A. cristatum 6P disomic substitution line 4844-12-1, the wheat-A. cristatum 6P translocation line WAT655, wheat varieties (Zhoumai18, Jimai22, Shi4185, Luyuan502, Gaocheng8901, and Xinong979), 500 breeding lines selected from the progenies of the distant hybridization of A. cristatum and wheat, and the common wheat cultivar “Fukuho” were planted in a randomized complete block design with three replicates in the field in Beijing (39°54′20″ N, 116°25′29″ E, China) during 2019–2020. Twenty grains of each material were planted in 2.0 m rows that were spaced 0.3 m apart. The common wheat “Fukuho” was used as the control. The prevalent physiological races of stripe rust CYR32 and CYR33 were used to inoculate the plant materials at the elongation stage in the field in Beijing. The infection type (IT) score ranged from 0 to 9 (0: no visible symptoms; 1–2: necrotic flecks or necrotic areas without sporulation; 3–4: trace or light sporulation; 5–6: intermediate or moderate sporulation; 7–8: abundant sporulation; 9: no necrosis or chlorosis and abundant sporulation) [60]. Plants with IT scores of 0–2 were considered as highly resistant type (HR); plants with IT scores of 3–4 were considered as moderately resistant type (MR); plants with IT scores of 5–6 were moderately susceptible type (MS); plants with IT scores of 5–9 were considered as highly susceptible type (HS).
To evaluate agronomic traits, wheat varieties (Zhoumai18, Jimai22, Shi4185, Luyuan502, Gaocheng8901, and Xinong979) and 500 breeding lines were planted in 1.2 × 6 m2 plots with four replicates in the field in Xinxiang (35°18′13″ N, 113°55′15″ E, Henan Province, China) during 2019–2020. The plant height, plot yield, and thousand grain weight of each material were measured. Statistical Analysis System (Version 9.4, SAS Institute, Cary, NC, USA) was used for statistical analysis in this study. Analysis of variance was performed to test the differences in the plant height, the plot yield, and the thousand grain weight among the breeding lines. The “mean ± SD” was used to represent the data.

5. Conclusions

In the previous report, the wheat–A. cristatum translocation line WAT655 carrying A. cristatum 6PS (0.81–1.00) exhibited the high resistance to prevalent physiological races of stripe rust (CYR32 and CYR33). In the present study, three disease resistance-related A. cristatum genes were acquired, which can be mapped to A. cristatum 6PS (0.81–1.00) carried by the translocation line WAT655. The three disease resistance-related genes could constitute a potential gene cluster through molecular cytogenetic analysis. Moreover, the introgression between A. cristatum P genome and wheat genome was observed in the translocation line WAT655 and the breeding lines carrying A. cristatum P genomic components were acquired by using the molecular markers and the FISH probes of the three genes. According to the resistance to stripe rust of the breeding lines, the three genes could be closely associated with the resistance to stripe rust. Therefore, this study provides new insights into the introgression between A. cristatum P genome and wheat genome and the desirable germplasms for breeding practice.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ijms222011208/s1.

Author Contributions

L.L. conceived and designed the experiments. Z.Z. performed the experiments, collected data, and wrote the paper. Z.Z. and S.Z. analyzed data. W.L. and L.S. produced the plant materials. J.Z., H.H., X.Y., Y.L. and X.L. contributed reagents/materials/analysis tools. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Chinese Academy of Agricultural Sciences, grant number CAAS-ASTIP-2021-ICS, and the National Science Foundation of China, grant number 31801359.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets of Agropyron cristatum BAC clones generated during and/or analyzed during the current study are not publicly available due to the transgenic work of the genes in progress but are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Abbreviations

FISHFluorescence in situ hybridization
GISHGenomic in situ hybridization
BACBacterial artificial chromosome
KASPKompetitive allele-specific PCR
SDStandard Deviation
PstPuccinia striiformis f. sp. tritici
TGWThousand grain weight
GNSGrain number per spike
NCBINational Center of Biotechnology Information
DAPI4,6-diamino-2-phenyl indole
ITInfection type

References

  1. United States Department of Agriculture Foreign Agricultural Service. World Agricultural Production (WAP). Circular Series. WAP 05-21. 2020. Available online: https://apps.fas.usda.gov/psdonline/circulars/production.pdf (accessed on 11 May 2021).
