Long-Day Photoperiod Improves the Growth and Muscle Quality of Grass Carp (Ctenopharyngodon idella)
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Ethics Statement
2.2. Fish and Rearing Conditions
2.3. Randomized Controlled Trial Design
2.4. Growth Parameters Analysis
2.5. Muscle Texture Properties and Color Analysis
2.6. Muscle Conventional Nutrient Content Analysis
2.7. Muscle Hydrolyzed Amino Acid and Free Fatty Acid Analysis
2.8. Muscle Hydroxyproline and Collagen Content Analysis
2.9. Muscle Histology Observation
2.10. Gene Expression Analysis
2.11. Statistical Analysis
3. Results and Discussion
3.1. Growth Parameters of Grass Carp
3.2. Textural Parameters and Color of Muscle
3.2.1. Textural Parameters of Muscle
3.2.2. Color of Muscle
3.3. Common Nutritional Component Contents of Muscle
3.4. Amino Acid and Fatty Acid Composition of Muscle
3.4.1. Amino Acid Composition of Muscle
3.4.2. Fatty Acid Composition of Muscle
3.5. The Main Muscle Components Involved in the Development of Flesh Texture
3.5.1. Muscle Fiber Properties
3.5.2. Collagen Synthesis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Food and Agriculture Organization of the United Nations. State of World Fisheries and Aquaculture 2024: Blue Transformation in Action; Food and Agriculture Organization of the United Nations: Rome, Italy, 2024. [Google Scholar] [CrossRef]
- Feng, R.; Feng, D.; Wang, L.; Zhang, L.; Liu, C.; Ma, F.; Zhang, M.; Yu, M.; Jiang, H.; Qiao, Z.; et al. Comparative analysis of nutritional quality, serum biochemical indices, and visceral peritoneum of grass carp (Ctenopharyngodon idellus) fed with two distinct aquaculture systems. Foods 2024, 13, 1248. [Google Scholar] [CrossRef]
- Cheng, J.; Sun, D.; Han, Z.; Zeng, X. Texture and structure measurements and analyses for evaluation of fish and fillet freshness quality: A review. Compr. Rev. Food Sci. Food Saf. 2013, 13, 52–61. [Google Scholar] [CrossRef]
- Tang, T.; Bai, J.; Ao, Z.; Wei, Z.; Hu, Y.; Liu, S. Effects of dietary paper mulberry (Broussonetia papyrifera) on growth performance and muscle quality of grass carp (Ctenopharyngodon idella). Animals 2021, 11, 1655. [Google Scholar] [CrossRef] [PubMed]
- Bjørnevik, M.; Hansen, H.; Roth, B.; Foss, A.; Vikingstad, E.; Solberg, C.; Imsland, A. Effects of starvation, subsequent feeding and photoperiod on flesh quality in farmed cod (Gadus morhua). Aquac. Nutr. 2016, 23, 285–292. [Google Scholar] [CrossRef]
- Hemre, G.; Karlsen, O.; Eckhoff, K.; Tveit, K.; Mangor-Jensen, A.; Rosenlund, G. Effect of season, light regime and diet on muscle composition and selected quality parameters in farmed Atlantic cod, Gadus morhua L. Aquac. Res. 2004, 35, 683–697. [Google Scholar] [CrossRef]
- Johnston, I.; Manthri, S.; Bickerdike, R.; Dingwall, A.; Luijkx, R.; Campbell, P.; Nickell, D.; Alderson, R. Growth performance, muscle structure and flesh quality in out-of-season Atlantic salmon (Salmo salar) smolts reared under two different photoperiod regimes. Aquaculture 2004, 237, 281–300. [Google Scholar] [CrossRef]
