Occurrence of Antibiotic-Resistant Bacteria and Genes in Two Drinking Water Treatment and Distribution Systems in the North-West Province of South Africa
Abstract
1. Introduction
2. Results
2.1. Physicochemical Water Quality Parameters
2.2. Bacteriological Water Quality
2.3. Antimicrobial Resistance Profiles of Heterotrophic Bacterial Isolates
2.4. Extracellular Enzyme Production
2.5. Prevalence of Antibiotic Resistance Genes in MDR Isolates
2.6. Identification of MDR Isolates Based on 16S rRNA Gene Sequences
3. Discussion
4. Materials and Methods
4.1. Ethical Considerations
4.2. Study Area and Selection of Sampling Points
4.3. Determination of the Physicochemical Parameters of Water Samples
4.4. Enumeration of Indicator Organisms and Isolation of Heterotrophic Bacteria
4.5. Phenotypic Antibiotic Resistance Testing
4.6. Antibiotic Resistance Risk Assessment of Heterotrophic Bacterial Isolates
4.7. Production of Extracellular Enzymes
4.8. Molecular Characterisation of Isolates
4.8.1. Extraction of Chromosomal DNA
4.8.2. Detection of Antibiotic Resistance Genes
4.8.3. Identification of MDR Isolates by Bacterial 16S rRNA Gene Analysis
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Riley, M.R.; Gerba, C.P.; Elimelech, M. Biological approaches for addressing the grand challenge of providing access to clean drinking water. J. Biol. Eng. 2011, 5, 2. [Google Scholar] [CrossRef] [Scilit]
- Cizmas, L.; Sharma, V.K.; Gray, C.M.; McDonald, T.J. Pharmaceuticals and personal care products in waters: Occurrence, toxicity, and risk. Environ. Chem. Lett. 2015, 13, 381–394. [Google Scholar] [CrossRef] [Scilit]
- Evgenidou, E.N.; Konstantinou, I.K.; Lambropoulou, D.A. Occurrence and removal of transformation products of PPCPs and illicit drugs in wastewaters: A review. Sci. Total Environ. 2015, 505, 905–926. [Google Scholar] [CrossRef] [Scilit]
- Yi, X.; Lin, C.; Ong, E.J.L.; Wang, M.; Li, B.; Zhou, Z. Expression of resistance genes instead of gene abundance are correlated with trace levels of antibiotics in urban surface waters. Environ. Pollut. 2019, 250, 437–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, R.; Feng, J.; Liu, J.; Fu, W.; Li, X.; Li, B. Deciphering of microbial community and antibiotic resistance genes in activated sludge reactors under high selective pressure of different antibiotics. Water Res. 2019, 151, 388–402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aali, R.; Nikaeen, M.; Khanahmad, H.; Hassanzadeh, A. Monitoring and comparison of antibiotic resistant bacteria and their resistance genes in municipal and hospital wastewaters. Int. J. Prev. Med. 2014, 5, 887. [Google Scholar] [PubMed]
- Michael, C. CDC’s Antibiotic Resistance Threats Report. 2019. Available online: https://www.hhs.gov/sites/default/files/michael-craig-cdc-talk-thursday-am-508.pdf (accessed on 8 October 2020).
