Physiological and Histological Responses of Awassi Lambs to High Dietary Organic Copper Supplementation
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Management and Experimental Feeding
2.2. Body Biometric Measurement and Sample Collection
2.3. Mineral Analysis
2.4. Histological Analysis
2.5. Gene Expression Analysis of Blood Serum
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gowane, G.; Gadekar, Y.; Prakash, V.; Kadam, V.; Chopra, A.; Prince, L. Climate Change Impact on Sheep Production: Growth, Milk, Wool, and Meat; Springer: Singapore, 2017; pp. 31–69. [Google Scholar]
- da Cruz Ferreira Júnior, H.; da Silva, D.L.; de Carvalho, B.R.; de Oliveira, H.C.; Cunha Lima Muniz, J.; Junior Alves, W.; Eugene Pettigrew, J.; Eliza Facione Guimarães, S.; da Silva Viana, G.; Hannas, M.I. Broiler responses to copper levels and sources: Growth, tissue mineral content, antioxidant status and mRNA expression of genes involved in lipid and protein metabolism. BMC Vet. Res. 2022, 18, 223. [Google Scholar] [CrossRef] [PubMed]
- Ueda, M.; Katsuse, K.; Kakumoto, T.; Kobayashi, S.; Ishiura, H.; Mitsui, J.; Toda, T. Copper deficiency in Wilson’s disease with a normal zinc value. Intern. Med. 2023, 62, 1073–1076. [Google Scholar] [CrossRef]
- Liu, J.; Yang, X.; Sun, X.; Zhuang, C.; Xu, F.; Li, Y. Suppressive effects of copper sulfate accumulation on the spermatogenesis of rats. Biol. Trace Elem. Res. 2016, 174, 356–361. [Google Scholar] [CrossRef] [PubMed]
- Underwood, E. The Mineral Nutrition of Livestock; CAB International: Wallingford, UK, 1999. [Google Scholar]
- Spears, J.W. Trace mineral bioavailability in ruminants. Nutr. J. 2003, 133, 1506S–1509S. [Google Scholar] [CrossRef]
- Linder, M.C. Copper homeostasis in mammals, with emphasis on secretion and excretion. A review. Int. J. Mol. Sci. 2020, 21, 4932. [Google Scholar] [CrossRef]
- Minervino, A.H.H.; López-Alonso, M.; Barrêto Júnior, R.A.; Rodrigues, F.A.M.L.; Araújo, C.A.S.C.; Sousa, R.S.; Mori, C.S.; Miranda, M.; Oliveira, F.L.C.; Antonelli, A.C. Dietary zinc supplementation to prevent chronic copper poisoning in sheep. Animals 2018, 8, 227. [Google Scholar] [CrossRef] [PubMed]
- Borobia, M.; Villanueva-Saz, S.; Ruiz de Arcaute, M.; Fernández, A.; Verde, M.T.; González, J.M.; Navarro, T.; Benito, A.A.; Arnal, J.L.; De las Heras, M. Copper poisoning, a deadly hazard for sheep. Animals 2022, 12, 2388. [Google Scholar] [CrossRef]
- Amaral, F.; Grazziotin, R.; Machado, M.; Hasse, L.; Frata, M.; Blanco, C.; Gonçalves, F.; Ribeiro-Filho, H.; Bermudes, R.; Del Pino, F. Limits of grape byproduct inclusion in diets for lambs: Zinc supplementation to prevent copper poisoning. Res. J. Vet. Sci. 2019, 124, 334–337. [Google Scholar]
- Abdan, A.; Saeed, O. Growth performance, rumen fermentation, and nutrient digestibility of awassi lambs fed different levels of organic copper in a basal diet. Anbar J. Agric. Sci. 2024, 22, 1542–1556. [Google Scholar] [CrossRef]
