An Experimentally Defined Hypoxia Gene Signature in Glioblastoma and Its Modulation by Metformin
Abstract
1. Introduction
2. Materials and Methods
2.1. In Vitro Cultures
2.2. Sequencing and Polymerase Chain Reaction (PCR)
2.3. TP53 Analysis
2.4. Western Blot
2.5. In Vitro Assays
2.6. Bionformatic and Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Louis, D.N.; Perry, A.; Reifenberger, G.; von Deimling, A.; Figarella-Branger, D.; Cavenee, W.K.; Ohgaki, H.; Wiestler, O.D.; Kleihues, P.; Ellison, D.W. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: A summary. Acta Neuropathol. 2016, 131, 803–820. [Google Scholar] [CrossRef] [PubMed]
- Wen, P.Y.; Kesari, S. Malignant gliomas in adults. N. Engl. J. Med. 2008, 359, 492–507. [Google Scholar] [CrossRef]
- Stupp, R.; Mason, W.P.; van den Bent, M.J.; Weller, M.; Fisher, B.; Taphoorn, M.J.; Belanger, K.; Brandes, A.A.; Marosi, C.; Bogdahn, U.; et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N. Engl. J. Med. 2005, 352, 987–996. [Google Scholar] [CrossRef] [PubMed]
- Verhaak, R.G.; Hoadley, K.A.; Purdom, E.; Wang, V.; Qi, Y.; Wilkerson, M.D.; Miller, C.R.; Ding, L.; Golub, T.; Mesirov, J.P.; et al. Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer Cell 2010, 17, 98–110. [Google Scholar] [CrossRef] [PubMed]
- Phillips, H.S.; Kharbanda, S.; Chen, R.; Forrest, W.F.; Soriano, R.H.; Wu, T.D.; Misra, A.; Nigro, J.M.; Colman, H.; Soroceanu, L.; et al. Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis. Cancer Cell 2006, 9, 157–173. [Google Scholar] [CrossRef]
- Sottoriva, A.; Spiteri, I.; Piccirillo, S.G.; Touloumis, A.; Collins, V.P.; Marioni, J.C.; Curtis, C.; Watts, C.; Tavare, S. Intratumor heterogeneity in human glioblastoma reflects cancer evolutionary dynamics. Proc. Natl. Acad. Sci. USA 2013, 110, 4009–4014. [Google Scholar] [CrossRef]
- Patel, A.P.; Tirosh, I.; Trombetta, J.J.; Shalek, A.K.; Gillespie, S.M.; Wakimoto, H.; Cahill, D.P.; Nahed, B.V.; Curry, W.T.; Martuza, R.L.; et al. Single-cell RNA-seq highlights intratumoral heterogeneity in primary glioblastoma. Science 2014, 344, 1396–1401. [Google Scholar] [CrossRef]
- Bhandari, V.; Hoey, C.; Liu, L.Y.; Lalonde, E.; Ray, J.; Livingstone, J.; Lesurf, R.; Shiah, Y.J.; Vujcic, T.; Huang, X.; et al. Molecular landmarks of tumor hypoxia across cancer types. Nat. Genet. 2019, 51, 308–318. [Google Scholar] [CrossRef]
- Tredan, O.; Galmarini, C.M.; Patel, K.; Tannock, I.F. Drug resistance and the solid tumor microenvironment. J. Natl. Cancer Inst. 2007, 99, 1441–1454. [Google Scholar] [CrossRef]
- Vaupel, P. Hypoxia and aggressive tumor phenotype: Implications for therapy and prognosis. Oncologist 2008, 13, 21–26. [Google Scholar] [CrossRef]
- Wei, J.; Wu, A.; Kong, L.Y.; Wang, Y.; Fuller, G.; Fokt, I.; Melillo, G.; Priebe, W.; Heimberger, A.B. Hypoxia potentiates glioma-mediated immunosuppression. PLoS ONE 2011, 6, e16195. [Google Scholar] [CrossRef] [PubMed]
- Keeley, T.P.; Mann, G.E. Defining physiological normoxia for improved translation of cell physiology to animal models and humans. Physiol. Rev. 2019, 99, 161–234. [Google Scholar] [CrossRef] [PubMed]
- Timpano, S.; Guild, B.D.; Specker, E.J.; Melanson, G.; Medeiros, P.J.; Sproul, S.L.J.; Uniacke, J. Physioxic human cell culture improves viability, metabolism, and mitochondrial morphology while reducing DNA damage. FASEB J. 2019, 33, 5716–5728. [Google Scholar] [CrossRef] [PubMed]
- Erecinska, M.; Silver, I.A. Tissue oxygen tension and brain sensitivity to hypoxia. Respir. Physiol. 2001, 128, 263–276. [Google Scholar] [CrossRef]