- Qin, K.; Wei, L.; Li, J.; Lai, B.; Zhu, F.; Yu, H.; Zhao, Q.; Wang, K. A review of ARGs in WWTPs: Sources, stressors and elimination. Chin. Chem. Lett. 2020, in press. [Google Scholar] [CrossRef] [Scilit]
- Zainab, S.M.; Junaid, M.; Xu, N.; Malik, R.N. Antibiotics and antibiotic resistant genes (ARGs) in groundwater: A global review on dissemination, sources, interactions, environmental and human health risks. Water Res. 2020. [Google Scholar] [CrossRef] [Scilit]
- Chee-Sanford, J.C.; Mackie, R.I.; Koike, S.; Krapac, I.G.; Lin, Y.-F.; Yannarell, A.C.; Maxwell, S.; Aminov, R.I. Fate and transport of antibiotic residues and antibiotic resistance genes following land application of manure waste. J. Environ. Q. 2009, 38, 1086–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ventola, C.L. The antibiotic resistance crisis: Part 1: Causes and threats. Pharm. Ther. J. 2015, 40, 277–283. [Google Scholar]
- Pallares-Vega, R.; Blaak, H.; van der Plaats, R.; de Roda Husman, A.M.; Leal, L.H.; van Loosdrecht, M.C.; Weissbrodt, D.G.; Schmitt, H. Determinants of presence and removal of antibiotic resistance genes during WWTP treatment: A cross-sectional study. Water Res. 2019, 161, 319–328. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. WHO Report on Surveillance of Antibiotic Consumption: 2016–2018 Early Implementation; WHO: Geneva, Switzerland, 2018. [Google Scholar]
- DWAF. South African Water Quality Guidelines, 2nd ed.; Volume 7: Aquatic Ecosystems; Department of Water Affairs and Forestry: Pretoria, South Africa, 1996. [Google Scholar]
- van Zyl, J.E. Introduction to Operation and Maintenance of Water Distribution Systems, 1st ed.; Water Research Commission: Pretoria, South Africa, 2014; pp. 11–130. [Google Scholar]
- USEPA. Health Risks from Microbial Growth and Biofilms in Drinking Water Distribution Systems; USEPA: Washington, DC, USA, 2002; pp. 1–50. [Google Scholar]
- Mulamattathil, S.G.; Bezuidenhout, C.; Mbewe, M. Biofilm formation in surface and drinking water distribution systems in Mafikeng, South Africa. S. Afr. J. Sci. 2014, 110, 1–9. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization (WHO). Emerging Issues in Water and Infectious Diseases; World Health Organization: Geneva, Switzerland, 2002. [Google Scholar]
- World Health Organization (WHO). Guidelines for Drinking Water Quality, 4th ed.; WHO Press: Geneva, Switzerland, 2011. [Google Scholar]
- Chang, Q.; Wang, W.; Regev-Yochay, G.; Lipsitch, M.; Hanage, W.P. Antibiotics in agriculture and the risk to human health: How worried should we be? Evol. Appl. 2015, 8, 240–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thanner, S.; Drissner, D.; Walsh, F. Antimicrobial resistance in agriculture. mBio 2016, 7, e02227-15. [Google Scholar] [CrossRef] [Scilit]
- Ateba, C.N.; Mbewe, M. Detection of Escherichia coli O157: H7 virulence genes in isolates from beef, pork, water, human and animal species in the North West province, South Africa: Public health implications. Res. MicroBiol. 2010, 162, 240–248. [Google Scholar] [CrossRef] [Scilit]
- Ateba, C.N.; Mbewe, M. Determination of the genetic similarities of fingerprints from Escherichia coli O157: H7 isolated from different sources in the North West Province, South Africa using ISR, BOXAIR and REP-PCR analysis. MicroBiol. Res. 2013, 168, 438–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mulamattathil, S.G.; Bezuidenhout, C.; Mbewe, M.; Ateba, C.N. Isolation of environmental bacteria from surface and drinking water in Mafikeng, South Africa, and characterization using their antibiotic resistance profiles. J. Pathog. 2014, 2014, 371208. [Google Scholar] [CrossRef] [Scilit]