- Bautista-Díaz, E.; Salazar-Cuytun, R.; Chay-Canul, A.J.; Herrera, R.A.G.; Piñeiro-Vázquez, Á.T.; Monforte, J.G.M.; Tedeschi, L.O.; Cruz-Hernández, A.; Gómez-Vázquez, A. Determination of carcass traits in Pelibuey ewes using biometric measurements. Small Rumin. Res. 2017, 147, 115–119. [Google Scholar]
- Saito, S. The effect of copper on zinc in rat liver and metallothionein in a time-course study. Trace Elem. Electrolytes 2020, 37, 166. [Google Scholar] [CrossRef]
- Rasool, G.; Jaiswal, P.; Jain, A.; Sharma, S.K. Histomorphometric study of renal corpuscles of human and goat. Natl. J. Clin. Anat. 2021, 10, 205–208. [Google Scholar] [CrossRef]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
- Malisetty, V.; Yerradoddi, R.R.; Marrivada, S.R. Effect of feeding crop residues based complete rations on growth in ram lambs. Int. J. Sci. Environ. Technol 2013, 2, 15–19. [Google Scholar]
- Khaleel, B.S.; Mansoor, A.R. Effect of Rearing System and Physical form of the Total Mixed Ration on Growth Performance of Local Male Lambs. IOP Conf. Ser. Earth Environ. Sci. 2023, 1259, 012078. [Google Scholar] [CrossRef]
- Garrine, C.M.L.P.; Yoshikawa, C.Y.C.; Conti, R.M.C.; Correa, L.B.; Pugine, S.M.P.; Tchamo, C.; Pondja, A.; de Carvalho Balieiro, J.C.; Zanetti, M.A. Effects of different sources and levels of copper on lipid metabolism in Merino× Texel lambs. Meat Sci. 2019, 155, 85–90. [Google Scholar] [CrossRef]
- Vaswani, S.; Kumar, V.; Roy, D.; Kumar, M.; Kushwaha, R. Effect of different sources of copper supplementation on performance, nutrient utilization, blood-biochemicals and plasma mineral status of growing Hariana heifers. Indian J. Anim. Sci. 2018, 88, 812–818. [Google Scholar] [CrossRef]
- Eren, V.; Güleş, Ö.; Gökdal, Ö.; Eren, Ü.; Ünübol Aypak, S. The effect of dietary organic copper and zinc trace minerals on some yield and mineral levels and histological structure of testes. Biol. Trace Elem. Res. 2024, 202, 5522–5530. [Google Scholar] [CrossRef]
- Deribe, B.; Beyene, D.; Dagne, K.; Getachew, T.; Gizaw, S. Predicting body weight of three Ethiopian thin-tailed sheep breeds from linear body measurements. J. Nat. Sci. Res. 2018, 8, 25–32. [Google Scholar]
- Costa, R.G.; Lima, A.G.V.d.O.; Ribeiro, N.L.; Medeiros, A.N.d.; Medeiros, G.R.d.; Gonzaga Neto, S.; Oliveira, R.L. Predicting the carcass characteristics of Morada Nova lambs using biometric measurements. Rev. Bras. Zootec. 2020, 49, e20190179. [Google Scholar] [CrossRef]
- Zhang, A.L.; Wu, B.P.; Wuyun, C.T.; Jiang, D.X.; Xuan, E.C.; Ma, F.Y. Algorithm of sheep body dimension measurement and its applications based on image analysis. Comput. Electron. Agric. 2018, 153, 33–45. [Google Scholar] [CrossRef]
- Heidari, A.H.; Zamiri, M.J.; Nazem, M.N.; Shirazi, M.R.J.; Akhlaghi, A.; Pirsaraei, Z.A. Detrimental effects of long-term exposure to heavy metals on histology, size and trace elements of testes and sperm parameters in Kermani Sheep. Ecotoxicol. Environ. Saf. 2021, 207, 111563. [Google Scholar] [CrossRef] [PubMed]