- Xin, L.; Pingping, W.; Songtao, L.; He, M.; Junpeng, Z.; Ying, L.; Ye, T. Comparative study of the growth, feeding, amino acid composition, and nutritional quality of Dicentrarchus labrax juveniles under different light photoperiods. J. Fish. Sci. China 2020, 27, 1062–1074. [Google Scholar]
- Zhou, Y.; Wu, P.; Jiang, W.; Liu, Y.; Peng, Y.; Kuang, S.; Tang, L.; Li, S.; Feng, L.; Zhou, X. Dietary cinnamaldehyde improves muscle protein content by promoting muscle fiber growth via PTP1B/IGF1/PI3K/AKTs-TOR/FOXO3a signaling pathway in grass carp (Ctenopharyngodon idella). Food Chem. 2023, 399, 133799. [Google Scholar] [CrossRef]
- Qu, L.; Xia, T.; Du, X.; Lou, B.; Chen, X.; Xu, J.; Ding, Z.; Wei, C.; Cheng, H. Effects of salinity treatment on muscle quality and off-flavour compounds of grass carp (Ctenopharyngodon idella) and black carp (Mylopharyngodon piceus). Aquac. Res. 2022, 53, 4823–4831. [Google Scholar] [CrossRef]
- Xu, W.; Yang, Q.; Wang, Y.; Tang, R.; Li, D. The growth performance, antioxidative status and muscle quality of grass carp (Ctenopharyngodon idellus) cultured in the recirculating pond aquaculture system (RPAS). Aquaculture 2023, 562, 738829. [Google Scholar] [CrossRef]
- Wu, X.; Li, D.; Lu, J.; Liu, L.; Yang, Q.; Tang, R.; Zhang, X.; Li, L. Adaptation strategies of juvenile grass carp (Ctenopharyngodon idella) facing different dissolved oxygen concentrations in a recirculating aquaculture system. Water Biol. Secur. 2023, 2, 100202. [Google Scholar] [CrossRef]
- Liu, D.; Liang, L.; Xia, W.; Regenstein, J.M.; Zhou, P. Biochemical and physical changes of grass carp (Ctenopharyngodon idella) fillets stored at −3 and 0 °C. Food Chem. 2013, 140, 105–114. [Google Scholar] [CrossRef] [PubMed]
- Benjakul, S.; Visessanguan, W.; Tueksuban, J. Changes in physico-chemical properties and gel-forming ability of lizardfish (Saurida tumbil) during post-mortem storage in ice. Food Chem. 2003, 80, 535–544. [Google Scholar] [CrossRef]
- Zhang, Z.; Xu, W.; Tang, R.; Li, L.; Refaey, M.M.; Li, D. Thermally processed diet greatly affects profiles of amino acids rather than fatty acids in the muscle of carnivorous Silurus meridionalis. Food Chem. 2018, 256, 244–251. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization; United Nations University. Protein and Amino Acid Requirements in Human Nutrition; World Health Organization technical report series; World Health Organization: Geneva, Switzerland, 2007; pp. 1–265, back cover. [Google Scholar]
- Etherington, D.; Sims, T. Detection and estimation of collagen. J. Sci. Food Agric. 1981, 32, 539–546. [Google Scholar] [CrossRef]
- Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative pcr and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Abdollahpour, H.; Falahatkar, B.; Lawrence, C. The effect of photoperiod on growth and spawning performance of zebrafish, Danio rerio. Aquac. Res. 2020, 17, 100295. [Google Scholar] [CrossRef]