- National Research Council (NRC). Drinking Water Distribution Systems; Assessing and Reducing Risks; National Academies Press: Washington, DC, USA, 2007. [Google Scholar]
- Inomata, A.; Chiba, T.; Hosaka, M. Identification of heterotrophic plate count bacteria isolated from drinking water in Japan by DNA sequencing analysis. Biocontrol. Sci. 2009, 14, 139–145. [Google Scholar] [CrossRef] [Scilit]
- Sun, W.; Liu, W.; Cui, L.; Zhang, M.; Wang, B. Characterization and identification of a chlorine-resistant bacterium, Sphingomonas TS001, from a model drinking water distribution system. Sci. Total Environ. 2013, 458, 169–175. [Google Scholar] [CrossRef] [Scilit]
- Khan, S.; Beattie, T.K.; Knapp, C.W. Relationship between antibiotic-and disinfectant-resistance profiles in bacteria harvested from tap water. Chemosphere 2016, 152, 132–141. [Google Scholar] [CrossRef] [Scilit]
- Khan, S.; Beattie, T.K.; Knapp, C.W. Rapid selection of antimicrobial-resistant bacteria in complex water systems by chlorine and pipe materials. Environ. Chem. Lett. 2019, 17, 1367–1373. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.J.; Hu, H.Y.; Wu, Y.H.; Wei, B.; Lu, Y. Effect of chlorination and ultraviolet disinfection on tetA-mediated tetracycline resistance of Escherichia coli. Chemosphere 2013, 90, 2247–2253. [Google Scholar] [CrossRef] [Scilit]
- Shi, P.; Jia, S.; Zhang, X.X.; Zhang, T.; Cheng, S.; Li, A. Metagenomic insights into chlorination effects on microbial antibiotic resistance in drinking water. Water Res. 2013, 47, 111–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- WHO/UNICEF JoInt. Water Supply, Sanitation Monitoring Programme and World Health Organization, Progress on Sanitation and Drinking Water: 2015 Update and MDG Assessment; World Health Organization: Geneva, Switzerland, 2015. [Google Scholar]
- Behera, B.; Bhoriwal, S.; Mathur, P.; Sagar, S.; Singhal, M.; Misra, M.C. Post-traumatic skin and soft tissue infection due to Aeromonas Hydrophila. Indian J. Crit. Care Med. 2011, 15, 49–51. [Google Scholar] [PubMed]
- Blue Drop Report, Department of Water and Sanitation, 2014. Available online: http://www.ewisa.co.za/misc/BLUE_GREENDROPREPORT/GREEN%20BLUE%20DROP/2014BlueDropReportExecutiveSummary_ToPDF.pdf (accessed on 15 November 2016).
- Rahmanian, N.; Ali, S.H.B.; Homayoonfard, M.; Ali, N.J.; Rehan, M.; Sadef, Y.; Nizami, A.S. Analysis of physiochemical parameters to evaluate the drinking water quality in the State of Perak, Malaysia. J. Chem. 2015, 2015, 716125. [Google Scholar] [CrossRef] [Scilit]
- Huijbers, P.M.; Blaak, H.; de Jong, M.C.; Graat, E.A.; Vandenbroucke-Grauls, C.M.; de Roda Husman, A.M. Role of the environment in the transmission of antimicrobial resistance to humans: A review. Environ. Sci. Technol. 2015, 49, 11993–12004. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kinge, C.N.W.; Ateba, C.N.; Kawadza, D.T. Antibiotic resistance profiles of Escherichia coli isolated from different water sources in the Mmabatho locality, North-West Province. S. Afr. J. Sci. 2010, 106, 44–49. [Google Scholar] [CrossRef] [Scilit]
- Su, H.C.; Liu, Y.S.; Pan, C.G.; Chen, J.; He, L.Y.; Ying, G.G. Persistence of antibiotic resistance genes and bacterial community changes in drinking water treatment system: From drinking water source to tap water. Sci. Total Environ. 2018, 616, 453–461. [Google Scholar] [CrossRef] [Scilit]
- Joint United Nations Programme on HIV/AIDS, UNAIDS, 2018. Available online: https://www.unaids.org/en/regionscountries/countries/southafrica (accessed on 10 February 2020).
