Menaquinone-4 Suppresses Lipopolysaccharide-Induced Inflammation in MG6 Mouse Microglia-Derived Cells by Inhibiting the NF-κB Signaling Pathway
Abstract
1. Introduction
2. Results
2.1. Effect of MK-4 Pretreatment Time on LPS-Induced Inflammatory Cytokine Expression in MG6 Cells
2.2. Effect of MK-4 on Inflammatory Cytokine and Inflammatory Mediator Expression in LPS-Stimulated MG6 Cells
2.3. Effect of MK-4 on Inflammatory Cytokine Expression in TNF-α-Stimulated MG6 cells
2.4. Effect of Vitamin K Analogs on Inflammatory Cytokine Expression in LPS-Stimulated MG6 Cells
2.5. Effect of MK-4 on the Phosphorylation of Inflammation-Related Proteins in LPS-Stimulated MG6 Cells
2.6. Effect of MK-4 on the Nuclear Localization of NF-κB p65 in LPS-Stimulated MG6 Cells
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture
4.3. WST-1 Assays
4.4. RNA Extraction and Quantitative Reverse Transcriptase Polymerase Chain Reaction
4.5. Western Blot Analysis
4.6. Fluorescence Microscopy
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| AD | Alzheimer’s disease |
| CNS | Central nervous system |
| LPS | Lipopolysaccharide |
| MK-3 | Menaquinone-3 |
| MK-4 | Menaquinone-4 |
| MK-7 | Menaquinone-7 |
References
- Morales, I.; Guzmán-Martínez, L.; Cerda-Troncoso, C.; Farías, G.A.; Maccioni, R.B. Neuroinflammation in the pathogenesis of Alzheimer’s disease. A rational framework for the search of novel therapeutic approaches. Front. Cell. Neurosci. 2014, 8, 112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McManus, R.M.; Heneka, M.T. Role of neuroinflammation in neurodegeneration: New insights. Alzheimers Res. 2017, 9, 14. [Google Scholar] [CrossRef] [Scilit]
- Calsolaro, V.; Edison, P. Neuroinflammation in Alzheimer’s disease: Current evidence and future directions. Alzheimers Dement. 2016, 12, 719–732. [Google Scholar] [CrossRef] [Scilit]
- Akiyama, H. Inflammatory response in Alzheimer’s disease. Tohoku J. Exp. Med. 1994, 174, 295–303. [Google Scholar] [CrossRef] [Scilit]
- Streit, W.J.; Mrak, R.E.; Griffin, W.S.T. Microglia and neuroinflammation: A pathological perspective. J. Neuroinflammation 2004, 1, 14. [Google Scholar] [CrossRef] [Scilit]
- Akiyama, H.; Barger, S.; Barnum, S.; Bradt, B.; Bauer, J.; Cole, G.M.; Cooper, N.R.; Eikelenboom, P.; Emmerling, M.; Fiebich, B.L.; et al. Inflammation and Alzheimer’s disease. Neurobiol. Aging 2000, 21, 383–421. [Google Scholar] [CrossRef] [Scilit]
- Biesmans, S.; Meert, T.F.; Bouwknecht, J.A.; Acton, P.D.; Davoodi, N.; De Haes, P.; Kuijlaars, J.; Langlois, X.; Matthews, L.J.R.; Ver Donck, L.; et al. Systemic Immune Activation Leads to Neuroinflammation and Sickness Behavior in Mice. Available online: https://www.hindawi.com/journals/mi/2013/271359/ (accessed on 25 April 2019).