- Vuillefroy de Silly, R.; Ducimetiere, L.; Yacoub Maroun, C.; Dietrich, P.Y.; Derouazi, M.; Walker, P.R. Phenotypic switch of CD8(+) T cells reactivated under hypoxia toward IL-10 secreting, poorly proliferative effector cells. Eur. J. Immunol. 2015, 45, 2263–2275. [Google Scholar] [CrossRef] [PubMed]
- Vaupel, P.; Hockel, M.; Mayer, A. Detection and characterization of tumor hypoxia using pO2 histography. Antioxid. Redox Signal. 2007, 9, 1221–1235. [Google Scholar] [CrossRef] [PubMed]
- Iyer, N.V.; Kotch, L.E.; Agani, F.; Leung, S.W.; Laughner, E.; Wenger, R.H.; Gassmann, M.; Gearhart, J.D.; Lawler, A.M.; Yu, A.Y.; et al. Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1 alpha. Genes Dev. 1998, 12, 149–162. [Google Scholar] [CrossRef]
- Park, E.C.; Ghose, P.; Shao, Z.; Ye, Q.; Kang, L.; Xu, X.Z.; Powell-Coffman, J.A.; Rongo, C. Hypoxia regulates glutamate receptor trafficking through an HIF-independent mechanism. EMBO J. 2012, 31, 1379–1393. [Google Scholar] [CrossRef]
- Arsham, A.M.; Howell, J.J.; Simon, M.C. A novel hypoxia-inducible factor-independent hypoxic response regulating mammalian target of rapamycin and its targets. J. Biol. Chem. 2003, 278, 29655–29660. [Google Scholar] [CrossRef]
- Akhavan, D.; Cloughesy, T.F.; Mischel, P.S. mTOR signaling in glioblastoma: Lessons learned from bench to bedside. Neuro Oncol. 2010, 12, 882–889. [Google Scholar] [CrossRef]
- Wick, W.; Gorlia, T.; Bendszus, M.; Taphoorn, M.; Sahm, F.; Harting, I.; Brandes, A.A.; Taal, W.; Domont, J.; Idbaih, A.; et al. Lomustine and bevacizumab in progressive glioblastoma. N. Engl. J. Med. 2017, 377, 1954–1963. [Google Scholar] [CrossRef] [PubMed]
- Bowker, S.L.; Majumdar, S.R.; Veugelers, P.; Johnson, J.A. Increased cancer-related mortality for patients with type 2 diabetes who use sulfonylureas or insulin. Diabetes Care 2006, 29, 254–258. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Liang, G.; Yao, Z.; Zhang, J.; Liu, R.; Chen, H.; Zhou, Y.; Wu, H.; Yang, B.; He, Q. Metformin prevents cancer metastasis by inhibiting M2-like polarization of tumor associated macrophages. Oncotarget 2015, 6, 36441–36455. [Google Scholar] [CrossRef] [PubMed]
- Eikawa, S.; Nishida, M.; Mizukami, S.; Yamazaki, C.; Nakayama, E.; Udono, H. Immune-mediated antitumor effect by type 2 diabetes drug, metformin. Proc. Natl. Acad. Sci. USA 2015, 112, 1809–1814. [Google Scholar] [CrossRef] [PubMed]
- Scharping, N.E.; Menk, A.V.; Whetstone, R.D.; Zeng, X.; Delgoffe, G.M. Efficacy of PD-1 Blockade is potentiated by metformin-induced reduction of tumor hypoxia. Cancer Immunol. Res. 2017, 5, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Sesen, J.; Dahan, P.; Scotland, S.J.; Saland, E.; Dang, V.T.; Lemarie, A.; Tyler, B.M.; Brem, H.; Toulas, C.; Cohen-Jonathan Moyal, E.; et al. Metformin inhibits growth of human glioblastoma cells and enhances therapeutic response. PLoS ONE 2015, 10, e0123721. [Google Scholar] [CrossRef]
- Hegi, M.E.; Diserens, A.C.; Gorlia, T.; Hamou, M.F.; de Tribolet, N.; Weller, M.; Kros, J.M.; Hainfellner, J.A.; Mason, W.; Mariani, L.; et al. MGMT gene silencing and benefit from temozolomide in glioblastoma. N. Engl. J. Med. 2005, 352, 997–1003. [Google Scholar] [CrossRef]
- Ceccarelli, M.; Barthel, F.P.; Malta, T.M.; Sabedot, T.S.; Salama, S.R.; Murray, B.A.; Morozova, O.; Newton, Y.; Radenbaugh, A.; Pagnotta, S.M.; et al. Molecular profiling reveals biologically discrete subsets and pathways of progression in diffuse glioma. Cell 2016, 164, 550–563. [Google Scholar] [CrossRef]