- Tian, H.; Zhang, D.; Li, X.; Jiang, G.; Liu, W. Photoperiod affects blunt snout bream (Megalobrama amblycephala) growth, diel rhythm of cortisol, activities of antioxidant enzymes and mRNA expression of GH/IGF-I. Comp. Biochem. Physiol. B 2019, 233, 4–10. [Google Scholar] [CrossRef] [PubMed]
- Wei, H.; Cai, W.; Liu, H.; Han, D.; Zhu, X.; Yang, Y.; Jin, J.; Xie, S. Effects of photoperiod on growth, lipid metabolism and oxidative stress of juvenile gibel carp (Carassius auratus). J. Photochem. Photobiol. B Biol. 2019, 198, 111552. [Google Scholar] [CrossRef] [PubMed]
- Al-Emran, M.; Zahangir, M.; Badruzzaman, M.; Shahjahan, M. Influences of photoperiod on growth and reproduction of farmed fishes-prospects in aquaculture. Aquac. Res. 2024, 35, 101978. [Google Scholar] [CrossRef]
- Nagasawa, K.; Giannetto, A.; Fernandes, J. Photoperiod influences growth and mll (mixed-lineage leukaemia) expression in Atlantic cod. PLoS ONE 2012, 7, e36908. [Google Scholar] [CrossRef]
- Malinovskyi, O.; Rahimnejad, S.; Stejskal, V.; Boňko, D.; Stará, A.; Velíšek, J.; Policar, T. Effects of different photoperiods on growth performance and health status of largemouth bass (Micropterus salmoides) juveniles. Aquaculture 2022, 548, 737631. [Google Scholar] [CrossRef]
- Churova, M.; Shulgina, N.; Kuritsyn, A.; Krupnova, M.; Nemova, N. Muscle-specific gene expression and metabolic enzyme activities in Atlantic salmon Salmo salar L. fry reared under different photoperiod regimes. Comp. Biochem. Physiol. B 2020, 239, 110330. [Google Scholar] [CrossRef]
- Bano, F.; Serajuddin, M. Photoperiodic modulation on growth and behaviour of the giant gourami, Trichogaster fasciata (Bloch and Schneider, 1801). Turk. J. Fish. Aquat. Sci. 2017, 18, 91–100. [Google Scholar] [CrossRef]
- Mustapha, M.; Oladokun, T.; Salman, M.; Afolayan, P. Optimizing the growth and survival of Nile Tilapia Oreochromis niloticus through photoperiodic manipulations. Rom. J. Biol.-Zool. 2012, 57, 129–137. [Google Scholar]
- Wang, K.; Li, K.; Liu, L.; Tanase, C.; Mols, R.; van der Meer, M. Effects of light intensity and photoperiod on the growth and stress response of juvenile Nile tilapia (Oreochromis niloticus) in a recirculating aquaculture system. Aquac. Fish. 2023, 8, 85–90. [Google Scholar] [CrossRef]
- Shahjahan, M.; Al-Emran, M.; Majharul Islam, S.; Abdul Baten, S.; Rashid, H.; Mahfuzul Haque, M. Prolonged photoperiod inhibits growth and reproductive functions of rohu Labeo rohita. Aquac. Res. 2020, 16, 100272. [Google Scholar] [CrossRef]
- Barlow, C.; Pearce, M.; Rodgers, L.; Clayton, P. Effects of photoperiod on growth, survival and feeding periodicity of larval and juvenile barramundi Lates calcarifer (Bloch). Aquaculture 1995, 138, 159–168. [Google Scholar] [CrossRef]
- Yu, Y.; Wei, Y.; Chen, S.; Wang, Y.; Huang, H.; Li, C.; Wang, D.; Shi, W.; Li, J.; Zhao, Y. Correlation analysis of phosphorylation of myofibrillar protein and muscle quality of tilapia during storage in ice. Food Chem. 2024, 451, 139502. [Google Scholar] [CrossRef]