- Li, Q.; Verma, I.M. NF-κB regulation in the immune system. Nat. Rev. Immunol. 2002, 2, 725–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yanagitai, M.; Itoh, S.; Kitagawa, T.; Takenouchi, T.; Kitani, H.; Satoh, T. Carnosic acid, a pro-electrophilic compound, inhibits LPS-induced activation of microglia. Biochem. Biophys. Res. Commun. 2012, 418, 22–26. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; Ni, J.; Liu, Y.; Teeling, J.L.; Takayama, F.; Collcutt, A.; Ibbett, P.; Nakanishi, H. Cathepsin B plays a critical role in inducing Alzheimer’s disease-like phenotypes following chronic systemic exposure to lipopolysaccharide from Porphyromonas gingivalis in mice. Brain. Behav. Immun. 2017, 65, 350–361. [Google Scholar] [CrossRef] [Scilit]
- Inoue, T.; Tanaka, M.; Masuda, S.; Ohue-Kitano, R.; Yamakage, H.; Muranaka, K.; Wada, H.; Kusakabe, T.; Shimatsu, A.; Hasegawa, K.; et al. Omega-3 polyunsaturated fatty acids suppress the inflammatory responses of lipopolysaccharide-stimulated mouse microglia by activating SIRT1 pathways. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2017, 1862, 552–560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakamichi, K.; Saiki, M.; Kitani, H.; Kuboyama, Y.; Morimoto, K.; Takayama-Ito, M.; Kurane, I. Suppressive effect of simvastatin on interferon-β-induced expression of CC chemokine ligand 5 in microglia. Neurosci. Lett. 2006, 407, 205–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takenouchi, T.; Ogihara, K.; Sato, M.; Kitani, H. Inhibitory effects of U73122 and U73343 on Ca2+ influx and pore formation induced by the activation of P2X7 nucleotide receptors in mouse microglial cell line. Biochim. Biophys. Acta Gen. Subj. 2005, 1726, 177–186. [Google Scholar] [CrossRef] [Scilit]
- Ferland, G. Vitamin K, an emerging nutrient in brain function. BioFactors 2012, 38, 151–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shearer, M.J.; Newman, P. Metabolism and cell biology of vitamin K. Thromb. Haemost. 2008, 100, 530–547. [Google Scholar]
- Yamamoto, R.; Komai, M.; Kojima, K.; Furukawa, Y.; Kimura, S. Menaquinone-4 Accumulation in Various Tissues after and Oral Administration of Phylloquinone in Wistar Rats. J. Nutr. Sci. Vitam. 1997, 43, 133–143. [Google Scholar] [CrossRef] [Scilit]
- Thijssen, H.H.; Drittij-Reijnders, M.J. Vitamin K distribution in rat tissues: Dietary phylloquinone is a source of tissue menaquinone-4. Br. J. Nutr. 1994, 72, 415–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okano, T.; Shimomura, Y.; Yamane, M.; Suhara, Y.; Kamao, M.; Sugiura, M.; Nakagawa, K. Conversion of Phylloquinone (Vitamin K1) into Menaquinone-4 (Vitamin K2) in Mice Two Possible Routes for Menaquinone-4 Accumulation in Cerebra Of Mice. J. Biol. Chem. 2008, 283, 11270–11279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thijssen, H.H.; Drittij-Reijnders, M.J.; Fischer, M.A. Phylloquinone and menaquinone-4 distribution in rats: Synthesis rather than uptake determines menaquinone-4 organ concentrations. J. Nutr. 1996, 126, 537–543. [Google Scholar] [CrossRef] [Scilit]
- Yoshida, T.; Miyazawa, K.; Kasuga, I.; Yokoyama, T.; Minemura, K.; Ustumi, K.; Aoshima, M.; Ohyashiki, K. Apoptosis induction of vitamin K2 in lung carcinoma cell lines: The possibility of vitamin K2 therapy for lung cancer. Int. J. Oncol. 2003, 23, 627–632. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amalia, H.; Sasaki, R.; Suzuki, Y.; Demizu, Y.; Bito, T.; Nishimura, H.; Okamoto, Y.; Yoshida, K.; Miyawaki, D.; Kawabe, T.; et al. Vitamin K2-derived compounds induce growth inhibition in radioresistant cancer cells. Kobe J. Med. Sci. 2010, 56, E38–E49. [Google Scholar] [PubMed]
- Duan, F.; Yu, Y.; Guan, R.; Xu, Z.; Liang, H.; Hong, L. Vitamin K2 Induces Mitochondria-Related Apoptosis in Human Bladder Cancer Cells via ROS and JNK/p38 MAPK Signal Pathways. PLoS ONE 2016, 11, e0161886. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nimptsch, K.; Rohrmann, S.; Kaaks, R.; Linseisen, J. Dietary vitamin K intake in relation to cancer incidence and mortality: Results from the Heidelberg cohort of the European Prospective Investigation into Cancer and Nutrition (EPIC-Heidelberg). Am. J. Clin. Nutr. 2010, 91, 1348–1358. [Google Scholar] [CrossRef] [Scilit]