- Gravendeel, L.A.; Kouwenhoven, M.C.; Gevaert, O.; de Rooi, J.J.; Stubbs, A.P.; Duijm, J.E.; Daemen, A.; Bleeker, F.E.; Bralten, L.B.; Kloosterhof, N.K.; et al. Intrinsic gene expression profiles of gliomas are a better predictor of survival than histology. Cancer Res. 2009, 69, 9065–9072. [Google Scholar] [CrossRef]
- Chang, W.H.; Forde, D.; Lai, A.G. A novel signature derived from immunoregulatory and hypoxia genes predicts prognosis in liver and five other cancers. J. Transl. Med. 2019, 17, 14. [Google Scholar] [CrossRef]
- Genoud, V.; Marinari, E.; Nikolaev, S.I.; Castle, J.C.; Bukur, V.; Dietrich, P.Y.; Okada, H.; Walker, P.R. Responsiveness to anti-PD-1 and anti-CTLA-4 immune checkpoint blockade in SB28 and GL261 mouse glioma models. Oncoimmunology 2018, 7, e1501137. [Google Scholar] [CrossRef]
- Grauer, O.M.; Molling, J.W.; Bennink, E.; Toonen, L.W.; Sutmuller, R.P.; Nierkens, S.; Adema, G.J. TLR ligands in the local treatment of established intracerebral murine gliomas. J. Immunol. 2008, 181, 6720–6729. [Google Scholar] [CrossRef] [PubMed]
- Cibulskis, K.; Lawrence, M.S.; Carter, S.L.; Sivachenko, A.; Jaffe, D.; Sougnez, C.; Gabriel, S.; Meyerson, M.; Lander, E.S.; Getz, G. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nat. Biotechnol. 2013, 31, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Cosset, E.; Ilmjarv, S.; Dutoit, V.; Elliott, K.; von Schalscha, T.; Camargo, M.F.; Reiss, A.; Moroishi, T.; Seguin, L.; Gomez, G.; et al. Glut3 addiction is a druggable vulnerability for a molecularly defined subpopulation of glioblastoma. Cancer Cell 2017, 32, 856–868. [Google Scholar] [CrossRef]
- Kosaka, A.; Ohkuri, T.; Okada, H. Combination of an agonistic anti-CD40 monoclonal antibody and the COX-2 inhibitor celecoxib induces anti-glioma effects by promotion of type-1 immunity in myeloid cells and T-cells. Cancer Immunol. Immunother. 2014, 63, 847–857. [Google Scholar] [CrossRef] [PubMed]
- Szatmari, T.; Lumniczky, K.; Desaknai, S.; Trajcevski, S.; Hidvegi, E.J.; Hamada, H.; Safrany, G. Detailed characterization of the mouse glioma 261 tumor model for experimental glioblastoma therapy. Cancer Sci. 2006, 97, 546–553. [Google Scholar] [CrossRef]
- Bouaoun, L.; Sonkin, D.; Ardin, M.; Hollstein, M.; Byrnes, G.; Zavadil, J.; Olivier, M. TP53 Variations in human cancers: New lessons from the IARC TP53 database and genomics data. Hum Mutat 2016, 37, 865–876. [Google Scholar] [CrossRef]
- Irizarry, R.A.; Bolstad, B.M.; Collin, F.; Cope, L.M.; Hobbs, B.; Speed, T.P. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. 2003, 31, e15. [Google Scholar] [CrossRef]
- Cancer Genome Atlas Research, N. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 2008, 455, 1061–1068. [Google Scholar] [CrossRef]
- Puchalski, R.B.; Shah, N.; Miller, J.; Dalley, R.; Nomura, S.R.; Yoon, J.G.; Smith, K.A.; Lankerovich, M.; Bertagnolli, D.; Bickley, K.; et al. An anatomic transcriptional atlas of human glioblastoma. Science 2018, 360, 660–663. [Google Scholar] [CrossRef]
- Freije, W.A.; Castro-Vargas, F.E.; Fang, Z.; Horvath, S.; Cloughesy, T.; Liau, L.M.; Mischel, P.S.; Nelson, S.F. Gene expression profiling of gliomas strongly predicts survival. Cancer Res. 2004, 64, 6503–6510. [Google Scholar] [CrossRef] [PubMed]
- Bowman, R.L.; Wang, Q.; Carro, A.; Verhaak, R.G.; Squatrito, M. GlioVis data portal for visualization and analysis of brain tumor expression datasets. Neuro Oncol. 2017, 19, 139–141. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2013; Available online: http://www.R-project.org/ (accessed on 22 June 2016).