- Munir, M.; Wong, K.; Xagoraraki, I. Release of antibiotic resistant bacteria and genes in the effluent and biosolids of five wastewater utilities in Michigan. Water Res. 2011, 45, 681–693. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, M.; Mamun, A.A.; Morshed, S.; Islam, M.S.; Hoque, M.M.; Sarwar, N.; Kobra, K.T.; Junayed, M.; Ahmed, T. Microbial safety of drinking jar water and antimicrobial resistant pattern against Escherichia coli in jar water at Chittagong, Bangladesh. Int. Food Res. J. 2018, 25, 597–601. [Google Scholar]
- Vaz-Moreira, I.; Nunes, O.C.; Manaia, C.M. Diversity and antibiotic resistance patterns of Sphingomonadaceae isolates from drinking water. Appl. Environ. MicroBiol. 2011, 77, 5697–5706. [Google Scholar] [CrossRef] [Scilit]
- Bird, K.; Boopathy, R.; Nathaniel, R.; LaFleur, G. Water pollution and observation of acquired antibiotic resistance in Bayou Lafourche, a major drinking water source in Southeast Louisiana, USA. Environ. Sci. Pollut. Res. 2019, 26, 4220–4232. [Google Scholar] [CrossRef] [Scilit]
- Carballa, M.; Omil, F.; Lema, J.M.; Llompart, M.; García-Jares, C.; Rodríguez, I.; Gomez, M.; Ternes, T. Behavior of pharmaceuticals, cosmetics and hormones in a sewage treatment plant. Water Res. 2004, 38, 2918–2926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lindberg, R.H.; Wennberg, P.; Johansson, M.I.; Tysklind, M.; Andersson, B.A. Screening of human antibiotic substances and determination of weekly mass flows in five sewage treatment plants in Sweden. Environ. Sci. Technol. 2005, 39, 3421–3429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pruden, A.; Arabi, M.; Storteboom, H.N. Correlation between upstream human activities and riverine antibiotic resistance genes. Environ. Sci. Technol. 2012, 46, 11541–11549. [Google Scholar] [CrossRef] [Scilit]
- Gebreyes, W.A.; Altier, C. Molecular characterization of multidrug-resistant Salmonella enterica subsp enterica serovar Typhimurium isolates from swine. J. Clin. MicroBiol. 2002, 40, 2813–2822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sundin, G.W. Examination of base pair variants of the strA–strB streptomycin resistance genes from bacterial pathogens of humans, animals and plants. J. Antimicrob. Chemother. 2000, 46, 848–849. [Google Scholar] [CrossRef] [Scilit]
- Miller, R.A.; Beno, S.M.; Kent, D.J.; Carroll, L.M.; Martin, N.H.; Boor, K.J.; Kovac, J. Bacillus wiedmannii sp nov., a psychrotolerant and cytotoxic Bacillus cereus group species isolated from dairy foods and dairy environments. Int. J. Syst. Evol. Micr. 2016, 66, 4744–4753. [Google Scholar] [CrossRef] [Scilit]
- Brolund, A.; Sundqvist, M.; Kahlmeter, G.; Grape, M. Molecular characterisation of Trimethoprim resistance in Escherichia coli and Klebsiella pneumoniae during a two-year intervention on Trimethoprim use. PLoS ONE 2010, 5, e9233. [Google Scholar] [CrossRef] [Scilit]