- Kheirandish, R.; Askari, N.; Babaei, H. Zinc therapy improves deleterious effects of chronic copper administration on mice testes: Histopathological evaluation. Andrologia 2014, 46, 80–85. [Google Scholar] [PubMed]
- Martínez, J.; Limas, T.; Peron, N. Daily production and testicular and epididymal sperm reserves of Pelibuey rams. Theriogenology 1994, 41, 1595–1599. [Google Scholar]
- Krishnaiah, M.V.; Arangasamy, A.; Selvaraju, S.; Guvvala, P.; Ramesh, K. Organic Zn and Cu interaction impact on sexual behaviour, semen characteristics, hormones and spermatozoal gene expression in bucks (Capra hircus). Theriogenology 2019, 130, 130–139. [Google Scholar]
- Mohammed, A.J.; Al-Ameri, M.H.; Saleh, I.D.; Salih, N.D.; Majeed, A.; Hasan, M.S. Effect of age on semen parameters and sperm dna fragmentation in iraqi awassi rams. Biochem. Cell. Arch. 2019, 19, 3787–3791. [Google Scholar]
- Saeed, O.A.; Kee, L.T.; Sazili, A.Q.; Akit, H.; Jahromi, M.F.; Alimon, A.R.; Samsudin, A.A. Effects of corn supplementation on the antioxidant activity, selected minerals, and gene expression of selenoprotein and metallothionein in serum, liver, and kidney of sheep-fed palm kernel cake: Urea-treated rice straw diets. 3 Biotech 2019, 9, 146. [Google Scholar]
- Netto, A.S.; Zanetti, M.A.; Correa, L.B.; Del Claro, G.R.; Salles, M.S.V.; Vilela, F.G. Effects of dietary selenium, sulphur and copper levels on selenium concentration in the serum and liver of lamb. Asian-Australas. J. Anim. Sci. 2014, 27, 1082. [Google Scholar]
- Hyun, C.; Filippich, L.J. Inherited copper toxicosis with emphasis on copper toxicosis in Bedlington terriers. J. Exp. Anim. Sci. 2004, 43, 39–64. [Google Scholar] [CrossRef]
- Barman, S.; Pradeep, S.R.; Srinivasan, K. Zinc supplementation mitigates its dyshomeostasis in experimental diabetic rats by regulating the expression of zinc transporters and metallothionein. Metallomics 2017, 9, 1765–1777. [Google Scholar]
- Jarad, A.S.; Majeed, A.S.F.; Aboud, Q.M.; Hasan, M.S.; Aboud, W.H.F.A.E. Pathological study of reproductive tracts of Awassi ewes in Fallujah, Iraq. Indian J. Forensic. Med. Toxicol. 2021, 15, 2342–2346. [Google Scholar]
- Li, W.; Chang, N.; Li, L. Heterogeneity and function of kupffer cells in liver injury. Front. Immunol. 2022, 13, 940867. [Google Scholar]
- Saeed, O.; Jaber, B.T.; Sanı, U.M.; Sazılı, A.Q.; Akıt, H.; Alımon, A.R.; Samsudın, A.A. Histopathological effects of different levels of palm kernel cake fed to Dorper lambs. Yuz. Yil Univ. J. Agric. Sci. 2021, 31, 807–812. [Google Scholar]
- Gupta, R. A review of copper poisoning in animals: Sheep, goat and cattle. Int. J. Vet. Sci. Anim. Husb. 2018, 3, 1–4. [Google Scholar]
- Huwaish, M.; Mohammed, T. Effect of administering n-acytl cysteine with selenium or zinc on the hematological characteristics of local ewes. Anbar J. Agric. Sci. 2023, 21, 528–537. [Google Scholar]
- Xue, J.; Xie, L.; Liu, B.; Zhou, L.; Hu, Y.; Ajuwon, K.M.; Fang, R. Dietary supplementation of EGF ameliorates the negatively effects of LPS on early-weaning piglets: From views of growth performance, nutrient digestibility, microelement absorption and possible mechanisms. Animals 2021, 11, 1598. [Google Scholar] [CrossRef]