  2. Shewry, P.R.; Hey, S.J. The contribution of wheat to human diet and health. Food Energy Secur. 2015, 4, 178–202. [Google Scholar] [CrossRef]
  3. Friebe, B.; Jiang, J.; Raupp, W.J.; McIntosh, R.A.; Gill, B.S. Characterization of wheat-alien translocations conferring resistance to diseases and pests: Current status. Euphytica 1996, 91, 59–87. [Google Scholar] [CrossRef]
  4. Wellings, C.R. Global status of stripe rust: A review of historical and current threats. Euphytica 2011, 179, 129–141. [Google Scholar] [CrossRef]
  5. Beddow, J.M.; Pardey, P.G.; Chai, Y.; Hurley, T.M.; Kriticos, D.J.; Braun, H.J.; Park, R.F.; Cuddy, W.S.; Yonow, T. Research investment implications of shifts in the global geography of wheat stripe rust. Nat. Plants 2015, 1, 15132. [Google Scholar] [CrossRef]
  6. Wan, A.M.; Zhao, Z.H.; Chen, X.M.; He, Z.H.; Jin, S.L.; Jia, Q.Z.; Yao, G.; Yang, J.X.; Wang, B.T.; Li, G.B.; et al. Wheat stripe rust epidemic and virulence of Puccinia striiformis f. sp. tritici in China in 2002. Plant Dis. 2004, 88, 896–904. [Google Scholar]
  7. Chen, W.Q.; Wu, L.R.; Liu, T.G.; Xu, S.C.; Jin, S.L.; Peng, Y.L.; Wang, B.T. Race dynamics, diversity, and virulence evolution in Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust in China from 2003 to 2007. Plant Dis. 2009, 93, 1093–1101. [Google Scholar]
  8. Dewey, D.R. The genomic system of classification as a guide to intergeneric hybridization with the perennial Triticeae. In Gene manipulation in Plant Improvement; Gustafson, J.P., Ed.; Plenum Press: New York, NY, USA, 1984; pp. 209–279. [Google Scholar]
  9. Dong, Y.C.; Zhou, R.H.; Xu, S.J.; Li, L.H.; Cauderon, Y.; Wang, R.R.C. Desirable characteristics in perennial Triticeae collected in China for wheat improvement. Hereditas 1992, 116, 175–178. [Google Scholar] [CrossRef]
  10. Cao, A.Z.; Xing, L.P.; Wang, X.Y.; Yang, X.M.; Wang, W.; Sun, Y.L.; Qian, C.; Ni, J.L.; Chen, Y.P.; Liu, D.J.; et al. Serine/threonine kinase gene Stpk-V, a key member of powdery mildew resistance gene Pm21, confers powdery mildew resistance in wheat. Proc. Natl. Acad. Sci. USA 2011, 108, 7727–7732. [Google Scholar] [CrossRef] [Green Version]
  11. Chen, P.D.; You, C.F.; Hu, Y.; Chen, S.W.; Zhou, B.; Cao, A.Z.; Wang, X.E. Radiation-induced translocations with reduced Haynaldia villosa chromatin at the Pm21 locus for powdery mildew resistance in wheat. Mol. Breed. 2013, 31, 477–484. [Google Scholar] [CrossRef]
  12. Xing, L.P.; Hu, P.; Liu, J.Q.; Witek, K.; Zhou, S.; Xu, J.F.; Zhou, W.H.; Gao, L.; Huang, Z.P.; Zhang, R.Q.; et al. Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat. Mol. Plant 2018, 11, 874–878. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Gerechter-Amitai, Z.K.; Wahl, I.; Vardi, A.; Zohary, D. Transfer of stem rust seedling resistance from wild diploid einkorn to tetraploid durum wheat by means of a triploid hybrid bridge. Euphytica 1971, 20, 281–285. [Google Scholar] [CrossRef]
  14. McIntosh, R.A.; Dyck, P.L.; The, T.T.; Cusick, J.; Milne, D.L. Cytogenetical studies in wheat XIII. Sr35, a third gene from Triticum monococcum for resistance to Puccinia graminis tritici. Z. Pflanzenzucht. 1984, 92, 1–14. [Google Scholar]
  15. Saintenac, C.; Zhang, W.J.; Salcedo, A.; Rousse, M.N.; Trick, H.N.; Akhunov, E.; Dubcovsky, J. Identification of wheat gene Sr35 that confers resistance to Ug99 stem rust race group. Science 2013, 341, 783–786. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Steuernagel, B.; Periyannan, S.K.; Hernández-Pinzón, I.; Witek, K.; Rouse, M.N.; Yu, G.T.; Hatta, A.; Ayliffe, M.; Bariana, H.; Jones, J.D.G.; et al. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture. Nat. Biotechnol. 2016, 34, 652–655. [Google Scholar] [CrossRef] [PubMed]
  17. Chen, S.S.; Zhang, W.J.; Bolus, S.; Rouse, M.N.; Dubcovsky, J. Identification and characterization of wheat stem rust resistance gene Sr21 effective against the Ug99 race group at high temperature. PLoS Genet. 2018, 14, e1007287. [Google Scholar] [CrossRef] [Green Version]
  18. Singh, R.P.; Nelson, J.C.; Sorrells, M.E. Mapping Yr28 and other genes for resistance to stripe rust in wheat. Crop Sci. 2000, 40, 1148–1155. [Google Scholar] [CrossRef] [Green Version]