- Voros, N.S.; Hubner, M.; Becker, J.; Kuhnle, M.; Thomaitiv, F.; Grasset, A.; Brelet, P.; Bonnot, P.; Campi, F.; Schuler, E.; et al. MORPHEUS: A heterogeneous dynamically reconfigurable platform for designing highly complex embedded systems. ACM Trans. Embed. Comput. Syst. 2013, 12, 1–33. [Google Scholar] [CrossRef]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
- Manalo, D.J.; Rowan, A.; Lavoie, T.; Natarajan, L.; Kelly, B.D.; Ye, S.Q.; Garcia, J.G.; Semenza, G.L. Transcriptional regulation of vascular endothelial cell responses to hypoxia by HIF-1. Blood 2005, 105, 659–669. [Google Scholar] [CrossRef]
- Schodel, J.; Oikonomopoulos, S.; Ragoussis, J.; Pugh, C.W.; Ratcliffe, P.J.; Mole, D.R. High-resolution genome-wide mapping of HIF-binding sites by ChIP-seq. Blood 2011, 117, e207–e217. [Google Scholar] [CrossRef]
- Scarpace, L.F.; Flanders, E.; Jain, R.; Mikkelsen, T.; Andrews, D.W. Data From REMBRANDT. The Cancer Imaging Archive. 2015. Available online: https://gdoc.georgetown.edu/gdoc/ (accessed on 26 November 2018).
- DeBerardinis, R.J.; Chandel, N.S. Fundamentals of cancer metabolism. Sci. Adv. 2016, 2, e1600200. [Google Scholar] [CrossRef]
- Koh, M.Y.; Powis, G. Passing the baton: The HIF switch. Trends Biochem. Sci. 2012, 37, 364–372. [Google Scholar] [CrossRef]
- Murat, A.; Migliavacca, E.; Hussain, S.F.; Heimberger, A.B.; Desbaillets, I.; Hamou, M.F.; Ruegg, C.; Stupp, R.; Delorenzi, M.; Hegi, M.E. Modulation of angiogenic and inflammatory response in glioblastoma by hypoxia. PLoS ONE 2009, 4, e5947. [Google Scholar] [CrossRef]
- Kickingereder, P.; Sahm, F.; Radbruch, A.; Wick, W.; Heiland, S.; Deimling, A.; Bendszus, M.; Wiestler, B. IDH mutation status is associated with a distinct hypoxia/angiogenesis transcriptome signature which is non-invasively predictable with rCBV imaging in human glioma. Sci. Rep. 2015, 5, 16238. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Cheng, X.; Wang, X.; Wang, J.; Wen, X.; Xie, C.; Liao, C. Clinical implications of hypoxia-inducible factor-1alpha and caveolin-1 overexpression in isocitrate dehydrogenase-wild type glioblastoma multiforme. Oncol. Lett. 2019, 17, 2867–2873. [Google Scholar] [CrossRef] [PubMed]
- Metellus, P.; Colin, C.; Taieb, D.; Guedj, E.; Nanni-Metellus, I.; de Paula, A.M.; Colavolpe, C.; Fuentes, S.; Dufour, H.; Barrie, M.; et al. IDH mutation status impact on in vivo hypoxia biomarkers expression: New insights from a clinical, nuclear imaging and immunohistochemical study in 33 glioma patients. J. Neurooncol. 2011, 105, 591–600. [Google Scholar] [CrossRef] [PubMed]
- Lluis, J.M.; Buricchi, F.; Chiarugi, P.; Morales, A.; Fernandez-Checa, J.C. Dual role of mitochondrial reactive oxygen species in hypoxia signaling: Activation of nuclear factor-{kappa}B via c-SRC and oxidant-dependent cell death. Cancer Res. 2007, 67, 7368–7377. [Google Scholar] [CrossRef]