- Holstein, A.; Grillon, A.; Yzon, L.; Morange, V.; Baty, G.; Lartigue, M.F.; Mereghetti, L.; Goudeau, A.; Lanotte, P. Prevalence of extended-spectrum beta-lactamases of the CTX-M type producing Escherichia coli and Klebsiella pneumoniae in Bretonneau hospitals (CHRU Tours). Pathol. Biol. 2010, 58, 67–69. [Google Scholar] [CrossRef] [Scilit]
- Magro, P.; Garand, G.; Cattier, B.; Renjard, L.; Marquette, C.H.; Diot, P. Association of tracheobronchopathia osteochondroplastica and ozene. Rev. Mal. Respir. 2007, 24, 883–887. [Google Scholar] [CrossRef] [Scilit]
- Alves, M.S.; da Silva Dias, R.C.; de Castro, A.C.D.; Riley, L.W.; Moreira, B.M. Identification of clinical isolates of indole-positive and indole-negative Klebsiella spp. J. Clin. MicroBiol. 2006, 44, 3640–3646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maatallah, M.; Vading, M.; Kabir, M.H.; Bakhrouf, A.; Kalin, M.; Nauclér, P.; Brisse, S.; Giske, C.G. Klebsiella variicola is a frequent cause of bloodstream infection in the Stockholm area, and associated with higher mortality compared to K. pneumoniae. PLoS ONE 2014, 9, e113539. [Google Scholar] [CrossRef] [Scilit]
- American Public Health Association (APHA). Standard Methods for Examination of Water and Waste, 18th ed.; American Public Health Association: Washington, DC, USA, 1992. [Google Scholar]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 24th Informational Supplement CLSI Document M100-S24; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2014. [Google Scholar]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 17th Informational Supplement M100-S17; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2007. [Google Scholar]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing 26th CLSI Supplement M100S; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2016. [Google Scholar]
- Burch, T.R.; Sadowsky, M.J.; LaPara, T.M. Aerobic digestion reduces the quantity of antibiotic resistance genes in residual municipal wastewater solids. Front. MicroBiol. 2013, 4, 17. [Google Scholar] [CrossRef] [Scilit]
- Bergeron, S.; Boopathy, R.; Nathaniel, R.; Corbin, A.; LaFleur, G. Presence of antibiotic resistant bacteria and antibiotic resistance genes in raw source water and treated drinking water. Int. Biodeterior. Biodegrad. 2015, 102, 370–374. [Google Scholar] [CrossRef] [Scilit]
- Poirel, L.; Guibert, M.; Girlich, D.; Naas, T.; Nordmann, P. Cloning, sequence analyses expression and distribution of ampC-ampR from Morganella morganii clinical isolates. Antimicrob. Agents Chemother. 1999, 43, 769–776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lanz, R.; Kuhnert, P.; Boerlin, P. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland. Vet. MicroBiol. 2003, 91, 73–84. [Google Scholar] [PubMed]