  19. Zhang, H.Q.; Jia, J.Z.; Yang, H.; Zhang, B.S. SSR mapping of stripe rust resistance gene from Ae. tauschii. Hereditas 2008, 30, 491–494. [Google Scholar] [PubMed]
  20. Huang, L.; Zhang, L.Q.; Liu, B.L.; Yan, Z.H.; Zhang, B.; Zhang, H.G.; Zheng, Y.L.; Liu, D.C. Molecular tagging of a stripe rust resistance gene in Aegilops tauschii. Euphytica 2011, 179, 313–318. [Google Scholar] [CrossRef]
  21. Liu, M.; Zhang, C.Z.; Yuan, C.L.; Zhang, L.Q.; Huang, L.; Wu, J.J.; Wang, J.R.; Zheng, Y.L.; Zhang, H.G.; Liu, D.C.; et al. Stripe rust resistance in Aegilops tauschii germplasm. Crop Sci. 2013, 53, 2014–2020. [Google Scholar] [CrossRef]
  22. Zhang, R.Q.; Singh, R.P.; Lillemo, M.; He, X.Y.; Randhawa, M.S.; Huerta-Espino, J.; Singh, P.K.; Li, Z.K.; Lan, C.X. Two main stripe rust resistance genes identified in synthetic-derived wheat line Soru#1. Phytopathology 2018, 109, 120–126. [Google Scholar]
  23. Klymiuk, V.; Yaniv, E.; Huang, L.; Raats, D.; Fatiukha, A.; Chen, S.S.; Feng, L.H.; Frenkel, Z.; Krugman, T.; Lidzbarsky, G.; et al. Cloning of the wheat Yr15 resistance gene sheds light on the plant tandem kinase-pseudokinase family. Nat. Commun. 2018, 9, 3735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Limin, A.E.; Fowler, D.B. An interspecific hybrid and amphiploid produced from Triticum aestivum crosses with Agropyron cristatum and Agropyron desertorum. Genome 1990, 33, 581–584. [Google Scholar] [CrossRef]
  25. Li, L.H.; Dong, Y.C.; Zhou, R.H.; Li, X.Q.; Li, P. Cytogenetics and self-fertility of hybrids between Triticum aestivum L. and Agropyron cristatum (L.) Gaertn. Acta Genet. Sin. 1995, 22, 109–114. [Google Scholar]
  26. Li, L.H.; Li, X.Q.; Li, P.; Dong, Y.C.; Zhao, G.S. Establishment of wheat-Agropyron cristatum alien addition lines. I. Cytology of F3, F2BC1, BC4, and BC3F1 progenies. Acta Genet. Sin. 1997, 24, 154–159. [Google Scholar]
  27. Wu, J.; Yang, X.M.; Wang, H.; Li, H.J.; Li, L.H.; Li, X.Q.; Liu, W.H. The introgression of chromosome 6P specifying for increased numbers of florets and kernels from Agropyron cristatum into wheat. Theor. Appl. Genet. 2006, 114, 13–20. [Google Scholar] [CrossRef]
  28. Lu, M.J.; Lu, Y.Q.; Li, H.H.; Pan, C.L.; Guo, Y.; Zhang, J.P.; Yang, X.M.; Li, X.Q.; Liu, W.H.; Li, L.H. Transferring desirable genes from Agropyron cristatum 7P chromosome into common wheat. PLoS ONE 2017, 11, e0159577. [Google Scholar] [CrossRef] [Green Version]
  29. Li, H.H.; Jiang, B.; Wang, J.C.; Lu, Y.Q.; Zhang, J.P.; Pan, C.L.; Yang, X.M.; Li, X.Q.; Liu, W.H.; Li, L.H. Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P. Theor. Appl. Genet. 2017, 130, 109–121. [Google Scholar] [CrossRef]
  30. Said, M.; Parada, A.C.; Gaál, E.; Molnár, I.; Cabrera, A.; Doležel, J.; Vrána, J. Uncovering homeologous relationships between tetraploid Agropyron cristatum and bread wheat genomes using COS markers. Theor. Appl. Genet. 2019, 132, 2881–2898. [Google Scholar] [CrossRef] [Green Version]
  31. Zhang, Z.; Han, H.M.; Liu, W.H.; Song, L.Q.; Zhang, J.P.; Zhou, S.H.; Yang, X.M.; Li, X.Q.; Li, L.H. Deletion mapping and verification of an enhanced-grain number per spike locus from the 6PL chromosome arm of Agropyron cristatum in common wheat. Theor. Appl. Genet. 2019, 132, 2815–2827. [Google Scholar] [CrossRef] [PubMed]
  32. Jiang, B.; Liu, T.G.; Li, H.H.; Han, H.M.; Li, L.H.; Zhang, J.P.; Yang, X.M.; Zhou, S.H.; Li, X.Q.; Liu, W.H. Physical Mapping of a Novel Locus Conferring Leaf Rust Resistance on the Long Arm of Agropyron cristatum Chromosome 2P. Front. Plant Sci. 2018, 9, 817. [Google Scholar] [CrossRef]
  33. Zhang, Z.; Song, L.Q.; Han, H.M.; Zhou, S.H.; Zhang, J.P.; Yang, X.M.; Li, X.Q.; Liu, W.H.; Li, L.H. Physical localization of a locus from Agropyron cristatum conferring resistance to stripe rust in common wheat. Int. J. Mol. Sci. 2017, 18, 2403. [Google Scholar] [CrossRef] [Green Version]
  34. Gessese, M.; Bariana, H.; Wong, D.; Hayden, M.; Bansal, U. Molecular mapping of stripe rust resistance gene Yr81 in a common wheat landrace Aus27430. Plant Dis. 2019, 103, 1166–1171. [Google Scholar] [CrossRef]