- Shibayama-Imazu, T.; Aiuchi, T.; Nakaya, K. Vitamin K2-Mediated Apoptosis in Cancer Cells: Role of Mitochondrial Transmembrane Potential. Vitamins Hormones 2008, 78, 211–226. [Google Scholar]
- Yokoyama, T.; Miyazawa, K.; Naito, M.; Toyotake, J.; Tauchi, T.; Itoh, M.; Yuo, A.; Hayashi, Y.; Georgescu, M.-M.; Kondo, Y.; et al. Vitamin K2 induces autophagy and apoptosis simultaneously in leukemia cells. Autophagy 2008, 4, 629–640. [Google Scholar] [CrossRef] [Scilit]
- Tsang, C.K.; Kamei, Y. Novel effect of vitamin K1 (phylloquinone) and vitamin K2 (menaquinone) on promoting nerve growth factor-mediated neurite outgrowth from PC12D cells. Neurosci. Lett. 2002, 323, 9–12. [Google Scholar] [CrossRef] [Scilit]
- Ho, H.-J.; Shirakawa, H.; Komai, M. Menaquinone-4 Enhances Steroidogenesis in Testis Derived Tumor Cells Via the Elevation of cAMP Level. In Vitam. K2-Vital for Health Wellbeing; IntechOpen: London, UK, 2017. [Google Scholar]
- Ito, A.; Shirakawa, H.; Takumi, N.; Minegishi, Y.; Ohashi, A.; Howlader, Z.H.; Ohsaki, Y.; Sato, T.; Goto, T.; Komai, M. Menaquinone-4 enhances testosterone production in rats and testis-derived tumor cells. Lipids Health Dis. 2011, 10, 158. [Google Scholar] [CrossRef] [Scilit]
- Sultana, H.; Watanabe, K.; Rana, M.M.; Takashima, R.; Ohashi, A.; Komai, M.; Shirakawa, H. Effects of Vitamin K2 on the Expression of Genes Involved in Bile Acid Synthesis and Glucose Homeostasis in Mice with Humanized PXR. Nutrients 2018, 10, 982. [Google Scholar] [CrossRef] [Scilit]
- Ichikawa, T.; Horie-Inoue, K.; Ikeda, K.; Blumberg, B.; Inoue, S. Steroid and Xenobiotic Receptor SXR Mediates Vitamin K2-activated Transcription of Extracellular Matrix-related Genes and Collagen Accumulation in Osteoblastic Cells. J. Biol. Chem. 2006, 281, 16927–16934. [Google Scholar] [CrossRef] [Scilit]
- Igarashi, M.; Yogiashi, Y.; Mihara, M.; Takada, I.; Kitagawa, H.; Kato, S. Vitamin K induces osteoblast differentiation through pregnane X receptor-mediated transcriptional control of the Msx2 gene. Mol. Cell. Biol. 2007, 27, 7947–7954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohsaki, Y.; Shirakawa, H.; Hiwatashi, K.; Furukawa, Y.; Mizutani, T.; Komai, M. Vitamin K suppresses lipopolysaccharide-induced inflammation in the rat. Biosci. Biotechnol. Biochem. 2006, 70, 926–932. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohsaki, Y.; Shirakawa, H.; Miura, A.; Giriwono, P.E.; Sato, S.; Ohashi, A.; Iribe, M.; Goto, T.; Komai, M. Vitamin K suppresses the lipopolysaccharide-induced expression of inflammatory cytokines in cultured macrophage-like cells via the inhibition of the activation of nuclear factor κB through the repression of IKKα/β phosphorylation. J. Nutr. Biochem. 2010, 21, 1120–1126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shirakawa, H.; Tomoko, K.; Komai, M. Conversion of Menaquinone-4 in Animal Organs and its Functions. J. Jpn. Oil Chem. Soc. 2014, 14, 547–553. [Google Scholar]
- Bradley, J.R. TNF-mediated inflammatory disease. J. Pathol. 2008, 214, 149–160. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parameswaran, N.; Patial, S. Tumor Necrosis Factor-α Signaling in Macrophages. Crit. Rev. Eukaryot. Gene Exp. 2010, 20, 87–103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cherry, J.D.; Olschowka, J.A.; O’Banion, M.K. Neuroinflammation and M2 microglia: The good, the bad, and the inflamed. J. Neuroinflammation 2014, 11, 98. [Google Scholar] [CrossRef] [Scilit]
- Verhelst, K.; Carpentier, I.; Beyaert, R. Regulation of TNF-induced NF-κB activation by different cytoplasmic ubiquitination events. Cytokine Growth Factor Rev. 2011, 22, 277–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manna, S.K.; Aggarwal, B.B. IL-13 Suppresses TNF-Induced Activation of Nuclear Factor-κB, Activation Protein-1, and Apoptosis. J. Immunol. 1998, 161, 2863–2872. [Google Scholar] [PubMed]