- Keyes, K.; Hudson, C.; Maurer, J.; Thayer, S.; White, D.G.; Lee, M.D. Detection of Florfenicol Resistance Genes in Escherichia coli isolated from sick chickens. Antimicrob. Agents Chemother. 2000, 44, 421–424. [Google Scholar] [PubMed]
- Dutka-Malen, S.; Evers, S.; Courvalin, P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J. Clin. MicroBiol. 1995, 33, 24–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kadlec, K.; Kehrenberg, C.; Schwarz, S. Molecular basis of resistance to Trimethoprim, Chloramphenicol and sulphonamides in Bordetella Bronchiseptica. J. Antimicrob. Chemother. 2005, 56, 485–490. [Google Scholar]
- Novais, Â.; Comas, I.; Baquero, F.; Cantón, R.; Coque, T.M.; Moya, A.; González-Candelas, F.; Galan, J.C. Evolutionary trajectories of beta-lactamase CTX-M-1 cluster enzymes: Predicting antibiotic resistance. PLoS Pathog. 2010, 6, e1000735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lane, D.J. 16S/23S rRNA Sequencing Nucleic Acid Techniques in Bacterial Systematics; John Wiley and Sons: New York, NY, USA, 1991; pp. 115–175. [Google Scholar]
| Season | Temperature °C | pH | EC (µS/cm) | TDS (mg/L) | |||||
|---|---|---|---|---|---|---|---|---|---|
| Blue Drop Limit [34] | - | - | ≥5 to ≤9.7 | ≤170 | ≤1200 | ||||
| Site | A | B | A | B | A | B | A | B | |
| Winter | Raw | 18.7 | 10.4 | 9.53 | 7.76 | 800 | 405 | 508 | 827 |
| Inlet | 16.5 | 21.0 | 9.40 | 8.55 | 776 | 289 | 489 | 182 | |
| Outlet | 18.5 | 21.2 | 8.94 | 8.52 | 846 | 309 | 533 | 195 | |
| D1 | 21.0 | 22.2 | 9.17 | 7.73 | 750 | 805 | 473 | 507 | |
| D2 | 19.6 | 27.0 | 9.62 | 8.17 | 656 | 360 | 413 | 192.9 | |
| Spring | Raw | 25.7 | 24.6 | 9.94 | 8.96 | 763 | 390 | 481 | 246 |
| Inlet | 23.9 | 26.5 | 9.93 | 8.79 | 774 | 305 | 487 | 192 | |
| Outlet | 24.8 | 24.5 | 9.47 | 8.85 | 773 | 321 | 487 | 202 | |
| D1 | 27.0 | 31.1 | 9.17 | 8.56 | 703 | 321 | 443 | 202 | |
| D2 | 28.3 | 26.5 | 8.37 | 8.78 | 677 | 305 | 426 | 192.2 | |
| Summer | Raw | 28.5 | 24.5 | 7.42 | 7.84 | 283 | 262 | 180.9 | 167.3 |
| Inlet | 22.5 | 25.2 | 7.37 | 7.64 | 239 | 270 | 152.3 | 169.2 | |
| Outlet | 22.3 | 24.8 | 7.47 | 7.6 | 256 | 271 | 164.1 | 172.9 | |
| D1 | 27.8 | 26.8 | 7.34 | 7.64 | 287 | 280 | 183.2 | 179.6 | |
| D2 | 26.4 | 29.2 | 7.37 | 7.61 | 876 | 284 | 559 | 182.5 | |
| Autumn | Raw | 23.5 | 17.6 | 8.86 | 9.56 | 375 | 366 | 765 | 747 |
| Inlet | 20.9 | 20.0 | 8.58 | 8.65 | 374 | 357 | 764 | 717 | |
| Outlet | 21.1 | 21.0 | 8.28 | 8.43 | 398 | 355 | 811 | 727 | |
| D1 | 22.4 | 24.6 | 9.03 | 8.88 | 400 | 370 | 816 | 760 | |
| D2 | 21.8 | 25.6 | 8.66 | 8.62 | 387 | 338 | 789 | 690 | |
| Site | Source | Total Coliform (cfu/100 mL) Blue Drop Limit, <10 [34] | Fecal Coliform (cfu/100 mL) Blue Drop Limit, 0 [34] | E. coli (cfu/100 mL) Blue Drop Limit, 0 [34] | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Winter | Spring | Summer | Autumn | Winter | Spring | Summer | Autumn | Winter | Spring | Summer | Autumn | ||