  35. Marchal, C.; Zhang, J.P.; Zhang, P.; Fenwick, P.; Steuernagel, B.; Adamski, N.M.; Boyd, L.; Mclntosh, R.; Wulff, B.B.H.; Berry, S.; et al. BED-domain-containing immune receptors confer diverse resistance spectra to yellow rust. Nat. Plants 2018, 4, 662–668. [Google Scholar] [CrossRef]
  36. Zhang, C.Z.; Huang, L.; Zhang, H.F.; Hao, Q.Q.; Lyu, B.; Wang, M.N.; Epstein, L.; Liu, M.; Kou, C.L.; Qi, J.; et al. An ancestral NB-LRR with duplicated 3′ UTRs confers stripe rust resistance in wheat and barley. Nat. Commun. 2019, 10, 4023. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Fu, D.L.; Uauy, C.; Distelfeld, A.; Blechl, A.; Epstein, L.; Chen, X.M.; Sela, H.; Fahima, T.; Dubcovsky, J. A kinase-START gene confers temperature-dependent resistance to wheat stripe rust. Science 2009, 323, 1357–1360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Krattinger, S.G.; Keller, B. Molecular genetics and evolution of disease resistance in cereals. New Phytol. 2016, 212, 320–332. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Zou, S.; Wang, H.; Li, Y.; Kong, Z.S.; Tang, D. The NB-LRR gene Pm60 confers powdery mildew resistance in wheat. New Phytol. 2018, 218, 298–309. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Li, M.M.; Dong, L.L.; Li, B.B.; Wang, Z.Z.; Xie, J.Z.; Qiu, D.; Li, Y.H.; Shi, W.Q.; Yang, L.J.; Wu, Q.H.; et al. A CNL protein in wild emmer wheat confers powdery mildew resistance. New Phytol. 2020, 228, 1027–1037. [Google Scholar] [CrossRef]
  41. Song, L.Q.; Lu, Y.Q.; Zhang, J.P.; Pan, C.L.; Yang, X.M.; Li, X.Q.; Liu, W.H.; Li, L.H. Cytological and molecular analysis of wheat-Agropyron cristatum translocation lines with 6P chromosome fragments conferring superior agronomic traits in common wheat. Genome 2016, 59, 840–850. [Google Scholar] [CrossRef] [PubMed]
  42. Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.D.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [Green Version]
  43. Zhou, S.H.; Zhang, J.P.; Han, H.M.; Zhang, J.; Ma, H.H.; Zhang, Z.; Lu, Y.Q.; Liu, W.H.; Yang, X.M.; Li, X.Q.; et al. Full-length transcriptome sequences of Agropyron cristatum facilitate the prediction of putative genes for thousand-grain weight in a wheat-A. cristatum translocation line. BMC Genom. 2019, 20, 1025. [Google Scholar] [CrossRef] [Green Version]
  44. Huerta-Cepas, J.; Forslund, K.; Coelho, L.P.; Szklarczyk, D.; Jensen, L.J.; von Mering, C.; Bork, P. Fast Genome-Wide Functional Annotation through Orthology Assignment by eggNOG-Mapper. Mol. Biol. Evol. 2017, 34, 2115–2122. [Google Scholar] [CrossRef] [Green Version]
  45. Han, H.M.; Liu, W.H.; Lu, Y.Q.; Zhang, J.P.; Yang, X.M.; Li, X.Q.; Hu, Z.M.; Li, L.H. Isolation and application of P genome-specific DNA sequences of Agropyron Gaertn in Triticeae. Planta 2017, 245, 425–437. [Google Scholar] [CrossRef]
  46. Cheng, H.Y.; Concepcion, G.T.; Feng, X.W.; Zhang, H.W.; Li, H. Haplotype-resolved de novo assembly using phased assembly graphs with hifiasm. Nat. Methods 2021, 18, 170–175. [Google Scholar] [CrossRef] [PubMed]
  47. International Wheat Genome Sequencing Consortium (IWGSC). Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, eaar7191. [Google Scholar] [CrossRef] [Green Version]
  48. Zeller, F.J. 1B/1R wheat chromosome substitutions and translocations. In Proceedings of 4th International Wheat Genetic Symptoms; Sears, E.R., Sears, L.M.S., Eds.; University of Missouri: Columbia, SC, USA, 1973; pp. 209–221. [Google Scholar]
  49. Singh, N.K.; Shepherd, K.W.; McIntosh, R.A. Linkage mapping of genes for resistance to leaf, stem, and stripe rusts and x-secalins on the short arm of rye chromosome 1R. Theor. Appl. Genet. 1990, 80, 609–616. [Google Scholar] [CrossRef]
  50. Mago, R.; Spielmeyer, W.; Lawrence, G.J.; Lagudah, E.S.; Ellis, J.G.; Pryor, A. Identification and mapping of molecular markers linked to rust resistance genes located on chromosome 1RS of rye using wheat-rye translocation lines. Theor. Appl. Genet. 2002, 104, 1317–1324. [Google Scholar] [CrossRef]
  51. Ochoa, V.; Madrid, E.; Said, M.; Rubiales, D.; Cabrera, A. Molecular and cytogenetic characterization of a common wheat-Agropyron cristatum chromosome translocation conferring resistance to leaf rust. Euphytica 2015, 201, 89–95. [Google Scholar] [CrossRef]