- Kasznicki, J.; Sliwinska, A.; Drzewoski, J. Metformin in cancer prevention and therapy. Ann. Transl. Med. 2014, 2, 57. [Google Scholar] [CrossRef]
- Seliger, C.; Luber, C.; Gerken, M.; Schaertl, J.; Proescholdt, M.; Riemenschneider, M.J.; Meier, C.R.; Bogdahn, U.; Leitzmann, M.F.; Klinkhammer-Schalke, M.; et al. Use of metformin and survival of patients with high-grade glioma. Int. J. Cancer 2019, 144, 273–280. [Google Scholar] [CrossRef]
- Seliger, C.; Genbrugge, E.; Gorlia, T.; Chinot, O.; Stupp, R.; Nabors, B.; Weller, M.; Hau, P.; Group, E.B.T. Use of metformin and outcome of patients with newly diagnosed glioblastoma: Pooled analysis. Int. J. Cancer 2020, 164, 803–809. [Google Scholar] [CrossRef]
- Valtorta, S.; Lo Dico, A.; Raccagni, I.; Gaglio, D.; Belloli, S.; Politi, L.S.; Martelli, C.; Diceglie, C.; Bonanomi, M.; Ercoli, G.; et al. Metformin and temozolomide, a synergic option to overcome resistance in glioblastoma multiforme models. Oncotarget 2017, 8, 113090–113104. [Google Scholar] [CrossRef]
- Lee, J.E.; Lim, J.H.; Hong, Y.K.; Yang, S.H. High-dose metformin plus temozolomide shows increased anti-tumor effects in glioblastoma in vitro and in vivo compared with monotherapy. Cancer Res. Treat. 2018, 50, 1331–1342. [Google Scholar] [CrossRef]
- Gao, L.B.; Tian, S.; Gao, H.H.; Xu, Y.Y. Metformin inhibits glioma cell U251 invasion by downregulation of fibulin-3. Neuroreport 2013, 24, 504–508. [Google Scholar] [CrossRef]
- Al Hassan, M.; Fakhoury, I.; El Masri, Z.; Ghazale, N.; Dennaoui, R.; El Atat, O.; Kanaan, A.; El-Sibai, M. Metformin treatment inhibits motility and invasion of glioblastoma cancer cells. Anal. Cell Pathol. 2018, 2018, 5917470. [Google Scholar] [CrossRef] [PubMed]
- Miller, R.A.; Chu, Q.; Xie, J.; Foretz, M.; Viollet, B.; Birnbaum, M.J. Biguanides suppress hepatic glucagon signalling by decreasing production of cyclic AMP. Nature 2013, 494, 256–260. [Google Scholar] [CrossRef] [PubMed]
- Andrzejewski, S.; Siegel, P.M.; St-Pierre, J. Metabolic profiles associated with metformin efficacy in cancer. Front. Endocrinol. 2018, 9, 372. [Google Scholar] [CrossRef] [PubMed]
- Guimaraes, T.A.; Farias, L.C.; Santos, E.S.; de Carvalho Fraga, C.A.; Orsini, L.A.; de Freitas Teles, L.; Feltenberger, J.D.; de Jesus, S.F.; de Souza, M.G.; Santos, S.H.; et al. Metformin increases PDH and suppresses HIF-1alpha under hypoxic conditions and induces cell death in oral squamous cell carcinoma. Oncotarget 2016, 7, 55057–55068. [Google Scholar] [CrossRef]
- Zhou, X.; Chen, J.; Yi, G.; Deng, M.; Liu, H.; Liang, M.; Shi, B.; Fu, X.; Chen, Y.; Chen, L.; et al. Metformin suppresses hypoxia-induced stabilization of HIF-1alpha through reprogramming of oxygen metabolism in hepatocellular carcinoma. Oncotarget 2016, 7, 873–884. [Google Scholar] [CrossRef]