| A | Raw | 5 | 17 | 5 | 1 | 2 | 7 | 2 | 3 | - | 24 | - | 17 |
| Inlet | 3 | 1 | 3 | - | 4 | 1 | 4 | - | 2 | 5 | 2 | 7 | |
| Outlet | - | - | - | - | 5 | - | 5 | - | - | - | - | - | |
| D1 | 4 | - | 4 | - | 3 | - | 3 | - | - | - | - | - | |
| D2 | - | 1 | - | - | - | 1 | - | - | - | - | - | - | |
| B | Raw | 1 | 52 | 1 | 21 | 7 | 12 | 7 | 1 | 1 | 62 | 1 | 5 |
| Inlet | 5 | - | 5 | 3 | 7 | 6 | 6 | 5 | 2 | - | 2 | 1 | |
| Outlet | - | - | - | - | 1 | - | 1 | - | - | - | - | - | |
| D1 | 21 | - | 21 | - | 9 | - | 9 | - | - | - | - | - | |
| D2 | 2 | - | - | - | - | - | - | - | - | - | - | - | |
| Antibiotics | Site A | Site B | Total | ||
|---|---|---|---|---|---|
| Before Treatment NT = 40 (28G+, 12G-) | After Treatment NT = 62 (41G+, 21G-) | Before Treatment NT = 37 (27G+, 10G-) | After Treatment NT = 64 (43G+, 21G-) | NT = 203 (139G+, 64G-) | |
| AP * | 15 (53.6) | 25 (61.0) | 25 (92.6) | 24 (55.8) | 89 (64) |
| PG * | 12 (42.9) | 24 (58.5) | 19 (70.4) | 17 (39.5) | 72 (51.8) |
| VA * | 3 (10.7) | 7 (17.1) | 10 (37.0) | 9 (20.9) | 29 (20.9) |
| E | 1 (2.5) | 3 (4.8) | 2 (5.4) | 2 (3.1) | 8 (3.9) |
| CHL | 6 (15) | 11 (17.7) | 8 (21.6) | 10 (15.6) | 35 (17.2) |
| KF | 0 (0.0) | 1 (1.6) | 4 (10.8) | 7 (10.9) | 12 (5.9) |
| S | 5 (12.5) | 11(11.7) | 4 (10.8) | 11 (17.2) | 31(15.3) |
| K | 5 (12.5) | 19 (30.6) | 10 (27.0) | 11 (17.2) | 45 (22.2) |
| NE | 1 (2.5) | 3 (4.8) | 3 (8.1) | 8 (12.5) | 15 (7.4) |
| OT | 4 (10) | 10 (16.1) | 15 (40.5) | 11 (17.2) | 40 (19.7) |
| CIP | 1 (2.5) | 1 (1.6) | 1 (2.7) | 1 (1.6) | 4 (2.0) |
| TM | 17 (42.5) | 31 (50) | 27 (73.0) | 30 (46.9) | 105 (51.7) |
| Target Gene | Primer Sequence (5′-3′) | Amplicon Size (bp) | Cycling Conditions | Reference |
|---|---|---|---|---|
| erm(B) | F: GATACCGTTTACGAAATTGG | 364 | 58 °C for 1 min, 72 °C for 1 min, and a final elongation of 72 °C for 1 min. | [59] |
| R: GAATCGAGACTTGAG TGTGC | ||||
| sul1 | F: CCGTTGGCCTTCCTGTAAAG | 67 | 94 °C for 5 min, 30 cycles of 94 °C 30 s, 58 °C for 1 min, 72 °C for 1 min, and a final elongation of 72 °C for 10 min. | |
| R: TTG CCGATCGCGTGAAGT | ||||
| tet(A) | F: GCTACATCCTGCTTGCCTTC | 210 | 95 °C for 1 min, 40 cycles of 95 °C 15 s, 62 °C for 1 min, 72 °C for 1 min, and a final elongation of 72 °C for 10 min. | [60] |
| R: CATAGATCGCCGTGAAGAGG | ||||
| tet(W) | F: GAGAGCCTGCTATATGCCAGC | 168 | ||
| R: GGGCGTATCCAC AATGTTAAC | ||||
| tet(X) | F: AGCCTTACCAATGGGTGTAAA | 278 | ||
| R: TTCTTACCTTGGACATCCCG | ||||
| mec(A) | F: ATGCGCTATAGATTGAAAGGAT | 163 | 95 °C for 1 min, 40 cycles of 95 °C for 15 s, 60 °C for 1 min for 1 min, 72 °C for 1 min, and a final elongation of 72 °C for 10 min. | |
| R: TACGCGATATCTAACTTTCCTA | ||||
| ampC | F: TTCTATCAAMACTGGCARCC | 1048 | 95 °C for 1 min; 35 cycles of 94 °C 30 s, 49 °C for 30 s, 72 °C for 1 min and a final elongation of 72 °C for 10 min. | [61] |