  52. Song, L.Q.; Lu, Y.Q.; Zhang, J.P.; Pan, C.L.; Yang, X.M.; Li, X.Q.; Liu, W.H.; Li, L.H. Physical mapping of Agropyron cristatum chromosome 6P using deletion lines in common wheat background. Theor. Appl. Genet. 2016, 129, 1023–1034. [Google Scholar] [CrossRef] [PubMed]
  53. Zhang, J.; Zhang, J.P.; Liu, W.H.; Wu, X.Y.; Yang, X.M.; Li, X.Q.; Lu, Y.Q.; Li, L.H. An intercalary translocation from Agropyron cristatum 6P chromosome into common wheat confers enhanced kernel number per spike. Planta 2016, 244, 853–864. [Google Scholar] [CrossRef]
  54. Copete, A.; Cabrera, A. Chromosomal location of genes for resistance to powdery mildew in Agropyron cristatum and mapping of conserved orthologous set molecular markers. Euphytica 2017, 213, 189. [Google Scholar] [CrossRef]
  55. Zhou, S.H.; Zhang, J.P.; Che, Y.H.; Liu, W.H.; Lu, Y.Q.; Yang, X.M.; Li, X.Q.; Jia, J.Z.; Liu, X.; Li, L.H. Construction of Agropyron Gaertn. genetic linkage maps using a wheat 660K SNP array reveals a homoeologous relationship with the wheat genome. Plant Biotechnol. J. 2018, 16, 818–827. [Google Scholar] [CrossRef] [Green Version]
  56. Han, H.M.; Bai, L.; Su, J.J.; Zhang, J.P.; Song, L.Q.; Gao, A.N.; Yang, X.M.; Li, X.Q.; Liu, W.H.; Li, L.H. Genetic Rearrangements of Six Wheat-Agropyron cristatum 6P Addition Lines Revealed by Molecular Markers. PLoS ONE 2014, 9, e91066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Cuadrado, A.; Schwarzacher, T.; Jouve, N. Identification of different chromatin classes in wheat using in situ hybridization with simple sequence repeat oligonucleotides. Theor. Appl. Genet. 2000, 101, 711–717. [Google Scholar] [CrossRef]
  58. Tang, Z.X.; Yang, Z.J.; Fu, S.L. Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J. Appl. Genet. 2014, 55, 313–318. [Google Scholar] [CrossRef] [PubMed]
  59. Pedersen, C.; Langridge, P. Identification of the entire chromosome complement of bread wheat by two-colour FISH. Genome 1997, 40, 589–593. [Google Scholar] [CrossRef]
  60. Line, R.F.; Qayoum, A. Collecting and Evaluating Rust Samples for Virulence. In Virulence, Aggressiveness, Evolution, and Distribution of Races of Puccinia Striiformis (the Cause of Stripe Rust of Wheat) in North America, 1968–1987; United States Department of Agriculture: Washington, DC, USA, 1992; pp. 4–9. [Google Scholar]
Ijms 22 11208 g001 550
Figure 1. The functional annotations and the PCR amplification patterns of the molecular markers of three A. cristatum full-length transcripts. (a–c) The functional annotations of three full-length transcripts. (d–i) The gene-specific molecular markers of three full-length transcripts were used to trace A. cristatum 6PS (0.81–1.00). Lanes: M, DL2000 DNA marker; 1, Z559; 2, 4844-12; 3, Fukuho; 4, WAT655; 5, WAT638a; 6, WAT638b.
Figure 1. The functional annotations and the PCR amplification patterns of the molecular markers of three A. cristatum full-length transcripts. (a–c) The functional annotations of three full-length transcripts. (d–i) The gene-specific molecular markers of three full-length transcripts were used to trace A. cristatum 6PS (0.81–1.00). Lanes: M, DL2000 DNA marker; 1, Z559; 2, 4844-12; 3, Fukuho; 4, WAT655; 5, WAT638a; 6, WAT638b.
Ijms 22 11208 g001
Ijms 22 11208 g002 550
Figure 2. Then PCR amplification patterns of A. cristatum P genome-specific markers (AcPR2a, AcPR6, and AcPR2b) and gene makers (Agr6971-3, Agr4080-3, and Agr8173-9) in the genetic populations (BC5F2 and BC5F2:3). (a–e) The detection results for the BC5F2 population of the translocation line WAT655. (f–j) The detection results for the BC5F2:3 population of the translocation line WAT655. The red arrows indicated the differences between P genome-specific markers and the gene makers in these plants; the black arrows indicated the diagnostic bands. Lanes: M, DL2000 DNA marker; 1, Z559; 2, 4844-12; 3, Fukuho; 4–24 of (a–e) the partial plants of the BC5F2 population; 4–24 of (f–h) the partial plants of the WAT655 BC5F2:3 population; 4–17 of (i,j) the partial plants of the BC5F2:3 population.