- da Silva, E.S.; Abril, S.I.M.; Zanette, J.; Bianchini, A. Salinity-dependent copper accumulation in the guppy Poecilia vivipara is associated with CTR1 and ATP7B transcriptional regulation. Aquat. Toxicol. 2014, 152, 300–307. [Google Scholar]
- La Fontaine, S.; Mercer, J.F. Trafficking of the copper-ATPases, ATP7A and ATP7B: Role in copper homeostasis. Arch. Biochem. Biophys. 2007, 463, 149–167. [Google Scholar]
- Lockhart, P.J.; Mercer, J.F. Functional analysis of the sheep Wilson disease protein (sATP7B) in CHO cells. Eur. J. Cell Biol. 2001, 80, 349–357. [Google Scholar] [CrossRef]
- Kindler, J.; Pollock, N.; Laing, E.; Jenkins, N.; Oshri, A.; Isales, C.; Hamrick, M.; Lewis, R. Insulin resistance negatively influences the muscle-dependent IGF-1-bone mass relationship in premenarcheal girls. J. Clin. Endocr. 2016, 101, 199–205. [Google Scholar] [CrossRef]
- Khdhr, D.; Karim, K. Cytogenetic study of the hamdani sheep breed of the Iraqi kurdistan region. Anbar J. Agric. Sci. 2024, 22, 913–924. [Google Scholar] [CrossRef]




| Dietary Ingredient (g/kg) | T1 | T2 | T3 |
|---|---|---|---|
| Wheat straw | 300 | 300 | 300 |
| Rolled barley | 400 | 399.5 | 399 |
| Cracked wheat | 150 | 150 | 150 |
| Soyabean meal (44%) | 120 | 120 | 120 |
| Copper proteinate | 0 | 0.5 | 1 |
| Limestone | 10 | 10 | 10 |
| Salt | 10 | 10 | 10 |
| Vitamin–mineral mix | 10 | 10 | 10 |
| Total | 1000 | 1000 | 1000 |
| Chemical composition (%) | |||
| DM | 90.0 | 90.2 | 90.5 |
| OM | 95.0 | 94.5 | 94.0 |
| Ash | 5.0 | 5.5 | 6.0 |
| CP | 14.0 | 14.5 | 14.2 |
| EE | 2.5 | 2.3 | 2.2 |
| CF | 13.0 | 12.8 | 12.5 |
| Cu (ppm) | 6.18 | 81.68 | 156.75 |
| Genes | Primer Sequences (5′–3′) | Annealing Temperature (°C) | Accession Number |
|---|---|---|---|
| IGF1 | F: CAGGAGCACGAGAGGAAGAGA R: GATGGTACGTGACAAGGCAGG | 79 | XM_060411608.1 |
| ATP7A | F: AAGAGGAGGGGAAACGGGTAG R: GCTGCTTCAATGGCTACGTCT | 83 | XM_004022208.6 |
| ATP7B | F: GGCAGTCATCACTTACCAGCC R: CGTCTATGGGTCCCAGGCTTA | 79 | XM_060394019.1 |
| GAPDH | F: ACCACTTTGGCATCGTGGAG R: GGGCCATCCACAGTCTTCTG | 61 | XM_060411595.1 |
| Parameters | Body Weight (kg) | Height at Withers | Rib Depth | Body Diagonal Length | Body Length | Pelvic Girdle Length | Rump Depth | Rump Height | Pin Bone Width | Hook Bone Width | Abdomen Width | Girth Circumference | Abdomen Circumference |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| T1 | 33.66 | 64.00 b | 19.66 | 94.66 | 36.33 | 19.00 | 28.00 | 55.00 b | 23.33 | 24.00 | 43.00 | 51.33 | 99.00 |
| T2 | 29.75 | 61.50 b | 16.50 | 88.33 | 31.66 | 17.33 | 25.33 | 64.00 a | 27.66 | 25.00 | 43.66 | 56.00 | 93.66 |
| T3 | 35.89 | 67.00 a | 23.00 | 92.50 | 35.00 | 21.00 | 22.00 | 62.00 b | 30.00 | 28.50 | 44.50 | 45.00 | 96.50 |
| SEM | 1.36 | 1.02 | 1.24 | 2.38 | 1.12 | 0.98 | 1.12 | 1.80 | 2.10 | 0.89 | 0.94 | 1.87 | 2.12 |
| p value | 0.1917 | 0.0236 | 0.2219 | 0.5850 | 0.1970 | 0.4168 | 0.0994 | 0.0236 | 0.5721 | 0.0526 | 0.8697 | 0.1177 | 0.6310 |