- Zannella, V.E.; Dal Pra, A.; Muaddi, H.; McKee, T.D.; Stapleton, S.; Sykes, J.; Glicksman, R.; Chaib, S.; Zamiara, P.; Milosevic, M.; et al. Reprogramming metabolism with metformin improves tumor oxygenation and radiotherapy response. Clin. Cancer Res. 2013, 19, 6741–6750. [Google Scholar] [CrossRef]
- Lalau, J.D.; Race, J.M. Lactic acidosis in metformin therapy: Searching for a link with metformin in reports of ‘metformin-associated lactic acidosis’. Diabetes Obes. Metab. 2001, 3, 195–201. [Google Scholar] [CrossRef]
- Gerthofer, V.; Kreutz, M.; Renner, K.; Jachnik, B.; Dettmer, K.; Oefner, P.; Riemenschneider, M.J.; Proescholdt, M.; Vollmann-Zwerenz, A.; Hau, P.; et al. Combined modulation of tumor metabolism by metformin and diclofenac in glioma. Int. J. Mol. Sci. 2018, 19, 2586. [Google Scholar] [CrossRef]
- Griss, T.; Vincent, E.E.; Egnatchik, R.; Chen, J.; Ma, E.H.; Faubert, B.; Viollet, B.; DeBerardinis, R.J.; Jones, R.G. Metformin antagonizes cancer cell proliferation by suppressing mitochondrial-dependent biosynthesis. PLoS Biol. 2015, 13, e1002309. [Google Scholar] [CrossRef]
- Kheirandish, M.; Mahboobi, H.; Yazdanparast, M.; Kamal, W.; Kamal, M.A. Anti-cancer Effects of Metformin: Recent Evidences for its Role in Prevention and Treatment of Cancer. Curr. Drug Metab. 2018, 19, 793–797. [Google Scholar] [CrossRef]
- Rotermund, C.; Machetanz, G.; Fitzgerald, J.C. The therapeutic potential of metformin in neurodegenerative diseases. Front. Endocrinol. 2018, 9, 400. [Google Scholar] [CrossRef]
- Liu, J.; Zhang, C.; Hu, W.; Feng, Z. Tumor suppressor p53 and its mutants in cancer metabolism. Cancer Lett. 2015, 356, 197–203. [Google Scholar] [CrossRef]
- Molina, J.R.; Sun, Y.; Protopopova, M.; Gera, S.; Bandi, M.; Bristow, C.; McAfoos, T.; Morlacchi, P.; Ackroyd, J.; Agip, A.A.; et al. An inhibitor of oxidative phosphorylation exploits cancer vulnerability. Nat. Med. 2018, 24, 1036–1046. [Google Scholar] [CrossRef]
- Shi, Y.; Lim, S.K.; Liang, Q.; Iyer, S.V.; Wang, H.Y.; Wang, Z.; Xie, X.; Sun, D.; Chen, Y.J.; Tabar, V.; et al. Gboxin is an oxidative phosphorylation inhibitor that targets glioblastoma. Nature 2019, 567, 341–346. [Google Scholar] [CrossRef]
- Ben Sahra, I.; Regazzetti, C.; Robert, G.; Laurent, K.; Le Marchand-Brustel, Y.; Auberger, P.; Tanti, J.F.; Giorgetti-Peraldi, S.; Bost, F. Metformin, independent of AMPK, induces mTOR inhibition and cell-cycle arrest through REDD1. Cancer Res. 2011, 71, 4366–4372. [Google Scholar] [CrossRef]
- Dallaglio, K.; Bruno, A.; Cantelmo, A.R.; Esposito, A.I.; Ruggiero, L.; Orecchioni, S.; Calleri, A.; Bertolini, F.; Pfeffer, U.; Noonan, D.M.; et al. Paradoxic effects of metformin on endothelial cells and angiogenesis. Carcinogenesis 2014, 35, 1055–1066. [Google Scholar] [CrossRef]





| Gene ID | Forward Primer | Reverse Primer |
|---|---|---|