Figure 2. Then PCR amplification patterns of A. cristatum P genome-specific markers (AcPR2a, AcPR6, and AcPR2b) and gene makers (Agr6971-3, Agr4080-3, and Agr8173-9) in the genetic populations (BC5F2 and BC5F2:3). (a–e) The detection results for the BC5F2 population of the translocation line WAT655. (f–j) The detection results for the BC5F2:3 population of the translocation line WAT655. The red arrows indicated the differences between P genome-specific markers and the gene makers in these plants; the black arrows indicated the diagnostic bands. Lanes: M, DL2000 DNA marker; 1, Z559; 2, 4844-12; 3, Fukuho; 4–24 of (a–e) the partial plants of the BC5F2 population; 4–24 of (f–h) the partial plants of the WAT655 BC5F2:3 population; 4–17 of (i,j) the partial plants of the BC5F2:3 population.
Ijms 22 11208 g002
Ijms 22 11208 g003 550
Figure 3. The FISH and GISH patterns of common wheat “Fukuho”, the substitution line 4844-12-1, and the translocation line WAT655 using the DNA of the BAC clone “BAC1013”, the gene Agr4080, and A. cristatum “Z559” as the probes. (a,b) The FISH patterns of common wheat “Fukuho” using the probes BAC1013 and Agr4080. (c,e) The FISH patterns of the substitution line 4844-12-1 and the translocation line WAT655 using the probe BAC1013. (g,i) The FISH patterns of the substitution line 4844-12-1 and the translocation line WAT655 using the probe Agr4080. (d–j) The GISH patterns of the substitution line 4844-12-1 and the translocation line WAT655 using the DNA of A. cristatum “Z559” as the probe. A. cristatum 6P chromosomal segments were in red, while wheat chromosomes were in blue strained by 4′,6-diamidino-2-phenylindole (DAPI). The white arrows indicated the A. cristatum chromatin in the wheat background. (scale bar = 10 µm).
Figure 3. The FISH and GISH patterns of common wheat “Fukuho”, the substitution line 4844-12-1, and the translocation line WAT655 using the DNA of the BAC clone “BAC1013”, the gene Agr4080, and A. cristatum “Z559” as the probes. (a,b) The FISH patterns of common wheat “Fukuho” using the probes BAC1013 and Agr4080. (c,e) The FISH patterns of the substitution line 4844-12-1 and the translocation line WAT655 using the probe BAC1013. (g,i) The FISH patterns of the substitution line 4844-12-1 and the translocation line WAT655 using the probe Agr4080. (d–j) The GISH patterns of the substitution line 4844-12-1 and the translocation line WAT655 using the DNA of A. cristatum “Z559” as the probe. A. cristatum 6P chromosomal segments were in red, while wheat chromosomes were in blue strained by 4′,6-diamidino-2-phenylindole (DAPI). The white arrows indicated the A. cristatum chromatin in the wheat background. (scale bar = 10 µm).
Ijms 22 11208 g003
Ijms 22 11208 g004 550
Figure 4. The cytogenetic analysis of the introgression in the translocation line WAT655 using the DNA of A. cristatum BAC clone BAC1013, the gene Agr8173, A. cristatum “Z559”, pAs1, and pHvG39 as the probes. (a,d) The probes BAC1013 (red) and Agr8173 (red) were used for the first round of FISH, respectively. The white arrows indicated the A. cristatum chromatin in the wheat background. (b,e) The DNA of A. cristatum “Z559” as the probes (red/green) was used for the second round of GISH on the same slides. The white arrows indicated the A. cristatum chromatin in the wheat background. (c,f) The probes pAs1 (red) and pHvG39 (green) were used for the third round of FISH on the same slides. The white arrows indicated the wheat chromosomes that the A. cristatum chromatins were located on. Wheat chromosomes were in blue strained by DAPI. (scale bar = 10 µm).
Figure 4. The cytogenetic analysis of the introgression in the translocation line WAT655 using the DNA of A. cristatum BAC clone BAC1013, the gene Agr8173, A. cristatum “Z559”, pAs1, and pHvG39 as the probes. (a,d) The probes BAC1013 (red) and Agr8173 (red) were used for the first round of FISH, respectively. The white arrows indicated the A. cristatum chromatin in the wheat background. (b,e) The DNA of A. cristatum “Z559” as the probes (red/green) was used for the second round of GISH on the same slides. The white arrows indicated the A. cristatum chromatin in the wheat background. (c,f) The probes pAs1 (red) and pHvG39 (green) were used for the third round of FISH on the same slides. The white arrows indicated the wheat chromosomes that the A. cristatum chromatins were located on. Wheat chromosomes were in blue strained by DAPI. (scale bar = 10 µm).