| R: CCYTTTTATGTACCCAYGA | ||||
| strA | F: CTTGGTGATAACGGCAATTC | 548 | 94 °C for 1 min, 30 cycles of 94 °C for 45 s, 58 °C for 45 s, 72 °C for 45 s and a final elongation of 72 °C for 7 min | [47] |
| R: CCAATCGCAGATAGAAGGC | ||||
| strB | F: ATCGTCAAGGGATTGAAACC | 509 | ||
| R: GGATCGTAGAACATATTGGC | ||||
| aadA | F: GTGGATGGCGGCCTGAAGCC | 525 | 95 °C for 4 min, 30 cycles of 94 °C for 45 s, 60 °C for 45 s, 72 °C for 45 s, and a final elongation of 72 °C for 10 min. | [62] |
| R: AATGCCCAGTCGGCAGCG | ||||
| cmlA | F: CCGCCACGGTGTTGTTGTTATC | 698 | 95 °C for 2 min, 30 cycles of 94 °C for 1 s, 40 °C for 1 s, 72 °C for 15 s, and a final elongation of 72 °C for 10 min. | [63] |
| R: CACCTTGCCTGCCCATCATTAG | ||||
| vanA | F: GGGAAAACGACAATTGC | 732 | 94 °C for 3 min, 32 cycles of 94 °C for 30 s, 60 °C for 45 s, 72 °C for 2 min, and a final elongation of 72 °C for 10 min. | [64] |
| R: GTACAATGCGGCCGTTA | ||||
| dfrB1, dfrB2 | F: CAAAGTAGCGATGAAGCCA | 205 | 95 °C 10 min, 30 cycles of 95 °C for 15 s, 50 for 1 min, 72 °C for 1 min, and a final elongation of 72 °C for 10 min. | [65] |
| R: CAGGATAAATTTGCACTGAGC | ||||
| blaCTX-M | F: ATGTGCAGYACCAGTAA | 536 | 94 °C for 5 min, 40 cycles of 94 °C for 1 min, 57 °C for 1 min, 72 °C for 1 min, and a final elongation of 72 °C for 10 min. | [66] |
| R: CCGCTGCCGGTYTTATC | ||||
| Bacterial 16S rRNA | F: AGAGTTTGATCATGGCTCAG | 1420 | 94 °C, 3 min. 25 times (94°C, 1 min; 55°C, 1 min) 72 °C, 2 min. | [67] |
| R: GGTACCTTGTTACGACTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ateba, C.N.; Tabi, N.M.; Fri, J.; Bissong, M.E.A.; Bezuidenhout, C.C. Occurrence of Antibiotic-Resistant Bacteria and Genes in Two Drinking Water Treatment and Distribution Systems in the North-West Province of South Africa. Antibiotics 2020, 9, 745. https://doi.org/10.3390/antibiotics9110745
Ateba CN, Tabi NM, Fri J, Bissong MEA, Bezuidenhout CC. Occurrence of Antibiotic-Resistant Bacteria and Genes in Two Drinking Water Treatment and Distribution Systems in the North-West Province of South Africa. Antibiotics. 2020; 9(11):745. https://doi.org/10.3390/antibiotics9110745
Chicago/Turabian StyleAteba, Collins Njie, Naledi Mahalia Tabi, Justine Fri, Marie Ebob Agbortabot Bissong, and Cornelius Carlos Bezuidenhout. 2020. "Occurrence of Antibiotic-Resistant Bacteria and Genes in Two Drinking Water Treatment and Distribution Systems in the North-West Province of South Africa" Antibiotics 9, no. 11: 745. https://doi.org/10.3390/antibiotics9110745
APA StyleAteba, C. N., Tabi, N. M., Fri, J., Bissong, M. E. A., & Bezuidenhout, C. C. (2020). Occurrence of Antibiotic-Resistant Bacteria and Genes in Two Drinking Water Treatment and Distribution Systems in the North-West Province of South Africa. Antibiotics, 9(11), 745. https://doi.org/10.3390/antibiotics9110745