- Johnston, I.; Li, X.; Vieira, V.; Nickell, D.; Dingwall, A.; Alderson, R.; Campbell, P.; Bickerdike, R. Muscle and flesh quality traits in wild and farmed Atlantic salmon. Aquaculture 2006, 256, 323–336. [Google Scholar] [CrossRef]
- Periago, M.; Ayala, M.; López-Albors, O.; Abdel, I.; Martínez, C.; García-Alcázar, A.; Ros, G.; Gil, F. Muscle cellularity and flesh quality of wild and farmed sea bass, Dicentrarchus labrax L. Aquaculture 2005, 249, 175–188. [Google Scholar] [CrossRef]
- Ayala, M.; Arizcun, M.; Garcia-Alcazar, A.; Santaella, M.; Abellán, E. Long-term effects of the larval photoperiod on the subsequent growth of shi drum Umbrina cirrosa L. specimens and the fillet texture at commercial size. Turk. J. Fish Aquat. Sci. 2015, 15, 93–101. [Google Scholar] [CrossRef]
- Migaud, H.; Davie, A.; Taylor, J. Current knowledge on the photoneuroendocrine regulation of reproduction in temperate fish species. J. Fish Biol. 2010, 76, 27–68. [Google Scholar] [CrossRef] [PubMed]
- Imsland, A.; Gunnarsson, S.; Roth, B.; Foss, A.; Le Deuff, S.; Norberg, B.; Thorarensen, H.; Helming, T. Long-term effect of photoperiod manipulation on growth, maturation and flesh quality in turbot. Aquaculture 2013, 416–417, 152–160. [Google Scholar] [CrossRef]
- Gines, R.; Afonso, J.M.; Arguello, A.; Zamorano, M.; Lopez, J. The effects of long-day photoperiod on growth, body composition and skin colour in immature gilthead sea bream (Sparus aurata L.). Aquac. Res. 2004, 35, 1207–1212. [Google Scholar] [CrossRef]
- Urban, J.; Stys, D.; Sergejevová, M.; Masojídek, J. Expertomica Fishgui: Comparison of fish skin colour. J. Appl. Ichthyol. 2013, 29, 172–180. [Google Scholar] [CrossRef]
- Komolka, K.; Bochert, R.; Franz, G.P.; Kaya, Y.; Pfuhl, R.; Grunow, B. Determination and comparison of physical meat quality parameters of percidae and salmonidae in aquaculture. Foods 2020, 9, 388. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Bi, Q.; Liao, Z.; Sun, B.; Jia, L.; Wei, Y.; Liang, M. Long-term alternate feeding between fish oil- and terrestrially sourced oil-based diets mitigated the adverse effects of terrestrially sourced oils on turbot fillet quality. Aquaculture 2021, 531, 735974. [Google Scholar] [CrossRef]
- Zhou, Y.; Jiang, W.; Zhang, J.; Feng, L.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.; Tang, L.; Peng, Y.; et al. Cinnamaldehyde improves the growth performance and digestion and absorption capacity in grass carp (Ctenopharyngodon idella). Fish Physiol. Biochem. 2020, 46, 1589–1601. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Wei, P.; Liu, S.; Tian, Y.; Ma, H.; Liu, Y. Photoperiods affect growth, food intake and physiological metabolism of juvenile European Sea Bass (Dicentrachus labrax L.). Aquac. Res. 2021, 20, 100656. [Google Scholar] [CrossRef]