Ijms 22 11208 g004
Ijms 22 11208 g005 550
Figure 5. The production of the new types through the introgression and the physical positions of the three genes on A. cristatum 6PS (0.81–1.00) in the translocation line WAT655. (a) The new translocated types were produced through the introgression between A. cristatum P genome and wheat genome. The probes BAC1013, Agr8173, and pAs1 were in red; the probes made from A. cristatum P genomic DNA were in red or green. (b) The physical positions of the three genes Agr6971, Agr4080, and Agr8173 on A. cristatum 6PS (0.81–1.00). The probes Agr6971, Agr8173, and the probe made from the DNA of A. cristatum “Z559” were in red, while the probe Agr4080 was in green. The FISH/GISH patterns of chromosomes in (a,b) are from Figure 4 and Figures S2–S4.
Figure 5. The production of the new types through the introgression and the physical positions of the three genes on A. cristatum 6PS (0.81–1.00) in the translocation line WAT655. (a) The new translocated types were produced through the introgression between A. cristatum P genome and wheat genome. The probes BAC1013, Agr8173, and pAs1 were in red; the probes made from A. cristatum P genomic DNA were in red or green. (b) The physical positions of the three genes Agr6971, Agr4080, and Agr8173 on A. cristatum 6PS (0.81–1.00). The probes Agr6971, Agr8173, and the probe made from the DNA of A. cristatum “Z559” were in red, while the probe Agr4080 was in green. The FISH/GISH patterns of chromosomes in (a,b) are from Figure 4 and Figures S2–S4.
Ijms 22 11208 g005
Ijms 22 11208 g006 550
Figure 6. The detection of A. cristatum P genomic components using KASP markers and the investigation of agronomic traits of breeding lines. (a–c) The detection results of Agr6971kps-4, Agr4080kps-2, and Agr4080kps-4, respectively. The genotype of A. cristatum “Z559” was in red; the genotype of wheat was in blue. The genotype of the breeding lines was in the circles. (d,e) The agronomic traits of partial breeding lines including resistance to stripe rust and other agronomic traits in the field.
Figure 6. The detection of A. cristatum P genomic components using KASP markers and the investigation of agronomic traits of breeding lines. (a–c) The detection results of Agr6971kps-4, Agr4080kps-2, and Agr4080kps-4, respectively. The genotype of A. cristatum “Z559” was in red; the genotype of wheat was in blue. The genotype of the breeding lines was in the circles. (d,e) The agronomic traits of partial breeding lines including resistance to stripe rust and other agronomic traits in the field.
Ijms 22 11208 g006
Ijms 22 11208 g007 550
Figure 7. The FISH detection of A. cristatum P genomic components of the partial breeding lines using three gene FISH probes. (a,c,e) The A. cristatum P genomic components of the breeding lines can be detected using three gene probes. A. cristatum 6P chromosomal segments were in red, while wheat chromosomes were in blue strained by DAPI. The white arrows indicated the A. cristatum chromatin in the wheat background. (b,d,f) The A. cristatum P genomic components of the breeding lines cannot be traced by the DNA of A. cristatum “Z559” as the probe. (scale bar = 10 µm).
Figure 7. The FISH detection of A. cristatum P genomic components of the partial breeding lines using three gene FISH probes. (a,c,e) The A. cristatum P genomic components of the breeding lines can be detected using three gene probes. A. cristatum 6P chromosomal segments were in red, while wheat chromosomes were in blue strained by DAPI. The white arrows indicated the A. cristatum chromatin in the wheat background. (b,d,f) The A. cristatum P genomic components of the breeding lines cannot be traced by the DNA of A. cristatum “Z559” as the probe. (scale bar = 10 µm).
Ijms 22 11208 g007
Table
Table 1. Sequences of molecular markers designed according to A. cristatum transcript sequences.
Table 1. Sequences of molecular markers designed according to A. cristatum transcript sequences.
Transcript IdGene NameBAC ClonePrimer NameLeft Primer (5′–3′)Right Primer (5′–3′)Annealing Temperature
transcript/6971Agr6971BAC1013Agr6971-3TCACCAAAGATCGAGCTCCTACCCGTCTGCAGATTGTACC60 °C
Agr6971vgs-2GACCAGCTAGACAACCAGGTTGCTGTTTGGGACCATCTCT60 °C
transcript/4080Agr4080BAC700Agr4080-3GGGCGGTTTTACTTCACAAAACTTGCAGCTGTCAATGTGC60 °C
Agr4080-4TGAAACTGGATGGACGATGAGTGCTGCTGTGGTGTTGACT60 °C
Agr4080vgs-1CCGAGGTGGCGAATGAACTTGTAGAGATGGAGGCTGTGGTGACT60 °C
Agr4080cds-6TTGTCGGACTAATAATAGCGCTGCCGAGATAATGGGGTT60 °C
transcript/8173Agr8173BAC940Agr8173-2GGTCCCATACCTCCCAGTTTTCGATGAAAGGTCCAGTTCC60 °C
Agr8173-9ATCGTTGGCCAATTCGATAGCAGCAGAAGGAGCATGTTGA60 °C
Agr8173-6TGATCATTGTGGAGACCGGACACCCTCTTTTGGCAACCTT60 °C
PCR Program: 95 °C 5 mins; 95 °C 45 s, Annealing temperature °C 45 s, 72 °C 45 s, 35 cycles; 72 °C 5 min.