- Magder, S.; Neculcea, J.; Neculcea, V.; Sladek, R. Lipopolysaccharide and TNF-α Produce Very Similar Changes in Gene Expression in Human Endothelial Cells. J. Vasc. Res. 2006, 43, 447–461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Y.; Li, Y.; Gao, F.; Hu, Q.; Zhang, Y.; Chen, D.; Wang, G. Vitamin K2 suppresses rotenone-induced microglial activation in vitro. Acta Pharm. Sin. 2016, 37, 1178–1189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, C.; Zhu, L.; Li, H.; Shi, F.-G.; Wang, G.-Q.; Wei, Y.-Z.; Liu, J.; Zhang, F. Adulthood Exposure to Lipopolysaccharide Exacerbates the Neurotoxic and Inflammatory Effects of Rotenone in the Substantia Nigra. Front. Mol. Neurosci. 2017, 10, 131. [Google Scholar] [CrossRef] [Scilit]
- Fan, L.-W.; Tien, L.-T.; Lin, R.C.S.; Simpson, K.L.; Rhodes, P.G.; Cai, Z. Neonatal exposure to lipopolysaccharide enhances vulnerability of nigrostriatal dopaminergic neurons to rotenone neurotoxicity in later life. Neurobiol. Dis. 2011, 44, 304–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harshman, S.G.; Shea, M.K. The Role of Vitamin K in Chronic Aging Diseases: Inflammation, Cardiovascular Disease, and Osteoarthritis. Curr. Nutr. Rep. 2016, 5, 90–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shea, M.K.; Booth, S.L.; Massaro, J.M.; Jacques, P.F.; D’Agostino, R.B.; Dawson-Hughes, B.; Ordovas, J.M.; O’Donnell, C.J.; Kathiresan, S.; Keaney, J.F.; et al. Vitamin K and Vitamin D Status: Associations with Inflammatory Markers in the Framingham Offspring Study. Am. J. Epidemiol. 2008, 167, 313–320. [Google Scholar] [CrossRef] [Scilit]
- Shea, M.K.; Dallal, G.E.; Dawson-Hughes, B.; Ordovas, J.M.; O’Donnell, C.J.; Gundberg, C.M.; Peterson, J.W.; Booth, S.L. Vitamin K, circulating cytokines, and bone mineral density in older men and women. Am. J. Clin. Nutr. 2008, 88, 356–363. [Google Scholar] [CrossRef] [Scilit]
- Presse, N.; Shatenstein, B.; Kergoat, M.-J.; Ferland, G. Low Vitamin K Intakes in Community-Dwelling Elders at an Early Stage of Alzheimer’s Disease. J. Am. Diet. Assoc. 2008, 108, 2095–2099. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Allison, A.C. The possible role of vitamin K deficiency in the pathogenesis of Alzheimer’s disease and in augmenting brain damage associated with cardiovascular disease. Med. Hypotheses 2001, 57, 151–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mitsumasa, S.; Tomoko, Y.; Kouzi, Y.; Yutaka, M.; Tadashi, S.; Kiyoshi, K.; Kazuo, O. Determination of Menaquinone-4 in Plasma after Administration of Menaquinone-4 Dosage Forms in Healthy Human Subjects. Yakugaku Zasshi 1982, 102, 651–658. [Google Scholar]







| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Il-1β | CTGTGTCTTTCCCGTGGACC | CAGCTCATATGGGTCCGACA |
| Tnf-α | GACGTGGAACTGGCAGAAGAG | TCTGGAAGCCCCCCATCT |
| Il-6 | AGAGGAGACTTCACAGAGGATACC | AATCAGAATTGCCATTGCACAAC |
| Cox-2 | TGAGTACCGCAAACGCTTCT | CAGCCATTTCCTTCTCTCCTGT |
| IκBα | CTTGGGTGCTGATGTCAATG | ACCAGGTCAGGATTTTGCAG |
| Eef1a1 | GATGGCCCCAAATTCTTGAAG | GGACCATGTCAACAATTGCAG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saputra, W.D.; Aoyama, N.; Komai, M.; Shirakawa, H. Menaquinone-4 Suppresses Lipopolysaccharide-Induced Inflammation in MG6 Mouse Microglia-Derived Cells by Inhibiting the NF-κB Signaling Pathway. Int. J. Mol. Sci. 2019, 20, 2317. https://doi.org/10.3390/ijms20092317
Saputra WD, Aoyama N, Komai M, Shirakawa H. Menaquinone-4 Suppresses Lipopolysaccharide-Induced Inflammation in MG6 Mouse Microglia-Derived Cells by Inhibiting the NF-κB Signaling Pathway. International Journal of Molecular Sciences. 2019; 20(9):2317. https://doi.org/10.3390/ijms20092317
Chicago/Turabian StyleSaputra, Wahyu Dwi, Nao Aoyama, Michio Komai, and Hitoshi Shirakawa. 2019. "Menaquinone-4 Suppresses Lipopolysaccharide-Induced Inflammation in MG6 Mouse Microglia-Derived Cells by Inhibiting the NF-κB Signaling Pathway" International Journal of Molecular Sciences 20, no. 9: 2317. https://doi.org/10.3390/ijms20092317
APA StyleSaputra, W. D., Aoyama, N., Komai, M., & Shirakawa, H. (2019). Menaquinone-4 Suppresses Lipopolysaccharide-Induced Inflammation in MG6 Mouse Microglia-Derived Cells by Inhibiting the NF-κB Signaling Pathway. International Journal of Molecular Sciences, 20(9), 2317. https://doi.org/10.3390/ijms20092317