- Xiao, L.; Jiang, W.; Wu, P.; Liu, Y.; Ren, H.; Tang, L.; Li, S.; Zhong, C.; Zhang, R.; Feng, L.; et al. Improvement of flesh quality, muscle growth and protein deposition in adult grass carp (Ctenopharyngodon idella): The role of tryptophan. Aquaculture 2023, 577, 740005. [Google Scholar] [CrossRef]
- Hoffer, L. Human protein and amino acid requirements. JPEN J. Parenter. Enter. Nutr. 2016, 40, 460–474. [Google Scholar] [CrossRef] [PubMed]
- Di, Z.; Li, K.; Liu, R.; Wang, G.; Lu, Q.; Li, T.; Yan, L.; Jiang, H.; Liu, L. Effects of photoperiod and light intensity on the growth, muscle nutrition and economic performance of murray cod (Maccullochella peelii) in the recirculaying aquaculture system. Acta Hydrobiol. Sin. 2021, 45, 781–789. [Google Scholar] [CrossRef]
- Fatima, S.; Manzoor, F.; Amman, H.; Kanwal, Z.; Latif, A.; Ali, Z.; Gondal, H.; Sajjad, S.; Janjua, R. Supplementation of soy based feed with linseed and its effects on growth and fatty acid profile in grass carp (Ctenopharyngodon idella). Pak. J. Zool. 2021, 53, 1785–1791. [Google Scholar] [CrossRef]
- Wang, Z.; Qiao, F.; Zhang, W.; Parisi, G.; Du, Z.; Zhang, M. The flesh texture of teleost fish: Characteristics and interventional strategies. Rev. Aquac. 2023, 16, 508–535. [Google Scholar] [CrossRef]
- Cretoiu, D.; Pavelescu, L.; Duica, F.; Radu, M.; Suciu, N.; Cretoiu, S. Myofibers. Adv. Exp. Med. Biol. 2018, 1088, 23–46. [Google Scholar] [CrossRef] [PubMed]
- Valente, L.; Moutou, K.; Conceição, L.; Engrola, S.; Fernandes, J.; Johnston, I. What determines growth potential and juvenile quality of farmed fish species? Rev. Aquac. 2013, 5, S168–S193. [Google Scholar] [CrossRef]
- Song, D.; Yun, Y.; He, Z.; Mi, J.; Wang, L.; Jin, M.; Zhou, Q.; Nie, G. Fillet texture, physicochemical indexes, muscle cellularity and molecular expression in muscle of Yellow River carp (Cyprinus carpio haematopterus) in response to dietary hydroxyproline supplementation. Aquaculture 2022, 549, 737783. [Google Scholar] [CrossRef]
- Castro, V.; Grisdale-Helland, B.; Helland, S.; Kristensen, T.; Jørgensen, S.; Helgerud, J.; Claireaux, G.; Farrell, A.; Krasnov, A.; Takle, H. Aerobic training stimulates growth and promotes disease resistance in Atlantic salmon (Salmo salar). Comp. Biochem. Physiol. 2011, 160, 278–290. [Google Scholar] [CrossRef] [PubMed]
- Hurling, R.; Rodell, J.; Hunt, H. Fiber diameter and fish texture. J. Texture Stud. 1996, 27, 679–685. [Google Scholar] [CrossRef]
- Zammit, P. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin. Cell Dev. Biol. 2017, 72, 19–32. [Google Scholar] [CrossRef]
- McPherron, A.; Lawler, A.; Lee, S. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature 1997, 387, 83–90. [Google Scholar] [CrossRef]
- Shulgina, N.; Churova, M.; Murzina, S.; Krupnova, M.; Nemova, N. The effect of continuous light on growth and muscle-specific gene expression in atlantic salmon (Salmo salar L.) yearlings. Life 2021, 11, 328. [Google Scholar] [CrossRef]
- Parr, B.; Shea, M.; Vassileva, G.; McMahon, A. Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development 1993, 119, 247–261. [Google Scholar] [CrossRef] [PubMed]
- Purslow, P. New developments on the role of intramuscular connective tissue in meat toughness. Annu. Rev. Food Sci. Technol. 2014, 5, 133–153. [Google Scholar] [CrossRef] [PubMed]
- Mouw, J.; Ou, G.; Weaver, V. Extracellular matrix assembly: A multiscale deconstruction. Nat. Rev. Mol. Cell Biol. 2014, 15, 771–785. [Google Scholar] [CrossRef] [PubMed]
- Muyonga, J.; Cole, C.; Duodu, K. Characterisation of acid soluble collagen from skins of young and adult Nile perch (Lates niloticus). Food Chem. 2004, 85, 81–89. [Google Scholar] [CrossRef]
Gene Name | Primer Sequence (5′-3′) | Accession Numbers |
---|---|---|
mrf4 | F: TCGCTCCTGTATTGATGTTGATG | KT899334 |
R: GCTCCTGTCTCGCATTCGT | ||
myf5 | F: GGAGAGCCGCCACTATGA | GU290227 |
R: GCAGTCAACCATGCTTTCAG | ||
myog | F: CGGCGATAACTTCTTCCA | JQ793897 |
R: TTCTTCAACCTCCTCTTCTC | ||
myod | CGCTACTTAGGAGTCAAGAGGA | GU218462 |
AGTTCTCACCATGCCATCAGA | ||
mstn | GCAGGAGTCACGTCTTGGCA | KM874826 |
GAGTCCCTCCGGATTCGCTT | ||
col1α1 | GCATGGGGCAAGACAGTCA | HM363526 |
ACGCACACAAACAATCTCAAGT | ||
col1α2 | ACATTGGTGGCGCGCAGATCA | HM587241 |
TCTCCGATAGAGCCCAGCTT | ||
ef1α | TGACTGTGCCGTGCTGAT | GQ266394 |
GCTGACTTCCTTGGTGATTTC | ||
β-actin | CCTTCTTGGGTATGGAATCTTG | DQ211096 |
AGAGTATTTACGCTCAGGTGGG |
Items | Photoperiods | ||||
---|---|---|---|---|---|
0L:24D | 8L:16D | 12L:12D | 16L:8D | 24L:0D | |
FW (g) | 360.32 ± 17.41 b | 363.64 ± 5.85 b | 382.48 ± 5.84 a | 383.98 ± 9.3 a | 367.1 ± 3.84 ab |
FL (cm) | 25.34 ± 0.4 b | 25.64 ± 0.13 ab | 26.16 ± 0.53 a | 26.19 ± 0.16 a | 25.99 ± 0.29 a |
CF (g/cm3) | 2.00 ± 0.03 a | 1.95 ± 0.03 ab | 1.93 ± 0.07 ab | 1.92 ± 0.02 ab | 1.89 ± 0.08 b |
HSI (%) | 2.23 ± 0.18 | 2.02 ± 0.17 | 2.19 ± 0.12 | 2.26 ± 0.21 | 2.02 ± 0.06 |
VSI (%) | 9.87 ± 0.71 | 9.41 ± 0.58 | 9.63 ± 0.60 | 10.04 ± 0.58 | 9.48 ± 0.37 |
Chroma Index | Photoperiods | ||||
---|---|---|---|---|---|
0L:24D | 8L:16D | 12L:12D | 16L:8D | 24L:0D | |
White muscle | |||||
L* | 47.09 ± 0.14 b | 47.45 ± 1.03 ab | 50.5 ± 2.73 a | 48.6 ± 2.52 ab | 47.05 ± 0.5 b |
a* | −0.91 ± 0.19 | −1.05 ± 0.31 | −0.92 ± 0.01 | −1.12 ± 0.04 | −1.19 ± 0.07 |
b* | −1.55 ± 0.27 a | −1.57 ± 0.25 a | −1.81 ± 0.3 ab | −2.3 ± 0.43 b | −2.45 ± 0.58 b |
W* | 47.06 ± 0.14 b | 47.42 ± 1.03 ab | 50.47 ± 2.74 a | 48.54 ± 2.5 ab | 46.97 ± 0.48 b |
Red muscle | |||||
L* | 40.71 ± 0.89 | 41.03 ± 0.81 | 41.34 ± 1.41 | 40.66 ± 0.56 | 41.34 ± 0.77 |
a* | 13.88 ± 0.62 a | 12.58 ± 0.58 ab | 11.83 ± 0.56 b | 13.32 ± 1.18 a | 13.82 ± 0.51 a |
b* | 3.36 ± 0.15 a | 3.38 ± 0.23 a | 2.81 ± 0.18 b | 3.55 ± 0.31 a | 3.45 ± 0.06 a |
W* | 39.01 ± 0.86 | 39.6 ± 0.68 | 40.11 ± 1.48 | 39.07 ± 0.82 | 39.67 ± 0.81 |
Items | Photoperiods | ||||
---|---|---|---|---|---|
0L:24D | 8L:16D | 12L:12D | 16L:8D | 24L:0D | |
C10:0 | 0.39 ± 0.21 | 0.30 ± 0.08 | 0.26 ± 0.02 | 0.37 ± 0.11 | 0.31 ± 0.08 |