| ADM | TGCCCAGACCCTTATTCG | CCGGAGGCCCTGGAAGT |
| ALDOC | ATGCCTCACTCGTACCCAG | TTTCCACCCCAATTTGGCTCA |
| ANGPTL4 | GGCTCAGTGGACTTCAACCG | CCGTGATGCTATGCACCTTCT |
| ANKRD37 | TTAGGAGAAGCTCCACTACACAA | CACTGGCTACAAGCAGGCT |
| ARRDC3 | TGTATTCTAGTGGGGATACCGTC | TCGCATGTCCTCTTGCATGAA |
| BHLHE40 | ATCCAGCGGACTTTCGCTC | TAATTGCGCCGATCCTTTCTC |
| CA9 | GGATCTACCTACTGTTGAGGCT | CATAGCGCCAATGACTCTGGT |
| DDIT4 | TGAGGATGAACACTTGTGTGC | CCAACTGGCTAGGCATCAGC |
| EGLN3 | TCCTGCGGATATTTCCAGAGG | GGTTCCTACGATCTGACCAGAA |
| HAS2 | CACTGGGACGAAGTGTGGATTA | GCATAGTGTCTGAATCACAAACCTG |
| HILPDA | GCGCTTTTGTCTCCGGGTC | GTAAGCCCTCTAGGGACTCCA |
| HK2 | GAGCCACCACTCACCCTACT | CCAGGCATTCGGCAATGTG |
| PGK1 | GAACAAGGTTAAAGCCGAGCC | GTGGCAGATTGACTCCTACCA |
| NDRG1 | CTCCTGCAAGAGTTTGATGTCC | TCATGCCGATGTCATGGTAGG |
| PDK1 | GGATTGCCCATATCACGTCTTT | TCCCGTAACCCTCTAGGGAATA |
| SLC2A1 | TCTGGCATCAACGCTGTCTTC | CGATACCGGAGCCAATGGT |
| SLC2A3 | TCCACGCTCATGACTGTTTC | GCCTGGTCCAATTTCAAAGA |
| STC1 | AGGTGCAGGAAGAGTGCTACA | GACGACCTCAGTGATGGCTT |
| TMEM45A | GCATGGCTTTAACTGGCATGG | CAGCCCAGGAGTTGATTCCA |
| VEGFA | AGGGCAGAATCATCACGAAGT | AGGGTCTCGATTGGATGGCA |
| Hypoxia Signature | |||
|---|---|---|---|
| Tumor Variables Initial Diagnosis, n | Low Expression (n = 161) | High Expression (n = 367) | p-Value |
| MGMT gene promoter status, n | 0.574 | ||
| Unmethylated | 52 | 125 | |
| Methylated | 57 | 113 | |
| Unknown | 52 | 129 | |
| IDH gene status, n | <0.001 | ||
| Mutant | 23 | 7 | |
| Wildtype | 109 | 263 | |
| Unknown | 29 | 97 | |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Calvo Tardón, M.; Marinari, E.; Migliorini, D.; Bes, V.; Tankov, S.; Charrier, E.; McKee, T.A.; Dutoit, V.; Dietrich, P.-Y.; Cosset, E.; et al. An Experimentally Defined Hypoxia Gene Signature in Glioblastoma and Its Modulation by Metformin. Biology 2020, 9, 264. https://doi.org/10.3390/biology9090264
Calvo Tardón M, Marinari E, Migliorini D, Bes V, Tankov S, Charrier E, McKee TA, Dutoit V, Dietrich P-Y, Cosset E, et al. An Experimentally Defined Hypoxia Gene Signature in Glioblastoma and Its Modulation by Metformin. Biology. 2020; 9(9):264. https://doi.org/10.3390/biology9090264
Chicago/Turabian StyleCalvo Tardón, Marta, Eliana Marinari, Denis Migliorini, Viviane Bes, Stoyan Tankov, Emily Charrier, Thomas A McKee, Valérie Dutoit, Pierre-Yves Dietrich, Erika Cosset, and et al. 2020. "An Experimentally Defined Hypoxia Gene Signature in Glioblastoma and Its Modulation by Metformin" Biology 9, no. 9: 264. https://doi.org/10.3390/biology9090264
APA StyleCalvo Tardón, M., Marinari, E., Migliorini, D., Bes, V., Tankov, S., Charrier, E., McKee, T. A., Dutoit, V., Dietrich, P.-Y., Cosset, E., & Walker, P. R. (2020). An Experimentally Defined Hypoxia Gene Signature in Glioblastoma and Its Modulation by Metformin. Biology, 9(9), 264. https://doi.org/10.3390/biology9090264