| Parameters | Scrotum Length | Scrotum Width | Scrotum Height | Scrotum Circumference | Scrotum Thickness | Testicular Length | Testicular Width |
|---|---|---|---|---|---|---|---|
| T1 | 9.90 | 8.84 | 31.33 | 24.66 | 0.34 | 7.73 a,b | 4.55 |
| T2 | 10.91 | 7.90 | 27.66 | 24.66 | 0.33 | 6.20 b | 3.98 |
| T3 | 9.29 | 7.73 | 26.50 | 26.00 | 0.36 | 8.99 a | 4.09 |
| SEM | 0.38 | 0.35 | 1.38 | 0.85 | 0.02 | 0.49 | 0.17 |
| p value | 0.2434 | 0.4592 | 0.3909 | 0.8116 | 0.8553 | 0.0498 | 0.4921 |
| Tissue | T1 | T2 | T3 | SEM | p Value |
|---|---|---|---|---|---|
| Liver | |||||
| Cu | 26.95 b | 192.44 a | 276.44 a | 30.121 | 0.001 |
| Zn | 99.34 | 93.56 | 106.34 | 4.143 | 0.5434 |
| Kidney | |||||
| Cu | 20.98 | 15.76 | 21.00 | 1.700 | 0.4005 |
| Zn | 102.24 a | 72.84 b | 95.64 b | 5.528 | 0.0434 |
| Testis | |||||
| Cu | 12.51 | 16.17 | 10.12 | 1.212 | 0.0574 |
| Zn | 95.42 | 95.62 | 96.06 | 1.643 | 0.9893 |
| Parameters | T1 | T2 | T3 | SEM | p Value |
|---|---|---|---|---|---|
| Renal glomerulus diameter (mm2) | |||||
| Maximum | 3.40 | 4.03 | 3.43 | 0.470 | 0.8514 |
| Minimum | 2.55 | 3.93 | 2.92 | 0.398 | 0.3775 |
| Mean | 2.97 | 3.98 | 3.17 | 0.380 | 0.6392 |
| Renal corpuscle diameter (mm2) | |||||
| Maximum | 4.30 | 3.30 | 2.92 | 0.290 | 0.2044 |
| Minimum | 2.95 | 3.06 | 2.15 | 0.426 | 0.4122 |
| Mean | 3.63 | 3.18 | 2.39 | 0.329 | 0.3258 |
| Hepatic parenchymal swelling (mm2) | 0.60 b | 0.87 b | 2.45 a | 0.246 | 0.001 |
| Hepatocytes with vacuolated appearance (mm2) | 0.11 b | 0.67 b | 1.25 a | 0.141 | 0.001 |
| Necrosis of isolated Parenchymal cells (mm2) | 0.34 b | 0.13 b | 0.57 a | 0.056 | 0.001 |
| Proliferation of epithelial cells of bile ducts (mm2) | 0.21 b | 0.47 a,b | 0.86 a | 0.081 | 0.001 |
| Numerous kupffer cells (Cell) | 15.00 a | 16.50 a | 11.50 b | 0.699 | 0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saeed, O.A.; Shareef, M.A.; Alnori, H.M.; Leo, T.K.; Al-Bayar, M.A.; Abed, I.A.; Attallah, O.K. Physiological and Histological Responses of Awassi Lambs to High Dietary Organic Copper Supplementation. Animals 2025, 15, 1066. https://doi.org/10.3390/ani15071066
Saeed OA, Shareef MA, Alnori HM, Leo TK, Al-Bayar MA, Abed IA, Attallah OK. Physiological and Histological Responses of Awassi Lambs to High Dietary Organic Copper Supplementation. Animals. 2025; 15(7):1066. https://doi.org/10.3390/ani15071066
Chicago/Turabian StyleSaeed, Osama A., Mohanad A. Shareef, Hassan M. Alnori, Teik K. Leo, Mohammed A. Al-Bayar, Idham A. Abed, and Omar K. Attallah. 2025. "Physiological and Histological Responses of Awassi Lambs to High Dietary Organic Copper Supplementation" Animals 15, no. 7: 1066. https://doi.org/10.3390/ani15071066
APA StyleSaeed, O. A., Shareef, M. A., Alnori, H. M., Leo, T. K., Al-Bayar, M. A., Abed, I. A., & Attallah, O. K. (2025). Physiological and Histological Responses of Awassi Lambs to High Dietary Organic Copper Supplementation. Animals, 15(7), 1066. https://doi.org/10.3390/ani15071066