C12:0 | 0.19 ± 0.04 a | 0.15 ± 0.02 ab | 0.10 ± 0.03 b | 0.14 ± 0.02 ab | 0.10 ± 0.03 b |
C14:0 | 1.63 ± 0.42 | 1.65 ± 0.16 | 1.74 ± 0.17 | 1.67 ± 0.42 | 1.62 ± 0.25 |
C14:1 | 0.48 ± 0.03 ab | 0.50 ± 0.00 a | 0.40 ± 0.01 b | 0.46 ± 0.04 ab | 0.46 ± 0.03 ab |
C15:0 | 0.31 ± 0.06 | 0.30 ± 0.01 | 0.32 ± 0.03 | 0.30 ± 0.06 | 0.35 ± 0.05 |
C16:0 | 15.73 ± 3.22 | 15.99 ± 1.24 | 15.96 ± 1.75 | 16.12 ± 2.92 | 16.19 ± 2.29 |
C16:1 | 6.38 ± 1.96 | 6.25 ± 0.77 | 6.64 ± 1.16 | 6.30 ± 1.50 | 5.73 ± 1.10 |
C18:1n9c | 27.38 ± 8.02 | 26.05 ± 2.75 | 26.95 ± 5.25 | 26.54 ± 5.19 | 25.84 ± 4.26 |
C18:2n6t | 31.01 ± 6.21 | 31.72 ± 2.42 | 31.50 ± 4.01 | 31.54 ± 5.70 | 33.06 ± 4.95 |
C18:2n6c | 0.45 ± 0.05 | 0.44 ± 0.05 | 0.46 ± 0.06 | 0.39 ± 0.09 | 0.43 ± 0.09 |
C18:3n6 | 1.94 ± 0.30 | 2.01 ± 0.17 | 2.04 ± 0.32 | 1.99 ± 0.38 | 2.06 ± 0.31 |
C18:3n3 | 0.38 ± 0.06 | 0.32 ± 0.03 | 0.32 ± 0.06 | 0.32 ± 0.06 | 0.33 ± 0.04 |
C20:0 | 1.58 ± 0.32 | 1.46 ± 0.16 | 1.42 ± 0.25 | 1.47 ± 0.26 | 1.47 ± 0.20 |
C20:1 | 1.22 ± 0.21 | 1.20 ± 0.12 | 1.15 ± 0.16 | 1.25 ± 0.18 | 1.32 ± 0.20 |
C20:2 | 2.05 ± 0.28 | 2.15 ± 0.12 | 1.94 ± 0.27 | 2.08 ± 0.31 | 2.06 ± 0.30 |
C21:0 | 5.90 ± 0.69 | 6.47 ± 0.37 | 6.00 ± 0.48 | 6.08 ± 0.63 | 5.93 ± 0.64 |
C20:4n6 | 0.25 ± 0.03 | 0.20 ± 0.03 | 0.20 ± 0.01 | 0.22 ± 0.02 | 0.22 ± 0.01 |
C20:3n3 | 0.49 ± 0.04 | 0.42 ± 0.03 | 0.41 ± 0.03 | 0.45 ± 0.01 | 0.44 ± 0.01 |
C20:5n3 | 0.15 ± 0.03 | 0.10 ± 0.04 | 0.10 ± 0.04 | 0.11 ± 0.01 | 0.14 ± 0.03 |
C22:0 | 0.13 ± 0.04 | 0.10 ± 0.04 | 0.09 ± 0.02 | 0.11 ± 0.02 | 0.09 ± 0.02 |
C22:1n9 | 0.19 ± 0.06 | 0.11 ± 0.06 | 0.13 ± 0.05 | 0.09 ± 0.05 | 0.13 ± 0.02 |
C23:0 | 1.32 ± 0.16 | 1.58 ± 0.31 | 1.43 ± 0.32 | 1.54 ± 0.40 | 1.28 ± 0.11 |
C24:0 | 0.47 ± 0.13 | 0.52 ± 0.09 | 0.45 ± 0.10 | 0.43 ± 0.07 | 0.45 ± 0.09 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Li, X.; Xu, T.; Li, H.; Liu, J.; Yang, Q.; Li, W.; Zidan, S.R.S.; Jiang, C.; Yuan, Y.; et al. Long-Day Photoperiod Improves the Growth and Muscle Quality of Grass Carp (Ctenopharyngodon idella). Foods 2025, 14, 504. https://doi.org/10.3390/foods14030504
Wang Y, Li X, Xu T, Li H, Liu J, Yang Q, Li W, Zidan SRS, Jiang C, Yuan Y, et al. Long-Day Photoperiod Improves the Growth and Muscle Quality of Grass Carp (Ctenopharyngodon idella). Foods. 2025; 14(3):504. https://doi.org/10.3390/foods14030504
Chicago/Turabian StyleWang, Yin, Xuxu Li, Tingting Xu, Huacheng Li, Jieya Liu, Qiushi Yang, Wenhan Li, Sayed R. S. Zidan, Chengchen Jiang, Yutian Yuan, and et al. 2025. "Long-Day Photoperiod Improves the Growth and Muscle Quality of Grass Carp (Ctenopharyngodon idella)" Foods 14, no. 3: 504. https://doi.org/10.3390/foods14030504
APA StyleWang, Y., Li, X., Xu, T., Li, H., Liu, J., Yang, Q., Li, W., Zidan, S. R. S., Jiang, C., Yuan, Y., Tang, R., Yu, L., Li, L., Zhang, X., & Li, D. (2025). Long-Day Photoperiod Improves the Growth and Muscle Quality of Grass Carp (Ctenopharyngodon idella). Foods, 14(3), 504. https://doi.org/10.3390/foods14030504