Table
Table 2. The agronomic traits of wheat–A. cristatum breeding lines in 2019–2020.
Table 2. The agronomic traits of wheat–A. cristatum breeding lines in 2019–2020.
MaterialsPlant Height (cm)Plot Yields (kg)Thousand Grain Weight (g)Stripe Rust Response
Jimai2293.06 ± 1.41 a7.52 ± 0.24 c41.85 ± 0.28 cS
Zhoumai1886.32 ± 2.15 c6.78 ± 0.26 e44.61 ± 0.42 bS
WAg2077.25 ± 1.82 e6.09 ± 0.18 g\R
WAg3780.12 ± 2.65 d7.16 ± 0.38 d46.75 ± 0.45 aR
WAg3880.50 ± 2.37 d6.59 ± 0.16 ef\R
WAg6090.61 ± 3.56 b8.40 ± 0.27 a43.10 ± 0.32 bMR
WAg11583.21 ± 2.73 cd6.77 ± 0.23 e\MR
WAg13085.36 ± 4.01 c8.04 ± 0.26 b42.23 ± 0.24 bcMR
WAg16580.58 ± 2.13 d7.49 ± 0.14 c\R
WAg22075.42 ± 2.87 e7.63 ± 0.20 c\R
WAg27076.09 ± 3.25 e7.35 ± 0.17 cd\R
WAg27482.20 ± 3.35 d6.46 ± 0.18 f\R
WAg30185.23 ± 3.89 c8.37 ± 0.26 a40.84 ± 0.25 cMR
WAg30885.25 ± 2.10 c7.07 ± 0.35 d\MR
WAg31480.45 ± 2.34 d7.09 ± 0.19 d\MR
WAg31785.69 ± 3.14 c7.25 ± 0.15 d\R
WAg32287.57 ± 2.69 c8.32 ± 0.38 a39.73 ± 0.27 cdMR
WAg33082.63 ± 1.82 d8.11 ± 0.20 ab37.89 ± 0.38 dMR
WAg33580.33 ± 1.95 d7.52 ± 0.27 c38.96 ± 0.46 dR
WAg33783.28 ± 2.74 cd8.22 ± 0.24 a41.08 ± 0.47 cMR
WAg33980.29 ± 2.58 d7.13 ± 0.16 d38.66 ± 0.61 dR
WAg40981.35 ± 3.46 d7.08 ± 0.13 d39.32 ± 0.39 dMR
WAg45782.24 ± 2.09 d7.84 ± 0.23 b43.80 ± 0.46 bR
WAg46675.49 ± 2.51 e7.45 ± 0.34 c38.58 ± 0.52 dMR
WAg47585.41 ± 2.59 c8.24 ± 0.16 a45.94 ± 0.56 aR
WAg48085.17 ± 2.49 c7.96 ± 0.30 b41.84 ± 0.23 cR
Significant differences in the mean ± standard deviation (SD) are indicated at the probability levels of p = 0.05 (lowercase letters), based on Duncan’s multiple range test (analysis of variance by SAS 9.4).
Table
Table 3. The information of the plant materials.
Table 3. The information of the plant materials.
MaterialsZygosityProgenyType6P Segment SizeChromosome ConstitutionReference
4844-12-1Homozygous disomic substitution line6P42 (6P/6D)
4844-12Homozygous disomic addition line6P44Wu et al. [27]
WAT638bHomozygousBC2F66AS•6PL6PL arm42Zhang et al. [33]; Song et al. [41]
WAT638aHomozygousBC2F66PS•6AL6PS arm42
WAT655HomozygousBC2F66DS•6DL-6PS6PS (0.81–1.00)42
HeterozygousBC5F2, BC5F2:3
All of the plant materials were preserved at the Center of Crop Germplasm Resources Research at the Institute of Crop Science, Chinese Academy of Agricultural Sciences.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhang, Z.; Zhou, S.; Liu, W.; Song, L.; Zhang, J.; Han, H.; Yang, X.; Lin, Y.; Li, X.; Li, L. Molecular Cytogenetic Analysis of the Introgression between Agropyron cristatum P Genome and Wheat Genome. Int. J. Mol. Sci. 2021, 22, 11208. https://doi.org/10.3390/ijms222011208

AMA Style

Zhang Z, Zhou S, Liu W, Song L, Zhang J, Han H, Yang X, Lin Y, Li X, Li L. Molecular Cytogenetic Analysis of the Introgression between Agropyron cristatum P Genome and Wheat Genome. International Journal of Molecular Sciences. 2021; 22(20):11208. https://doi.org/10.3390/ijms222011208

Chicago/Turabian Style

Zhang, Zhi, Shenghui Zhou, Weihua Liu, Liqiang Song, Jinpeng Zhang, Haiming Han, Xinming Yang, Yida Lin, Xiuquan Li, and Lihui Li. 2021. "Molecular Cytogenetic Analysis of the Introgression between Agropyron cristatum P Genome and Wheat Genome" International Journal of Molecular Sciences 22, no. 20: 11208. https://doi.org/10.3390/ijms222011208

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop